ID: 1136384665

View in Genome Browser
Species Human (GRCh38)
Location 16:29916092-29916114
Sequence GTCTCCTGCATTAGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136384665_1136384668 9 Left 1136384665 16:29916092-29916114 CCCTCCACACTAATGCAGGAGAC 0: 1
1: 0
2: 0
3: 12
4: 105
Right 1136384668 16:29916124-29916146 AAACTTTCTGCCGCTACACAAGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136384665 Original CRISPR GTCTCCTGCATTAGTGTGGA GGG (reversed) Intronic
904998474 1:34649817-34649839 GTCTCCTGTGTTAGTGGGAAAGG - Intergenic
909258783 1:73459794-73459816 GGTTCCTGCATTACTCTGGAAGG + Intergenic
910506552 1:87955880-87955902 GCCTTCTGCATTGGTGGGGAGGG + Intergenic
912508583 1:110173280-110173302 GTCTCCTGCATCAGTGAGACTGG - Intronic
912714363 1:111971985-111972007 GTCTTCTGGATGAATGTGGAAGG - Intronic
913056472 1:115166114-115166136 GTCTCCTGCAGTAATGTGAAAGG - Intergenic
917453438 1:175166133-175166155 GACTCCTGGATTTGTGTGGGGGG + Intronic
920103997 1:203537587-203537609 GTCTCCTCAATAAGTGTGGCAGG + Intergenic
1063727569 10:8655478-8655500 GTCTCTTGCATCAATGTGAATGG + Intergenic
1065964280 10:30758466-30758488 GTCTTATTCATTAGTGTGGGTGG - Intergenic
1071285601 10:84141272-84141294 GTTTCTTGCATTACAGTGGATGG + Intronic
1072185047 10:93029095-93029117 GACTCTTGCCTCAGTGTGGATGG - Intronic
1073149804 10:101303970-101303992 GTCTCTTCCATCAGTGGGGAGGG + Intergenic
1074611630 10:115027460-115027482 GAGTCCTGCATTGCTGTGGAGGG - Intergenic
1076254722 10:129012872-129012894 GTCTGCTGCACTGGTGTGGAGGG - Intergenic
1080142384 11:28938183-28938205 GTCAGGTGCATTAGTGAGGATGG + Intergenic
1082170738 11:49001936-49001958 ATCTCCTGTCTTAGTGTGGTTGG + Intergenic
1083606328 11:63981049-63981071 ATGTCCTGCATTTGTGGGGATGG + Intronic
1086695067 11:89834424-89834446 ATCTCCTGTCTTAGTGTGGTTGG - Intergenic
1086711083 11:90010060-90010082 ATCTCCTGTCTTAGTGTGGTTGG + Intergenic
1086937591 11:92762057-92762079 ATCTCCTACAGTATTGTGGATGG + Exonic
1090936734 11:131349558-131349580 GCCTCCTGCAGGAGAGTGGAGGG + Intergenic
1091888614 12:4034621-4034643 GTCTCCTCCATTACTCTGCAGGG - Intergenic
1093651524 12:21651174-21651196 GTCTGCTGCCTTGGTGTGTATGG + Intronic
1094325428 12:29232763-29232785 GTCACCTGAATCAGTGTGGCAGG - Intronic
1095240279 12:39850144-39850166 GACTCCTTTATTATTGTGGAAGG - Intronic
1097733075 12:63151256-63151278 GTCCTCTGCATCACTGTGGAGGG + Intergenic
1101398403 12:104367809-104367831 GCCTCCTGCATTGGTGAGGGTGG - Intergenic
1102402699 12:112643984-112644006 GTCTTCTGCAGCAATGTGGATGG + Intronic
1109773709 13:67011561-67011583 GTCTCTTGCATTACTGTGATGGG - Intronic
1115536743 14:34380231-34380253 GCCTCCTGCATTCGTTTGTAAGG + Intronic
1116370600 14:44126137-44126159 GACACCTGCATAAGTGTGTATGG + Intergenic
1120924262 14:89782199-89782221 GTCTCCAGCCTCAGTGTTGAGGG + Intergenic
1122484578 14:102070180-102070202 GTCTCCTTCCTTAGCCTGGAAGG - Intergenic
1122729157 14:103782578-103782600 GTCTTCTGCATTGCTGTGGGAGG - Intronic
1128322918 15:66705189-66705211 GTCTCCTGACTCTGTGTGGAAGG + Intronic
1128875333 15:71196946-71196968 GACTCCTGCATGAAGGTGGAAGG + Intronic
1133685934 16:8165601-8165623 GTCTCCTTCACCAGTGTGCATGG - Intergenic
1136384665 16:29916092-29916114 GTCTCCTGCATTAGTGTGGAGGG - Intronic
1136484076 16:30559973-30559995 GTCTCCTCCCTTACTGTGTATGG + Intergenic
1137740508 16:50767161-50767183 GGCTCTTGCCTCAGTGTGGATGG - Intronic
1149137196 17:53381516-53381538 GTTTTCTGCATAAGTATGGAGGG + Intergenic
1156150459 18:34234832-34234854 GTCTCCTTCCATACTGTGGAAGG + Intergenic
1160963395 19:1734759-1734781 GTCTCGTGCATTTGTGGGGAGGG + Intergenic
1161026290 19:2038832-2038854 GTCTCAGGCCTTGGTGTGGAGGG + Exonic
1162438922 19:10680789-10680811 GTCTCCTGTATTCCTTTGGAAGG + Intronic
1168435887 19:56316533-56316555 GTCAAGTGCATTAGTGAGGAGGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925064693 2:921112-921134 GAATCCTGCATTTGTGTGGAAGG + Intergenic
925106349 2:1295767-1295789 GTCTCCTGTATTGGGGTGGGAGG + Intronic
925345081 2:3166327-3166349 GACGCCTGCATCAGCGTGGAGGG + Intergenic
928722978 2:34141958-34141980 GTCTCCTTCTTTACTGTGGAAGG - Intergenic
930828273 2:55716200-55716222 GTCTCCTGTGGTAGTGTGGAGGG + Intergenic
932007528 2:67941619-67941641 GTCACCTGTAGTAATGTGGAAGG + Intergenic
932573725 2:72951449-72951471 GTCTCCTGCCTCACTGTGGGTGG + Intronic
941376027 2:164731914-164731936 GTCTCCTGCAGAGGTGGGGAAGG + Intronic
942781378 2:179647525-179647547 GTCTCCTGCGTTAGTGAATATGG + Intronic
1170639932 20:18142833-18142855 GTCTCCTTCATCACTGTTGAGGG - Exonic
1170698386 20:18681172-18681194 GTCTCCTGCATGAGGGTGTGTGG - Intronic
1171446067 20:25205706-25205728 GTCTCCTGCTCCAGTGTGGGTGG + Intronic
1178333311 21:31720345-31720367 ATTTACTGCATTACTGTGGATGG + Intronic
1179269966 21:39843330-39843352 GTGTCCTCCATCTGTGTGGAGGG + Intergenic
1183976608 22:41515905-41515927 ATCTCCTGCACTGGTGAGGAAGG + Exonic
1185030226 22:48439062-48439084 GTCTCATACATTCTTGTGGAGGG + Intergenic
949093289 3:55261-55283 ATGTCCTACATTTGTGTGGAAGG + Intergenic
949839675 3:8306237-8306259 GTCTACTGCTTTGGTGGGGACGG - Intergenic
950192314 3:10986100-10986122 GTCACCTGCAGTAGTGGAGAGGG - Intergenic
957033538 3:75271339-75271361 ATGTCCTACATTTGTGTGGAAGG + Intergenic
962959692 3:140299136-140299158 GTGTCCTGGAGTAGTTTGGAAGG - Intronic
964735204 3:159910353-159910375 GTCTTCTCCACTAGTGTGGAGGG - Intergenic
965023467 3:163265944-163265966 GTCTATTGCAGTAGCGTGGATGG - Intergenic
967081518 3:186054157-186054179 GCCTCATGCATTACTGTAGAAGG - Intronic
973068170 4:45823097-45823119 GTCTTCTGCAGCAATGTGGATGG + Intergenic
973649560 4:52984863-52984885 GTCTCCTGCATTATTGGAAAAGG - Intronic
978114505 4:105003258-105003280 GTCTCCTGCCTCAGTGTGGTAGG + Intergenic
979093031 4:116511499-116511521 GTCTCTTGCATTAGAATGCAAGG - Intergenic
980901926 4:138913246-138913268 GTCTCTTGCCTTAGGCTGGAGGG - Intergenic
984413640 4:179429277-179429299 CTCTCCTGCAATGGTGTGGCCGG - Intergenic
986095853 5:4553526-4553548 GCCTTCTGCTTTAGGGTGGAAGG + Intergenic
987178890 5:15345944-15345966 GTCCTTTGCAGTAGTGTGGATGG + Intergenic
993099514 5:83520072-83520094 GTCTTCTAAATGAGTGTGGATGG - Exonic
997795946 5:136811153-136811175 GCCTTCTCCACTAGTGTGGATGG - Intergenic
999185262 5:149702694-149702716 TTCTCCTGCAGGAGTGTTGATGG - Intergenic
1000761174 5:165226550-165226572 TTCTCCTGCCTTAGTCTGGACGG - Intergenic
1001302034 5:170540616-170540638 GCATCCTGCATTACTGAGGATGG - Intronic
1002859951 6:1071719-1071741 GTCTGCTGCATTTCTGTGGAGGG - Intergenic
1006432660 6:34007496-34007518 GTCTTCAGCAGCAGTGTGGAAGG + Intergenic
1007740441 6:44006420-44006442 GTGTCCTTCATCAGTGGGGAGGG + Intergenic
1010351322 6:74878495-74878517 GTCTGCTTCATAACTGTGGAAGG - Intergenic
1011735054 6:90302276-90302298 GGCTCCTGGACTAGTGGGGAAGG + Intergenic
1012580269 6:100860237-100860259 GTCTCCTTCATGACTGTTGAAGG - Intronic
1013765068 6:113564923-113564945 TTCTTCTGCATTTGTGTGGAGGG - Intergenic
1022172100 7:27840559-27840581 CTCTCCTGCATTAGAGTGCGTGG - Intronic
1023969308 7:44979307-44979329 GTCTCCTGCTTGTGGGTGGAGGG - Intergenic
1023997471 7:45170274-45170296 GTCTGGTGCCTTAGGGTGGAAGG + Intronic
1026438055 7:70417084-70417106 GTCTCCTCCAGCAGAGTGGAGGG - Intronic
1028444354 7:90903402-90903424 GTCATCTGCAGTAGTATGGATGG + Intronic
1029207192 7:98876877-98876899 GTCTCCTGAATTAGAGGTGAGGG - Intergenic
1030978049 7:116151862-116151884 GCTTCCTGAATTAGTATGGATGG - Intronic
1031650909 7:124288825-124288847 GACTCTGGCAGTAGTGTGGAGGG - Intergenic
1033490682 7:141840744-141840766 GTTTTCTGCATTAGTGTCGGTGG + Intronic
1040003548 8:42599427-42599449 GTCCCCTTCAGTGGTGTGGAAGG - Intergenic
1041409342 8:57536138-57536160 TTCTCCGGAATTGGTGTGGAGGG - Intergenic
1042882253 8:73506589-73506611 GGGTCTTGCATCAGTGTGGATGG + Intronic
1047933034 8:129749578-129749600 GTCTCCTGCTTTATGGTGGGAGG - Intronic
1051848399 9:21479120-21479142 GTCACCTGCAATAGTGAAGAAGG - Intergenic
1054332999 9:63778861-63778883 GTCTTGTGCAATAGTGTGAAAGG - Intergenic
1056549754 9:87642513-87642535 TTCTCCTTCCTCAGTGTGGATGG + Intronic
1057387696 9:94619035-94619057 TCCTCCTGCATTAGTGAGGGTGG - Intronic
1057700908 9:97362483-97362505 ATCTCCTGCCTTTGTGTGGGGGG - Intronic
1186680678 X:11870538-11870560 GTCTCCTGCTTTTGTCTGGGAGG - Intergenic
1189295021 X:39911898-39911920 GTCTACTGAATGAGTGTGGAAGG - Intergenic
1190567028 X:51741581-51741603 GGCTCCAGCACTTGTGTGGAGGG + Intergenic
1190993660 X:55582080-55582102 ATGTCTTGCAGTAGTGTGGATGG + Intergenic
1195302165 X:103540997-103541019 GTGTCCTGGAATACTGTGGAAGG - Intergenic
1196793809 X:119487027-119487049 GTCTCCTTCCATGGTGTGGAAGG - Intergenic
1197042297 X:121952281-121952303 TTCTGTTGCATTTGTGTGGATGG + Intergenic
1199368373 X:147015933-147015955 GTCTCTTGCATCAGCATGGATGG + Intergenic