ID: 1136374744

View in Genome Browser
Species Human (GRCh38)
Location 16:29858900-29858922
Sequence CTCGGACCCCAGGACTGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136374735_1136374744 14 Left 1136374735 16:29858863-29858885 CCTCACACCACCTCCCTCACTCA 0: 1
1: 1
2: 4
3: 129
4: 1264
Right 1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 188
1136374734_1136374744 15 Left 1136374734 16:29858862-29858884 CCCTCACACCACCTCCCTCACTC 0: 1
1: 1
2: 8
3: 106
4: 1031
Right 1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 188
1136374739_1136374744 0 Left 1136374739 16:29858877-29858899 CCTCACTCAAGCGTCCCTAGCAT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 188
1136374733_1136374744 20 Left 1136374733 16:29858857-29858879 CCTGGCCCTCACACCACCTCCCT 0: 1
1: 0
2: 3
3: 82
4: 817
Right 1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 188
1136374736_1136374744 7 Left 1136374736 16:29858870-29858892 CCACCTCCCTCACTCAAGCGTCC 0: 1
1: 0
2: 0
3: 36
4: 538
Right 1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 188
1136374738_1136374744 1 Left 1136374738 16:29858876-29858898 CCCTCACTCAAGCGTCCCTAGCA 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 188
1136374737_1136374744 4 Left 1136374737 16:29858873-29858895 CCTCCCTCACTCAAGCGTCCCTA 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136374744 Original CRISPR CTCGGACCCCAGGACTGAGC AGG Exonic
900110062 1:1001588-1001610 CTCGGACCCCACGTCTAATCTGG + Intergenic
900640427 1:3685706-3685728 CTGGGACCCCTGGAGTTAGCGGG - Intronic
901067105 1:6499394-6499416 CTCTGACCCCTGGTCTCAGCAGG + Intronic
901494779 1:9614724-9614746 CTGGGACCGCAGGTCTGGGCAGG - Exonic
902203448 1:14850999-14851021 CTCTGATCCCAGCACTGTGCAGG - Intronic
903261665 1:22134874-22134896 CTGGGAACCCAGGACTAAGAGGG - Intronic
906580309 1:46930380-46930402 CCCTGACCCCAGCCCTGAGCTGG + Intronic
906603415 1:47148510-47148532 CCCTGACCCCAGCCCTGAGCTGG - Intronic
913278102 1:117158557-117158579 CTAGGACCCCAGGCCTGTGATGG + Intronic
914420310 1:147522701-147522723 CTCAGACCTCAGCACTGGGCTGG + Intergenic
914858068 1:151366443-151366465 CTCCCACCCCAGGACTGTACGGG - Exonic
917600251 1:176566545-176566567 CTCAGACCACAGGAATGAGATGG + Intronic
922516692 1:226213222-226213244 CTCCCACCCCCAGACTGAGCAGG + Intergenic
1062823314 10:550838-550860 CTGGGACCCCAGGCCTGGCCGGG + Intronic
1064288055 10:14010099-14010121 CACCGACCCCAAAACTGAGCTGG - Intronic
1065513790 10:26505454-26505476 CTGGGCACCCAGGACTGAGCAGG - Intronic
1067079569 10:43205506-43205528 CCTGGAGCCCAGGGCTGAGCTGG - Intronic
1069574470 10:69516941-69516963 CTGGGCCCCCAGGACTCAGTGGG + Intergenic
1069982193 10:72260548-72260570 CTCTGACCCCAGGATTGATTTGG - Intergenic
1072984977 10:100131328-100131350 CTCGAACCCCAGGACTCAAATGG - Intergenic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1073439661 10:103544995-103545017 CAGAGACCCCAGGACTGTGCAGG - Intronic
1075718789 10:124572848-124572870 CAGGGACCACAGGACTGAGCTGG - Intronic
1076373337 10:129968343-129968365 TTCTGACCCCAGGCTTGAGCAGG - Intergenic
1076495278 10:130893163-130893185 CTGGGGACCCAGGGCTGAGCTGG - Intergenic
1076830394 10:132991546-132991568 CTGTGGCCCCAGGACTGACCAGG + Intergenic
1076869400 10:133186038-133186060 CGGGGACCCCAGCACTGACCCGG + Exonic
1077103528 11:832476-832498 CTGGGACCCCAGGCCTGCCCGGG + Intergenic
1080136150 11:28857375-28857397 CTCTGACCCCATGACTCTGCAGG + Intergenic
1083295180 11:61711451-61711473 GTCGGAGCACAGGACTGAGTGGG + Intronic
1083311390 11:61785708-61785730 CACAGACCCCAGGACTGCGACGG + Intronic
1084153602 11:67302422-67302444 CTGGAGCCCCAGGAATGAGCAGG + Exonic
1088443904 11:109902205-109902227 CTAGGCCCCCAGGACTGTGATGG + Intergenic
1088922866 11:114274067-114274089 CACAGTCCCCAGCACTGAGCAGG - Intronic
1089587621 11:119520314-119520336 CAGGGACCCCAGGAATGAGGTGG + Intergenic
1090412281 11:126517551-126517573 CCAGGACCCCAGGGCTGAACAGG + Intronic
1092042419 12:5396126-5396148 ATTGGAGCCCAGGACTGAGGAGG + Intergenic
1096677352 12:53232760-53232782 CTGGGACCAAAGGACTGAGGTGG - Intronic
1100243835 12:92736706-92736728 AGAGGAACCCAGGACTGAGCAGG + Intronic
1100469102 12:94874006-94874028 CGCGGCCCCCAGAACTGAGCTGG + Intergenic
1101442792 12:104716022-104716044 CACAGACCCCAGGCCTGGGCTGG - Intronic
1102518419 12:113465049-113465071 CTGAGATCCCAGGACTCAGCAGG - Intronic
1103793623 12:123488709-123488731 CTCCGACCCCAAGGCTGGGCAGG - Intronic
1104774215 12:131382606-131382628 CTCAGCCCCCAGGAGGGAGCAGG - Intergenic
1104774250 12:131382720-131382742 CTCAGCCCCCAGGAGGGAGCAGG - Intergenic
1104774381 12:131383169-131383191 CTCAGCCCCCAGGAGGGAGCAGG - Intergenic
1104943003 12:132403706-132403728 GTCGGGGCCCGGGACTGAGCAGG - Intergenic
1104964945 12:132504687-132504709 CTGGCACCCCAGGGCTGGGCTGG + Intronic
1104989082 12:132614963-132614985 CTTGGAAGGCAGGACTGAGCCGG + Intergenic
1108530578 13:51323825-51323847 CTCGGACACCATGTCTGATCTGG - Intergenic
1113539103 13:111092940-111092962 CTTGGACGCCAGGACTGGTCGGG - Intergenic
1113728647 13:112624224-112624246 CGCTGGCCGCAGGACTGAGCCGG - Intergenic
1113928128 13:113952422-113952444 CTTGGAACCCAGCCCTGAGCAGG - Intergenic
1121800975 14:96773958-96773980 CTGGGACCCCAGGAATAGGCTGG + Intergenic
1121925850 14:97926779-97926801 CTGGGACTCCAGGCCTCAGCAGG + Intronic
1122640202 14:103155414-103155436 CTCGGACCCCAGGACAGGCTGGG + Intergenic
1122640220 14:103155468-103155490 CTCGGACCCCAGGACAGGCCGGG + Intergenic
1122640233 14:103155504-103155526 CTCGGACCCCAGGACAGGCCGGG + Intergenic
1122640247 14:103155540-103155562 CTCGGACCCCAGGACAGGCCGGG + Intergenic
1122640268 14:103155594-103155616 CTCGGACCCCAGGACAGGCTGGG + Intergenic
1122640281 14:103155630-103155652 CTCGGACCCCAGGACAGGCTGGG + Intergenic
1122780844 14:104142788-104142810 CCCGGACCCCATGCCTGACCTGG - Intronic
1122790593 14:104182691-104182713 CTCAGACCCCAGCACTGTCCTGG - Intergenic
1122916816 14:104863249-104863271 TTGGGAGCCCAGGACCGAGCCGG - Intergenic
1122921067 14:104880382-104880404 CTCGAACCCCAGGCCGGAGAAGG + Exonic
1122973964 14:105163544-105163566 CCCAGACCACAGGCCTGAGCGGG - Intronic
1122974015 14:105163737-105163759 CCCAGGTCCCAGGACTGAGCAGG - Intronic
1122974027 14:105163769-105163791 CTCAGGCCCCAGGCCTGAGCTGG - Intronic
1122974062 14:105163865-105163887 CCCAGACCCCAGGCCTGAGCGGG - Intronic
1124340352 15:28886203-28886225 CTCGGCCTCGCGGACTGAGCCGG + Exonic
1124656733 15:31515268-31515290 CTCAGAACCCAGGCCTGAGAGGG - Intronic
1126851912 15:52802240-52802262 CTTTGACCACAGGACTGAGGAGG + Intergenic
1127325978 15:57895914-57895936 GTCAGAGCCCAGGCCTGAGCTGG - Intergenic
1127333757 15:57963893-57963915 CTTTGACCCCACCACTGAGCAGG - Exonic
1128649869 15:69402795-69402817 CTCAGACCCCAGGAGTAAGGAGG - Intronic
1129028923 15:72604753-72604775 CTCAGACCCCAGGGCTCAGGAGG - Intergenic
1129360551 15:75021325-75021347 CTGGGACCCCAGAACTGACCTGG - Exonic
1129719800 15:77871867-77871889 CCCTGACCCCAGGACTCAGGGGG + Intergenic
1130960305 15:88654556-88654578 CCAGGACACCAGGGCTGAGCGGG + Intronic
1131517403 15:93088579-93088601 CGCGGAGCCCCGGACGGAGCCGG - Intronic
1132613220 16:828032-828054 CCCGCGCCCCAGGCCTGAGCTGG - Intergenic
1132734564 16:1379176-1379198 CTCGGAACTCAGGACAGGGCGGG + Intronic
1133133326 16:3691871-3691893 CTCAGCCCACTGGACTGAGCAGG - Intronic
1134554960 16:15156670-15156692 CTCAGAGCCCAGGACAGGGCAGG - Intergenic
1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG + Exonic
1136392338 16:29973702-29973724 CGCGGACCCCAGGCCGGAGGAGG - Exonic
1137630332 16:49938813-49938835 CACAGACCCAAGGCCTGAGCAGG + Intergenic
1139129030 16:64118013-64118035 GTGGGAGCCCAGGACTGATCAGG - Intergenic
1141370623 16:83482943-83482965 CTCAGAACCCAGGACAGAGTTGG + Intronic
1142426824 16:90006028-90006050 CTCGGGGCCCAGGAACGAGCTGG + Exonic
1142752550 17:1997772-1997794 CTCGGAGGTCAGGCCTGAGCCGG + Intronic
1143173225 17:4942209-4942231 CTCAGACCCCAGGAAGGAGGAGG + Intronic
1145794909 17:27649885-27649907 CTGGGACGCCAGGTCTGAGGAGG - Intergenic
1145809403 17:27755603-27755625 CTGGGACGCCAGGTCTGAGGAGG - Intergenic
1145940990 17:28743495-28743517 CAGGCACCCCAGGACTGGGCTGG + Intergenic
1146211195 17:30945088-30945110 CTCGCACCCCAGGACTTGGCAGG + Intronic
1146338017 17:31991957-31991979 CTCAGATCCCAGGTGTGAGCAGG - Intronic
1147122205 17:38342285-38342307 CTTGGCCCCCAGGCCTGAGAAGG - Intronic
1147207413 17:38847564-38847586 CTTGGAGCCCAGGAGTGAGATGG + Intergenic
1147336474 17:39729480-39729502 TTTGGACCCCAGAACAGAGCAGG + Exonic
1147537128 17:41328269-41328291 CTCAGCACCCAGGCCTGAGCTGG + Intergenic
1147741145 17:42671548-42671570 CTCCTAACCCAGGACCGAGCAGG - Exonic
1149137163 17:53381343-53381365 CCATGCCCCCAGGACTGAGCAGG - Intergenic
1150132943 17:62679113-62679135 CTCAGAGCCCAGGACAGAGGTGG - Intronic
1151530974 17:74704418-74704440 CTCAGAGACCAGGACAGAGCAGG + Intronic
1152169564 17:78735359-78735381 CTGGGACAGCAGGAGTGAGCCGG - Intronic
1152657129 17:81524984-81525006 CTGGGACCCCAGCACAGGGCCGG - Intergenic
1152906832 17:82974916-82974938 CCAGGGCCCCAGGACAGAGCCGG + Intronic
1153584034 18:6602932-6602954 CACTGAGCCCAAGACTGAGCAGG - Intergenic
1155241236 18:23865636-23865658 CCCAGACCCCAGCACTGAGAGGG - Intronic
1156361579 18:36388673-36388695 CTCTGCCCTCAGGACAGAGCAGG - Intronic
1157323912 18:46655715-46655737 CTCTAAGCCCAGGACTGTGCAGG + Intronic
1161968390 19:7561589-7561611 CTCCCACCCCTGGACTGGGCTGG + Exonic
1162020652 19:7866981-7867003 CTCTGACCGAAGGACTGTGCTGG + Intergenic
1162125711 19:8498574-8498596 CTCCAAACCCAGGGCTGAGCGGG + Exonic
1163234985 19:16024832-16024854 CTCTCACCCCAGGGCTGTGCCGG - Intergenic
1163447099 19:17353164-17353186 CTCGGGCCCCAGGGAAGAGCCGG - Intronic
1164704461 19:30310011-30310033 CTCGAACCCCAGGACTCTGATGG - Intronic
1165352698 19:35284807-35284829 CTGCAACCCCAGGACAGAGCTGG + Exonic
1165730366 19:38141214-38141236 CTCGGAGCCCAAGACGGAGCAGG + Exonic
1166751832 19:45167777-45167799 CTCGAACTCCTGGACTCAGCTGG - Intronic
1167550175 19:50154865-50154887 CTCAGACCCCAGGAGAGGGCAGG - Intronic
925571102 2:5313638-5313660 CTGGGGCCCTAGGACTTAGCTGG - Intergenic
926202659 2:10812789-10812811 CTCGGACCACCGGACTGGCCTGG - Intronic
927886363 2:26721154-26721176 CTCCCACCCCAGGCCTGTGCTGG + Intronic
928209903 2:29315821-29315843 CCCGGAGACCAGGACTGAGCTGG + Intronic
928337211 2:30408157-30408179 CTTGGAACCCAGCGCTGAGCTGG - Intergenic
929939534 2:46322508-46322530 CTCGGCCCGCAGGTCTGAGGTGG + Intronic
935669077 2:105540022-105540044 CACAGAACCCAGGACTGACCAGG + Intergenic
936047778 2:109200489-109200511 CTTGGACCCGCCGACTGAGCAGG - Intronic
940134452 2:150420764-150420786 ATCGGAACCCAGAAGTGAGCTGG + Intergenic
946401169 2:219469093-219469115 CTCCCACCCCAGGGCTGGGCTGG - Intronic
947968576 2:234302730-234302752 CAAGCACCCCAGGACTGAGCGGG + Intergenic
948222936 2:236287799-236287821 CACGGAACCCAGGGCAGAGCGGG + Intergenic
948289686 2:236816008-236816030 CTGGTACCCCAGGAGAGAGCAGG - Intergenic
948827019 2:240577766-240577788 CTCAGAGCCCAGCACGGAGCTGG + Exonic
948893367 2:240917437-240917459 CTCTGACCTCAGGCCTGGGCTGG - Intergenic
1168974495 20:1953929-1953951 CTGGGTCCCCAGGAATGAGGAGG + Intergenic
1172977652 20:38918791-38918813 CTCAGACCCCAGCCCTCAGCTGG + Exonic
1173178848 20:40786443-40786465 CTCAGACTCCAGGGATGAGCAGG + Intergenic
1175576332 20:60063481-60063503 CTTGGAGCCCAAGACTGAGCTGG + Intronic
1175876255 20:62231618-62231640 CATGGACCCCAGGTCTGAGCTGG - Intergenic
1175968981 20:62674401-62674423 CGGGGACCTCAGGACTGAGCAGG + Intronic
1180000723 21:44994145-44994167 CACGGGCCACAGTACTGAGCAGG - Intergenic
1180149928 21:45942270-45942292 CTCTGACCCCAGGAGTGGGGTGG + Exonic
1180950531 22:19718685-19718707 CTCGGACCCCAGGCCCGGTCAGG - Intronic
1181052438 22:20244231-20244253 CTCCAACCCCAGCACTTAGCCGG - Intronic
1182130746 22:27848779-27848801 CTCGAACCCCAGGACTCAAAAGG + Intergenic
1185275921 22:49950221-49950243 CTGGGTCCCCAGGACGGTGCAGG - Intergenic
950185981 3:10945791-10945813 CTCTGAGCCCAGGACTGGGATGG - Intergenic
953044256 3:39281113-39281135 CCCCAACCCCAGGACAGAGCTGG + Intronic
953796932 3:45993047-45993069 CTGGGACCCAAGGGCTGATCTGG - Intronic
954701077 3:52451209-52451231 CCCCAACCCCAGGACTCAGCTGG + Exonic
954754370 3:52831216-52831238 CTGGGACCCCAGGAGAGAGAAGG - Intronic
954795727 3:53160738-53160760 CTCTGCCCCAAAGACTGAGCTGG - Intronic
961594278 3:128004874-128004896 CGCTGACCCCAGGACGGGGCTGG - Intergenic
961831540 3:129625526-129625548 CACGAGTCCCAGGACTGAGCAGG - Intergenic
961930488 3:130528196-130528218 CTTGGAGACGAGGACTGAGCAGG + Intergenic
967945308 3:194799308-194799330 CTCAGAGCACAGGACTGAGCAGG + Intergenic
968533488 4:1109393-1109415 CTTGGAGCCCAGGGCTGACCAGG + Intronic
969709658 4:8835449-8835471 CGCTGACCTCAGGACTGTGCAGG + Intergenic
970203003 4:13627974-13627996 CTGGGGCCCTAGGTCTGAGCGGG + Intergenic
974573669 4:63688893-63688915 CTAGGACCCCAGGTCTGTGATGG - Intergenic
987903884 5:24050850-24050872 CGGGGACCCCAGGACTCTGCTGG - Intronic
988525488 5:31983407-31983429 CAGTGACCCCAGCACTGAGCTGG + Exonic
991281867 5:64923480-64923502 CTCAGACACCAGGACTGAAGAGG - Intronic
997719495 5:136066154-136066176 CTCTGGCCCCATGGCTGAGCTGG - Intergenic
997721342 5:136080523-136080545 CTCGAACCCCAGCACAGAGATGG + Intergenic
999273808 5:150314833-150314855 CTCTGAACCCAGCACCGAGCGGG + Intronic
999327179 5:150650544-150650566 GTCGGACTCCATGTCTGAGCGGG + Exonic
999701292 5:154230855-154230877 GTCAGACCCCAGGACTGGCCTGG - Intronic
1003973582 6:11322391-11322413 CTGGCACCTGAGGACTGAGCTGG + Intronic
1010083007 6:71886387-71886409 CTCGGACCCGGGGAGTGGGCGGG + Intergenic
1014219350 6:118784911-118784933 CTCGGGGCCCAGCACTGAGTGGG + Intergenic
1016461932 6:144286583-144286605 CTCGGACCCCGGGCCAAAGCGGG - Intronic
1018557724 6:165065757-165065779 CTGGGACTCCTGGACAGAGCAGG + Intergenic
1018841904 6:167523501-167523523 CTGGGAACCCAGGACAGAGGTGG + Intergenic
1019188111 6:170232898-170232920 CTCGGACCCCAGGATGGAAAGGG - Intergenic
1019487450 7:1295898-1295920 CTGGGGCCCCAGGCCTGGGCAGG + Intergenic
1022963830 7:35454906-35454928 CTCTGACCCCAACTCTGAGCAGG + Intergenic
1023872409 7:44269986-44270008 ATCTGGCCCCAGGACTGTGCTGG + Intronic
1024543711 7:50500017-50500039 CCAGGACCCCAGCACTGAGTAGG + Intronic
1026898951 7:74026911-74026933 TTCTGCCCCCAGGACTGAGCTGG - Intergenic
1027128175 7:75572088-75572110 CTGGGACCACAGGTCTGTGCTGG - Intronic
1034345601 7:150383671-150383693 CTGGGACCTCAGGGCTGAGAAGG + Intronic
1034490782 7:151392161-151392183 CCCGGACCCCAGCTCTGATCGGG + Intronic
1035735270 8:1882872-1882894 TTCAGACCCAAGCACTGAGCAGG - Intronic
1040060940 8:43102350-43102372 CTCAAGCCCCAGGACAGAGCAGG - Intronic
1045346870 8:101301278-101301300 CCCGGTACCCAGAACTGAGCCGG + Intergenic
1046606088 8:116373665-116373687 CTAGGCCCCCAGGTCTGTGCTGG + Intergenic
1049658233 8:143808302-143808324 CTTGGACCCCAGGCCTGCCCTGG - Intronic
1049658244 8:143808343-143808365 CTTGGACCCCAGGCCTGCCCTGG - Intronic
1049778177 8:144415858-144415880 CCCTGACCCCGGGCCTGAGCTGG - Exonic
1050332410 9:4558586-4558608 CTTGTACTCCAGGACTCAGCTGG - Intronic
1056239735 9:84632492-84632514 CTCAGGCCCCATGAATGAGCAGG - Intergenic
1057195459 9:93113804-93113826 CTGGGACCCTGCGACTGAGCAGG - Intergenic
1057891785 9:98875131-98875153 CTTGGGCCTCAGGACTGGGCAGG + Intergenic
1059483308 9:114608955-114608977 CTCAGACCCCAGAACTTAGCTGG - Intergenic
1059967767 9:119632796-119632818 CTCAGAGCCCAAGAATGAGCAGG - Intergenic
1060913624 9:127370506-127370528 CCCGGACCCCAGGACCCAGCTGG + Intronic
1061065729 9:128276381-128276403 CTCGGACCCCAGGGCTCAGGAGG + Exonic
1061080319 9:128365853-128365875 CCCGGACCCCAGGACTAAGTTGG + Intergenic
1061138710 9:128751557-128751579 CTTGGGACCCAGGCCTGAGCTGG + Intronic
1061448570 9:130656147-130656169 CTCAGACCCCAGATCGGAGCTGG - Intergenic
1062204339 9:135327518-135327540 CTAGCACCCCATGAGTGAGCAGG - Intergenic
1203631428 Un_KI270750v1:75201-75223 CTTTGACCCAAGGACTGTGCAGG + Intergenic
1186463259 X:9765295-9765317 CCCTCACCCCAGCACTGAGCAGG + Intronic
1190774673 X:53543303-53543325 CCGGGACCCCAACACTGAGCTGG + Intronic
1192577532 X:72255034-72255056 CCCGGACCCCCGCCCTGAGCCGG - Intronic
1196649746 X:118156755-118156777 AGCGGAGCCAAGGACTGAGCAGG - Intergenic
1198224722 X:134634534-134634556 CTGGTTCCCTAGGACTGAGCAGG - Intronic