ID: 1136377862

View in Genome Browser
Species Human (GRCh38)
Location 16:29876240-29876262
Sequence CCAGCACGGGGCTTCAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136377851_1136377862 -4 Left 1136377851 16:29876221-29876243 CCCTTCGCCTAACCCCAACCCAG 0: 1
1: 0
2: 0
3: 15
4: 241
Right 1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG 0: 1
1: 0
2: 1
3: 6
4: 80
1136377849_1136377862 -2 Left 1136377849 16:29876219-29876241 CCCCCTTCGCCTAACCCCAACCC 0: 1
1: 0
2: 2
3: 32
4: 363
Right 1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG 0: 1
1: 0
2: 1
3: 6
4: 80
1136377850_1136377862 -3 Left 1136377850 16:29876220-29876242 CCCCTTCGCCTAACCCCAACCCA 0: 1
1: 0
2: 0
3: 29
4: 341
Right 1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG 0: 1
1: 0
2: 1
3: 6
4: 80
1136377852_1136377862 -5 Left 1136377852 16:29876222-29876244 CCTTCGCCTAACCCCAACCCAGC 0: 1
1: 0
2: 0
3: 20
4: 330
Right 1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG 0: 1
1: 0
2: 1
3: 6
4: 80
1136377848_1136377862 23 Left 1136377848 16:29876194-29876216 CCATAAGAGTATGGAGGGGCTTG 0: 1
1: 0
2: 2
3: 1
4: 74
Right 1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG 0: 1
1: 0
2: 1
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136377862 Original CRISPR CCAGCACGGGGCTTCAATGA TGG Intronic
900515810 1:3081757-3081779 CCAACACGGGCCTTCCATGGGGG - Intronic
901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG + Intronic
904029110 1:27522994-27523016 CCAGCTCGGGGTTTCCAGGAGGG + Intergenic
907306494 1:53516066-53516088 CTAGCCCGGGGCTGCACTGATGG + Intronic
907504115 1:54904889-54904911 GCAGCATGGGGGTTTAATGAGGG + Intergenic
915079188 1:153339943-153339965 GCAGCACGGGTCTACCATGAGGG + Intronic
917076086 1:171206659-171206681 TCAGCCCGGGGCACCAATGAAGG + Intronic
1063242828 10:4188653-4188675 CCAGCCTCGGGCGTCAATGAAGG + Intergenic
1067050040 10:43010499-43010521 CCATCACAGGGCTTCAAAGGAGG + Intergenic
1069955721 10:72050163-72050185 CCTGAACTGGGCTTCAAGGATGG + Intergenic
1072544806 10:96428763-96428785 CAAGCACTCGACTTCAATGATGG + Intronic
1075313110 10:121431087-121431109 ACAGCAAGGGGCTTCTAAGATGG - Intergenic
1076897358 10:133319161-133319183 CCAGCACTGGGCTTCAAATCTGG - Intronic
1078259112 11:9687980-9688002 CCAGCACAGGGCATCACTGTGGG + Intronic
1089146872 11:116335668-116335690 CCAGCACAGGCCTTCATTTATGG - Intergenic
1094069147 12:26394075-26394097 CTAGCACGAGGCTTAACTGAGGG - Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1105434501 13:20364850-20364872 ACAGCTTGAGGCTTCAATGAGGG + Intergenic
1106999484 13:35526871-35526893 ACTGCAAGTGGCTTCAATGATGG + Intronic
1110926855 13:81164533-81164555 CTAGCAGGGGTTTTCAATGAGGG + Intergenic
1119444059 14:74648834-74648856 CCAGCACTGGGCGGCACTGAGGG + Intergenic
1119510554 14:75207854-75207876 GCAGCAGGGGACTTTAATGAGGG - Intergenic
1125330172 15:38574468-38574490 CCAGCATGTGGCTTTAAAGATGG - Intergenic
1126565649 15:50096145-50096167 CCACCACTGGGGTGCAATGAAGG + Intronic
1127147071 15:56035518-56035540 CCAGCATGGGGTTTCTATTAGGG + Intergenic
1128229572 15:66025248-66025270 GCAGCAGGGGACTTCAAGGAGGG - Intronic
1134110251 16:11510857-11510879 CCAGCGCGGAACTTCAAGGAGGG + Intronic
1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG + Intronic
1138537306 16:57666882-57666904 CCAGGATGGGGCTTCAGCGATGG + Intergenic
1140197241 16:72865410-72865432 CCAGCACAGGGCCGCCATGAAGG - Intronic
1148849416 17:50547559-50547581 CCAGCACTGGGGTGCAAGGAAGG - Intronic
1150470143 17:65430470-65430492 CCAGAACTGGGGTTCAGTGAGGG - Intergenic
1151889653 17:76944583-76944605 AGAGCACGGGGCTTCAAGGCTGG + Intronic
1152842205 17:82577389-82577411 CCTGCTCGGGGCTGCAGTGATGG - Intronic
1164243348 19:23409472-23409494 CCAGCAGAGGAGTTCAATGATGG - Intergenic
1166861564 19:45814672-45814694 CCAGCACGGGCCTTACATAAGGG - Exonic
925284832 2:2709131-2709153 CCTCCACGGGGCTTCCGTGAGGG - Intergenic
926189192 2:10715003-10715025 CAAGCAAGGGGCTTAAATGCTGG - Intergenic
926615719 2:14994927-14994949 CCAGCCATGGGCTTCAAGGATGG - Intergenic
927264046 2:21124303-21124325 CCAGCACATGGGGTCAATGATGG + Intronic
927789060 2:25995731-25995753 CCTGCAGGGGGCTTCTAGGATGG - Intergenic
927915582 2:26934045-26934067 CCTCCAAGGGGCTTCAGTGAGGG - Intronic
929645550 2:43623658-43623680 CCAACACTGGGCTTCAATGAAGG + Intergenic
933137773 2:78759037-78759059 GCAGCACTGGGCTGCAATGTGGG - Intergenic
934906340 2:98207652-98207674 TCAGAACGGGCCTTCAGTGATGG + Intronic
935319335 2:101870648-101870670 TCAGCGCGGTGCTTGAATGAGGG - Intronic
947333318 2:229053546-229053568 GCTGCATGGGGCTTCAAGGAAGG + Intronic
948868172 2:240785675-240785697 CCAGCACGGAGTCACAATGACGG + Intronic
1170338920 20:15301353-15301375 CCAGCACGGGGCCTGGTTGATGG + Intronic
1172228643 20:33322296-33322318 CCAGCCCGGAGTTTCAGTGAAGG - Intergenic
1178494653 21:33076423-33076445 CCAGCACTGGGATTCAATAAGGG + Intergenic
1179797481 21:43793839-43793861 CCTGAACGGGGATACAATGAGGG - Intronic
1180843521 22:18970096-18970118 CCAGCAAGGGGCTTCTGTGCAGG + Intergenic
1185239513 22:49735163-49735185 CCAGCACCAGGCTTCAGGGAGGG + Intergenic
954465220 3:50650396-50650418 CCAGTACTGGGCTTCCAGGAGGG + Intergenic
955955075 3:64280444-64280466 CCTGCCAGGCGCTTCAATGAGGG - Intronic
960968536 3:123122689-123122711 CCAGCAAGGGACCTCAGTGAGGG + Intronic
961756829 3:129132836-129132858 CCAGCACTGGGGTTCAGTGCAGG - Intronic
963277029 3:143342122-143342144 CCAACAAGCAGCTTCAATGATGG - Intronic
975151904 4:71032371-71032393 GCAGCCCGGGGCTGCAATGTGGG - Intergenic
976656812 4:87497330-87497352 CCAGCAGGGGGCATCATAGAAGG + Intronic
978330469 4:107607773-107607795 CCAGCACTGGGCATCTATAATGG - Intronic
982551350 4:156803848-156803870 CCAGAACTGTGCTTCAATGCTGG + Intronic
996699573 5:126436780-126436802 CCAGCATGGGGATTGAATGAAGG + Intronic
1000128209 5:158268404-158268426 CCAGCACGGGGCTTCCCTACAGG - Intergenic
1001398492 5:171433149-171433171 ACAGAATGGGGCTTCAATGGTGG + Intronic
1001985584 5:176072514-176072536 CCAGCTCGGGGCTTCAAAGCTGG + Intronic
1002231288 5:177765610-177765632 CCAGCTCGGGGCTTCAAAGCTGG - Intronic
1002264050 5:178018138-178018160 CCAGCTCGGGGCTTCAAAGCTGG + Intronic
1006191669 6:32213234-32213256 CCAGCCCCGTGCTTCAATGGGGG - Exonic
1006900909 6:37500267-37500289 CCAGCACCGGCCTTGAAGGATGG - Intergenic
1007694156 6:43721315-43721337 CCAGCTCTGGGCTTCACTTATGG - Intergenic
1015822586 6:137280158-137280180 CCAGACCTGGGCTTCACTGAGGG + Intergenic
1017146382 6:151239672-151239694 CCAGCACAGGCCCTCAAAGAAGG + Intergenic
1022340199 7:29460422-29460444 CCAGCAGGGAGCTTCTAAGAGGG + Intronic
1022501753 7:30886253-30886275 CCAGCCCAGGGGTTCTATGAGGG - Intronic
1029573189 7:101384980-101385002 CCAGCACGGGAGAACAATGAAGG + Intronic
1040496259 8:47968172-47968194 GCAGCACGGTTCTTCATTGATGG + Intronic
1040997446 8:53416318-53416340 CCAGCGTGGGGGTTCAAGGAAGG + Intergenic
1044538954 8:93389130-93389152 ACAGCAAGGGCATTCAATGAAGG + Intergenic
1044740034 8:95316710-95316732 CCAGGATGGGGCCTGAATGAGGG + Intergenic
1045702403 8:104881862-104881884 CCAGCAAGGGGCTTCAAATCTGG - Intronic
1051819991 9:21153446-21153468 GCAGGAAGGGGCTTCAATGGAGG - Intergenic
1058467509 9:105244453-105244475 CCAGCACGGCGCTGCACTGGGGG + Intergenic
1060728565 9:126022486-126022508 CCAGCCTGGGGCTTCAGTGGTGG + Intergenic
1062057884 9:134478013-134478035 CCTGCACGGGGCTCCCATGGGGG + Intergenic
1062481493 9:136754556-136754578 GCCCCACGGGGCTTCGATGAGGG + Intronic
1200248690 X:154540780-154540802 CCACCACAGGGCTTCCAGGAGGG + Intronic