ID: 1136377082

View in Genome Browser
Species Human (GRCh38)
Location 16:29872096-29872118
Sequence GGTCTCTGGAATCTCTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 184}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136377082_1136377085 -6 Left 1136377082 16:29872096-29872118 CCAAGACAGAGATTCCAGAGACC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1136377085 16:29872113-29872135 GAGACCTTGCGAGAAGGTTATGG 0: 1
1: 0
2: 0
3: 6
4: 55
1136377082_1136377093 28 Left 1136377082 16:29872096-29872118 CCAAGACAGAGATTCCAGAGACC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1136377093 16:29872147-29872169 AGCCAAGTGGTGGCTCTTCAGGG 0: 1
1: 0
2: 1
3: 10
4: 157
1136377082_1136377089 15 Left 1136377082 16:29872096-29872118 CCAAGACAGAGATTCCAGAGACC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1136377089 16:29872134-29872156 GGAGTCCTGGGAGAGCCAAGTGG 0: 1
1: 0
2: 2
3: 39
4: 350
1136377082_1136377092 27 Left 1136377082 16:29872096-29872118 CCAAGACAGAGATTCCAGAGACC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1136377092 16:29872146-29872168 GAGCCAAGTGGTGGCTCTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 149
1136377082_1136377088 3 Left 1136377082 16:29872096-29872118 CCAAGACAGAGATTCCAGAGACC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1136377088 16:29872122-29872144 CGAGAAGGTTATGGAGTCCTGGG 0: 1
1: 0
2: 3
3: 9
4: 114
1136377082_1136377087 2 Left 1136377082 16:29872096-29872118 CCAAGACAGAGATTCCAGAGACC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1136377087 16:29872121-29872143 GCGAGAAGGTTATGGAGTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1136377082_1136377094 29 Left 1136377082 16:29872096-29872118 CCAAGACAGAGATTCCAGAGACC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1136377094 16:29872148-29872170 GCCAAGTGGTGGCTCTTCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 152
1136377082_1136377090 18 Left 1136377082 16:29872096-29872118 CCAAGACAGAGATTCCAGAGACC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1136377090 16:29872137-29872159 GTCCTGGGAGAGCCAAGTGGTGG 0: 1
1: 0
2: 1
3: 22
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136377082 Original CRISPR GGTCTCTGGAATCTCTGTCT TGG (reversed) Intronic
900926819 1:5711220-5711242 GGTCTCTGGACTCTAGGCCTGGG - Intergenic
902704073 1:18192308-18192330 GGTCTCTGGAGTCTGTATCTTGG + Intronic
903141227 1:21340290-21340312 GCTGTCTGGGACCTCTGTCTGGG + Intronic
904866627 1:33584330-33584352 GGTCTGTGTTATCTCTGTGTTGG - Intronic
905050624 1:35047776-35047798 GGTCTCAGGAGGCTCTCTCTGGG + Intergenic
905532988 1:38696759-38696781 CGTTTCTGGAAACTCTTTCTGGG - Intergenic
906466116 1:46081335-46081357 GGGTTAGGGAATCTCTGTCTCGG - Intronic
906959795 1:50413016-50413038 GCTCTCTGGAACATCTGCCTTGG + Intergenic
907338671 1:53717955-53717977 TCTCTCTGGAATCACGGTCTGGG - Intronic
908068349 1:60432347-60432369 GGTCTCTAGAATATGTTTCTGGG - Intergenic
908274559 1:62456758-62456780 GCTCTCTGGGATCTCTGACCTGG + Intronic
909467921 1:75994609-75994631 GGTCTCTGAAATTTCTGTTTTGG + Intergenic
910446273 1:87301657-87301679 GGTCACTGCAACCTCTGCCTTGG - Intergenic
911947861 1:104135391-104135413 GGCCTCAGGGACCTCTGTCTAGG - Intergenic
915118520 1:153614727-153614749 GGTCTCTGTGCACTCTGTCTTGG - Exonic
916763422 1:167837275-167837297 TGTCTCAGGAATCTCTGAGTTGG + Exonic
920578465 1:207081807-207081829 GGTGTCTGGAATCATTCTCTGGG + Intronic
920749247 1:208658506-208658528 GGTCTCCTGAAGCTCTATCTAGG - Intergenic
924728566 1:246692130-246692152 CGTCTCTGGAATCTCTTCTTTGG - Intergenic
1062768041 10:80315-80337 AGTCTCTGGAACCCTTGTCTGGG - Intergenic
1063771309 10:9205257-9205279 GGTATCTGGAATTCCTGTTTTGG + Intergenic
1064148678 10:12844803-12844825 GTTCTGTGGAAACGCTGTCTGGG + Intergenic
1064807359 10:19150569-19150591 GGCACCTGGAAACTCTGTCTAGG + Intronic
1067338035 10:45379922-45379944 GGGATCAGGAATCTCTGTCTTGG + Intronic
1070068763 10:73065115-73065137 GGTCACTTGCATCACTGTCTTGG - Intronic
1072275990 10:93824108-93824130 TGTGTCTGGCATCTCTGACTCGG - Intergenic
1074525657 10:114261023-114261045 GGTCTTTGGAACCTCCTTCTAGG + Intronic
1075827238 10:125369717-125369739 GTTCCCTGCAATCTCTGTGTTGG - Intergenic
1076184062 10:128432740-128432762 TGGCTTTGGCATCTCTGTCTGGG + Intergenic
1076566656 10:131403883-131403905 GGTCTCTCGCATCTCTGTGCTGG + Intergenic
1079188379 11:18256988-18257010 GGTCTCTTGATTCTCCATCTAGG + Intergenic
1080692081 11:34566626-34566648 GGTCTCTGGCATCCCTGCCCAGG - Intergenic
1081537694 11:44007322-44007344 AGGCTCTGGAATGTCTGGCTGGG - Intergenic
1082593691 11:55047394-55047416 GGTGTCTGGAAACACTGTTTTGG - Intergenic
1082811905 11:57483321-57483343 GGTCTCTGCACTCTGTGTCCGGG - Intergenic
1083508061 11:63179422-63179444 GGTCCCCAGAATCTCTATCTGGG - Intronic
1085216628 11:74838496-74838518 CATCTCTGGAATTTCTGTTTGGG - Exonic
1087357441 11:97112430-97112452 GGTGTCTGTAGTCTCTGACTAGG - Intergenic
1088924116 11:114283223-114283245 TGTCTCTGGAATCATTGTGTTGG + Intronic
1089113102 11:116072487-116072509 GGTCTGGGGCATCTCTCTCTAGG + Intergenic
1089216676 11:116838170-116838192 GGTCTCCGAAACCTCAGTCTGGG - Intergenic
1089257420 11:117201161-117201183 GGTCTCTGGCATCACTGGCAGGG + Intronic
1089959260 11:122601249-122601271 GGTCCCTGGAGTATCTGACTGGG + Intergenic
1091029461 11:132171927-132171949 GGTCTCTTCAATCTCTTACTTGG + Intronic
1091694013 12:2616087-2616109 GCTCTCTGGAATCCAAGTCTCGG + Intronic
1092464732 12:8720612-8720634 GCTCACTGCAACCTCTGTCTCGG + Intronic
1097594328 12:61609773-61609795 GGCACCTGGAATCTCTGGCTGGG - Intergenic
1097781224 12:63707341-63707363 GGTCTCTGGGTGCTCTGTCTCGG - Intergenic
1100708562 12:97228714-97228736 TTCCTCTGGAATCTCAGTCTTGG + Intergenic
1100774264 12:97957116-97957138 GGCCTCTTGAAGCTTTGTCTTGG - Intergenic
1102133173 12:110549853-110549875 GTCCCCTGGAATCTGTGTCTAGG + Intronic
1102469280 12:113150444-113150466 GGTCTCAGGCATCTCGGGCTTGG + Intronic
1102665177 12:114565694-114565716 GGTCTCTGGTATGTCTTTATTGG + Intergenic
1109521162 13:63512071-63512093 GGTTGCTGGTATCTCTTTCTCGG + Intergenic
1110326854 13:74226348-74226370 TGTCTTTGGAATTTCTGGCTTGG + Intergenic
1111626031 13:90787899-90787921 GGGCTCTGTGATCTCTGCCTTGG + Intergenic
1114016931 14:18438900-18438922 GTTCTCTGGAATCTTTGTGAGGG + Intergenic
1118593789 14:67420523-67420545 GGTCTCGGGAATTTCTGATTAGG - Intergenic
1122397409 14:101443196-101443218 GTTCTTTGGAATCTCTTCCTGGG + Intergenic
1122446837 14:101775849-101775871 GGATTCTGGAGTCTCTGGCTGGG - Intronic
1125123088 15:36186902-36186924 GGTCTATGAAATTTATGTCTGGG - Intergenic
1127505178 15:59591076-59591098 GCTCCCTGGCATCTTTGTCTGGG - Intergenic
1127856815 15:62960221-62960243 GGTCTCTGGGTTCTCAATCTTGG + Intergenic
1128267817 15:66281981-66282003 GGTCACTGGATTCTCTGGGTGGG + Intergenic
1128501481 15:68229932-68229954 GGGTACGGGAATCTCTGTCTAGG + Intronic
1129531615 15:76270162-76270184 GGACTCTGGCATCTTTGTCTGGG - Intronic
1129777258 15:78244928-78244950 GGTGTCTGCAATCTCTACCTGGG - Intronic
1129796711 15:78383179-78383201 GGTCAGTGGAGTCTCTCTCTGGG - Intergenic
1129890439 15:79068187-79068209 TGTCTCTGGGATGGCTGTCTAGG + Intronic
1135405354 16:22193817-22193839 TGTCTCTCGGGTCTCTGTCTTGG + Intergenic
1135576362 16:23588900-23588922 GCTCACTGCAACCTCTGTCTGGG - Intronic
1136377082 16:29872096-29872118 GGTCTCTGGAATCTCTGTCTTGG - Intronic
1138007428 16:53350874-53350896 GTTCACTGCAATCTCTGTGTGGG - Intergenic
1138627894 16:58266903-58266925 GGGCTGTGGAATCTCTGTATGGG + Intronic
1139538960 16:67599457-67599479 GGCCTCTGGGGTCTCTGTGTTGG + Intronic
1140928409 16:79604514-79604536 GGTGTCTGGACTCTTTGTTTAGG + Intergenic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1143719872 17:8801960-8801982 GGTGTCTTTAATCTCTGGCTTGG + Intergenic
1144506264 17:15833971-15833993 GGGCTCTGGAGTCTCTGCCCAGG + Intergenic
1144561786 17:16326626-16326648 GCTCTCTGAAAGCTCTGGCTTGG + Intronic
1144899728 17:18573711-18573733 GCTCACTGCAATCTCTGCCTCGG + Intergenic
1148901155 17:50878406-50878428 AGTTTCTGGAATCCCTGTGTTGG - Intergenic
1149950066 17:60976354-60976376 GTTCTCTTGAATATCTATCTAGG + Intronic
1152592843 17:81222320-81222342 GGGCTCTGGCCTCTCTGTCCAGG - Intronic
1156214364 18:34980596-34980618 TATATCTGGAATGTCTGTCTTGG - Intronic
1164913591 19:32031905-32031927 GTTCTCTGCAAGCACTGTCTAGG + Intergenic
1167077517 19:47258421-47258443 GGTCTCTAGAATCTGAGTTTTGG + Intronic
1167352840 19:48986347-48986369 GGTCTTTGGAAACTATGTCCAGG - Intronic
1167740992 19:51325085-51325107 TTTCTCTGAAACCTCTGTCTGGG - Intronic
1167930811 19:52862957-52862979 GCTCACTGCAATCTCTGCCTTGG - Intergenic
1168433659 19:56301465-56301487 GGTCACTTGAATCGCTATCTTGG + Intronic
925170704 2:1748647-1748669 GGGCTTTGGAAGCTCTGTCCCGG + Intergenic
926416756 2:12657020-12657042 GGACTCTGGCATCTCTTTTTGGG - Intergenic
929444685 2:41992615-41992637 GGTCTCTGGAAGCTTAGCCTGGG - Intergenic
930283132 2:49395307-49395329 GGTGTTTAGAATATCTGTCTAGG - Intergenic
932822869 2:74916136-74916158 GCTCTCTGGACCCTCTGTCCAGG - Intergenic
937837130 2:126482896-126482918 GGTCACTGGCATCCCTGTTTTGG - Intergenic
940124611 2:150309944-150309966 GGTGGCTGGAATCCCTGGCTGGG - Intergenic
940574964 2:155491476-155491498 GGTCACTAGAATCTATTTCTTGG - Intergenic
941216917 2:162723295-162723317 GGCCTGTGGAGTTTCTGTCTGGG - Intronic
941233738 2:162943397-162943419 GCTCACTGCAATCTCTGCCTCGG - Intergenic
942707062 2:178786060-178786082 GCTCTCTGGGCTCTCTGACTCGG + Exonic
948248110 2:236503534-236503556 TGTCTGGGGAATCCCTGTCTGGG + Intronic
948281857 2:236753095-236753117 TGTCCCTAGAATCACTGTCTGGG + Intergenic
948285499 2:236781585-236781607 CATCTCTGGAGTCTCTGTCAAGG + Intergenic
1169970598 20:11265750-11265772 AGTCTCTGGTATCTAAGTCTAGG - Intergenic
1170198805 20:13720070-13720092 GGGATCTGGAAGCTATGTCTAGG + Intronic
1170595644 20:17803817-17803839 GCTGGCTGGAATATCTGTCTGGG - Intergenic
1172228709 20:33322715-33322737 GGTCTCTGGAATTTCTGAGCAGG - Intergenic
1173878654 20:46393912-46393934 GGTCTTGGGAATCATTGTCTTGG - Intronic
1175071117 20:56334685-56334707 CATCTCTGGACTCTCAGTCTTGG + Intergenic
1175751102 20:61498641-61498663 GATCTCCAGAATCTCTGTCCAGG + Intronic
1175844135 20:62049739-62049761 GGGCTCTGGAACCTCTGCCCGGG - Intronic
1178146162 21:29742937-29742959 TTTCTCTGGTATGTCTGTCTAGG + Intronic
1178532904 21:33389918-33389940 GGTGGCTGGACTCTCTGTGTGGG - Intergenic
1179649370 21:42796986-42797008 CTTCTCTGGCTTCTCTGTCTAGG + Intergenic
1180441436 22:15369773-15369795 GTTCTCTGGAATCTTTGTGAGGG + Intergenic
1184512368 22:44941231-44941253 GGTCTCTGGAATCTCCCTCTGGG - Intronic
950328643 3:12138003-12138025 GGGCTCTGGAATCACAATCTGGG - Intronic
950397040 3:12741484-12741506 GCTCTCTGCACTCTCTGTATTGG - Intronic
950923222 3:16716016-16716038 TGTCCCTGGAAACACTGTCTGGG + Intergenic
951947134 3:28151301-28151323 AATTTCTGTAATCTCTGTCTGGG + Intergenic
954147110 3:48639997-48640019 GGCCGCTGGACTCTCTGTCTAGG - Exonic
955203906 3:56877821-56877843 GGTCTTTGGCATCACTGTTTAGG + Intronic
955618491 3:60835013-60835035 AATCTTTGGAATCTCTGGCTAGG - Intronic
962406769 3:135107199-135107221 GGTCCCTAGAATTTCTGCCTTGG - Intronic
970634538 4:17993275-17993297 GCTCACTGCAACCTCTGTCTCGG + Intronic
971153461 4:24058316-24058338 GTTCTCTGTCATTTCTGTCTTGG + Intergenic
974009780 4:56595837-56595859 TATCTCTGTAATCTCTGTCGAGG + Intronic
974121007 4:57639237-57639259 TGGCTCTAGAATGTCTGTCTAGG - Intergenic
974269541 4:59632987-59633009 GGTCTCTAGCCTCTCTGTTTTGG - Intergenic
981125167 4:141097563-141097585 GGACTCTGGATTCTCTCTCATGG - Intronic
988468707 5:31515776-31515798 TGTCTCTGGAACCCCAGTCTTGG + Intronic
989115899 5:37952068-37952090 GTTCTCTGGAGTCACTGTTTTGG + Intergenic
990091848 5:52061475-52061497 GGTCTCTGGCACCTGTGTGTGGG - Intronic
990551621 5:56886612-56886634 GGTCTCCAGATTCCCTGTCTTGG + Intronic
991501798 5:67284256-67284278 GGCCTCTGGGTTCTCTGCCTTGG + Intergenic
992308250 5:75465783-75465805 TGTCTCTTGATTCTCTGTATTGG + Intronic
993001224 5:82382861-82382883 GTTATCTGGAAACTCTATCTGGG + Intronic
993631313 5:90289162-90289184 GGTATGTAGAATCTCTTTCTGGG - Intergenic
999168738 5:149574746-149574768 TGACTCTGGGATTTCTGTCTTGG - Intronic
999408119 5:151325124-151325146 GGTCTCCAGATTCTCTGTCCTGG - Intronic
999420253 5:151435052-151435074 GGTCTCTTGAATCTGTGGGTTGG - Intergenic
1000025751 5:157357754-157357776 GTTCACTGCAATCTCTGCCTCGG - Intronic
1000205980 5:159058973-159058995 TGTCCCTGGAATGTCTGTCAAGG - Intronic
1001057714 5:168463071-168463093 TGTGTCTGAAATCTCTGTATTGG + Intronic
1001338228 5:170819293-170819315 GGTCTCTTGACTCTCATTCTTGG - Intergenic
1006248803 6:32762978-32763000 GGTGTCTGTAGTCTCTGTATTGG - Intronic
1007468481 6:42072265-42072287 TGTCACTAGAATCTTTGTCTTGG - Intronic
1007934400 6:45720401-45720423 GATTTTTGGAATCTCTTTCTAGG - Intergenic
1008735211 6:54534939-54534961 GGACTCTGGAATCTCTTCCAGGG - Intergenic
1011724386 6:90194549-90194571 GTGGTCTGCAATCTCTGTCTTGG - Intronic
1014619902 6:123654495-123654517 GGTCTCTGGATTCAATGGCTTGG - Intergenic
1015940750 6:138449228-138449250 GGTCTTTGGATTCTTAGTCTAGG - Intronic
1016943442 6:149504122-149504144 AGTCTTTAGAATTTCTGTCTGGG - Intergenic
1016986604 6:149900212-149900234 AGTCCCTGGAACCTCTGTGTTGG - Intergenic
1017589728 6:155965907-155965929 GGCCTCTGCATTCTCTGCCTTGG + Intergenic
1018680242 6:166258484-166258506 GGCTTCTGGATTCCCTGTCTGGG + Intergenic
1018902024 6:168056437-168056459 GGTCTTTGGAAGCCCTGGCTTGG + Exonic
1019661006 7:2224027-2224049 GGTCTCCGGGAACCCTGTCTTGG - Intronic
1021315123 7:19139202-19139224 GGTCTCTGAAATCCTTGTCTGGG + Intergenic
1021800318 7:24299029-24299051 GGATTCTGAAATCACTGTCTGGG + Intergenic
1022053095 7:26699359-26699381 GCTTTCTTGAATGTCTGTCTTGG - Intronic
1022939812 7:35223412-35223434 GGTCTCTGGGTGCCCTGTCTCGG - Intronic
1023061433 7:36331008-36331030 AGTCTATGGTATCTCTGTATCGG + Exonic
1025994368 7:66518744-66518766 GGTCCCTGGAATCCCTCTCTGGG - Intergenic
1026033630 7:66815919-66815941 GGTCCCTGGAATCCCTCTCTGGG + Intergenic
1026888102 7:73966525-73966547 GGTCTCTGGACTCTGGGCCTGGG + Intergenic
1026907607 7:74071462-74071484 GGCCTGTGGACTCCCTGTCTTGG + Intergenic
1026985982 7:74555433-74555455 GGTCCCCGGAATCCCTCTCTGGG - Exonic
1028191415 7:87857439-87857461 AGTCTCTTGAATCTCTGTCCAGG + Intronic
1033898915 7:146112214-146112236 GGTCTCTGGGATTTGTGTATTGG - Intergenic
1035132568 7:156669460-156669482 GTTCCCTGGAACCTCTGTCCAGG + Intronic
1036207346 8:6815026-6815048 GGACTGGGGAATCTCTGTCCTGG + Intronic
1037617540 8:20533072-20533094 GGTGCCTGAAATCTCTGTCCAGG - Intergenic
1037922559 8:22817659-22817681 TGTCTCCAGAATCTCTGTCTGGG + Exonic
1038049612 8:23796444-23796466 GGTCTCTGAAATCTCTATATTGG + Intergenic
1040841345 8:51788588-51788610 GGAGTCTGGAATCTCTCTCAGGG + Intronic
1041668327 8:60467499-60467521 GGTCTCTGGCATCTGTGCCTAGG + Intergenic
1042091657 8:65165776-65165798 GGTCTTTGGTAGCTCTGCCTGGG - Intergenic
1042886110 8:73554051-73554073 GGCCTCCAGAATCTCTGTCCAGG - Intronic
1047895268 8:129359650-129359672 GGTAGTTGGAATCACTGTCTTGG + Intergenic
1048915212 8:139176138-139176160 GTTGTCTGGAACTTCTGTCTTGG + Intergenic
1049326837 8:142025970-142025992 GGGCTCTGCAATCTCTCCCTGGG + Intergenic
1050524382 9:6532879-6532901 TATCTCTGTAATCTCTGTCAAGG - Exonic
1057856064 9:98601721-98601743 GGTCTCTTGAAGCTCTGTTAAGG + Intronic
1058189785 9:101899261-101899283 GCTCACTGTAACCTCTGTCTGGG - Intergenic
1058898818 9:109423531-109423553 GCTCGCTGCAACCTCTGTCTCGG - Intronic
1059403722 9:114086950-114086972 ATTCTCTGGAATCTTTGGCTGGG - Intronic
1059416640 9:114166624-114166646 TGCCTCTGGAATCTGAGTCTGGG - Intronic
1060482923 9:124028356-124028378 GTTCTCTGGACTGTGTGTCTGGG - Intronic
1061414748 9:130440847-130440869 GCTCACTGCAATCTCTGTCTTGG + Intergenic
1061774988 9:132956494-132956516 GGTTCCTGGAGTCTCTGTCTGGG - Intronic
1186894217 X:13989847-13989869 TGTCTCTGAAATCTGTGTGTGGG - Intergenic
1187393486 X:18901310-18901332 CGGCTCTGGAATATCTATCTGGG + Intronic
1187400850 X:18958780-18958802 GCTCACTGAAACCTCTGTCTCGG + Intronic
1189229878 X:39443915-39443937 GGTCTTTGGAGTCTCAGTTTTGG - Intergenic
1193284984 X:79701747-79701769 GGTCTCCTGATTCTCTGTCTAGG + Intergenic
1196047504 X:111271574-111271596 GGTCTCTGAGATCTCCTTCTTGG + Intergenic
1199696385 X:150345589-150345611 GCCCTCTGGAATGTCTTTCTTGG + Intergenic
1200039837 X:153356774-153356796 GGTCTCGGGAATGTCTTTATTGG + Intronic
1200355017 X:155539510-155539532 GGTCTCTGGATTCTTTAACTGGG + Intronic
1200831785 Y:7692783-7692805 GATCTTTGGATTCTCTGTGTGGG - Intergenic