ID: 1136385239

View in Genome Browser
Species Human (GRCh38)
Location 16:29921377-29921399
Sequence CGTGAGGTGCAGAGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136385235_1136385239 4 Left 1136385235 16:29921350-29921372 CCACACACTGAGGAGTGTGCTGA 0: 1
1: 0
2: 2
3: 22
4: 189
Right 1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG 0: 1
1: 0
2: 1
3: 22
4: 196
1136385233_1136385239 21 Left 1136385233 16:29921333-29921355 CCAATATTGATGAAGTGCCACAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG 0: 1
1: 0
2: 1
3: 22
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136385239 Original CRISPR CGTGAGGTGCAGAGGGAACC TGG Intronic
901004668 1:6165998-6166020 TGTGAGGTGAAGGGGGAACCCGG - Intronic
901012046 1:6207533-6207555 GGTGAGGAGCAGAGGGTACCCGG + Intronic
902735317 1:18396914-18396936 GGTGAAGTCCAGAGGAAACCAGG - Intergenic
903437214 1:23359600-23359622 CGGGATGTGCAGAGGCAGCCAGG + Exonic
903844863 1:26273045-26273067 TGAGAGGTGATGAGGGAACCTGG + Intronic
905232160 1:36521317-36521339 AGTGAAGGGCAGAGGGGACCTGG + Intergenic
913065707 1:115252203-115252225 AGTGAGGGGCAGAGACAACCAGG + Intergenic
917260441 1:173161270-173161292 GGTGAGATCCAGAGGAAACCAGG + Intergenic
917649921 1:177066233-177066255 CCTGAGGTCCAGTGGGAACATGG - Intronic
918048468 1:180955018-180955040 GGTGAGCTGCAGAGGGACCCAGG - Intergenic
922551507 1:226497758-226497780 TGGGAGGTGGGGAGGGAACCAGG - Intergenic
922686540 1:227643054-227643076 AGAGAGGTGCACAGGGAACTTGG + Intronic
923281661 1:232448916-232448938 CGTGAGGTGCAGAGGAGAACAGG + Intronic
1063976903 10:11424656-11424678 CATGACGTCCAGAGGGAACTGGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1070304663 10:75233264-75233286 GGGGAGGTGGAGAAGGAACCAGG - Intergenic
1070343798 10:75522615-75522637 CGTGAGTGGTAGAGGGGACCTGG + Intronic
1070373712 10:75809197-75809219 GGTGAGATGCAGAGGCCACCTGG - Intronic
1070678914 10:78435137-78435159 CGTGAGGGGGAGAGGAAACTGGG - Intergenic
1070814689 10:79315286-79315308 AGGGAGGTGCAGAGGCATCCGGG + Exonic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1079108005 11:17586295-17586317 AGTGAGGTTCAGAGGGACCTTGG - Intronic
1083305674 11:61761011-61761033 CCTGGGGTGCAGAGGACACCAGG - Intronic
1083682632 11:64358502-64358524 CGTGAGGTGCGCATGGCACCTGG + Intergenic
1083729403 11:64644688-64644710 AGAGAGGTGGAGAGGGCACCTGG + Intronic
1085511872 11:77092469-77092491 GGTCAGGTGCAGAGGGCACCTGG + Intronic
1087086970 11:94229754-94229776 CAAGAGGTGCAGAGGGAATTGGG - Intergenic
1088455950 11:110033275-110033297 CAGGAGGTGCAGAGGGTTCCAGG + Intergenic
1088974028 11:114798871-114798893 CAGGAGGTGCAGACAGAACCCGG - Intergenic
1089394360 11:118126243-118126265 GGGGAGGTCAAGAGGGAACCAGG + Intergenic
1092126297 12:6077325-6077347 CCTAAGGTGCAGAGAGAACCCGG - Intronic
1092898978 12:13040859-13040881 TGTGAGGGGCAAAGGAAACCAGG - Intergenic
1096156194 12:49342633-49342655 CGGCAGGTACAGATGGAACCAGG + Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097891354 12:64780767-64780789 CGGGAGGAGCAGCGGGAGCCGGG + Intergenic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1100616136 12:96233155-96233177 CATGAGGTGGAGAGGGAAAAAGG + Intronic
1100849847 12:98697971-98697993 CCTGGGGTGCACAGGGACCCTGG + Intronic
1102101366 12:110281324-110281346 CGTGCGGCGCTGAGGGACCCGGG + Intronic
1102919917 12:116784251-116784273 CGTGAGCTGCAGTGAGAGCCAGG - Intronic
1103828755 12:123762309-123762331 CGCGCAGTGCAGAGGGAGCCGGG - Intergenic
1104492097 12:129203192-129203214 AGTGAGGTGCAGATGCAGCCGGG - Intronic
1104593059 12:130099943-130099965 GGTGAGAGGCAGTGGGAACCAGG + Intergenic
1104858185 12:131911613-131911635 AGTGAGGTGCAGAGGGCAGGTGG + Intronic
1105985401 13:25561278-25561300 CAAGAGATGCAGAGGGAACAGGG - Intronic
1117476163 14:56097030-56097052 AGAGAAGTGGAGAGGGAACCTGG + Intergenic
1117647218 14:57865449-57865471 GGGGAGGTGCGGAGGGGACCTGG - Intronic
1118303402 14:64634766-64634788 CAGGAGGTGCACAGGGAACAGGG + Intergenic
1119235766 14:73017967-73017989 GAAGAGGTGCAGAGGGAAGCAGG - Intronic
1119940589 14:78637023-78637045 AGAGAGGTGAAGAGGGAGCCAGG - Intronic
1121348941 14:93157339-93157361 TGTGAGGTGCTAAGGGAATCTGG + Intergenic
1123709856 15:22979785-22979807 TGTGAGGAGCGGAGGGAGCCTGG - Intronic
1123995581 15:25715900-25715922 CGTGATATGCATATGGAACCAGG - Intronic
1127728007 15:61769849-61769871 CCTGATGTGCAGAGGGATTCAGG - Intergenic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1128806460 15:70534535-70534557 GGGGAGGTGCGGAGGGAACAAGG + Intergenic
1129522452 15:76194448-76194470 CCTGAGGGACACAGGGAACCAGG - Intronic
1129845984 15:78767951-78767973 GGGGAGGAGCAGAGGGAGCCGGG - Intronic
1130599069 15:85264074-85264096 GGGGAGGAGCAGAGGGAGCCGGG - Intergenic
1131072114 15:89472559-89472581 CCTGAGGTGCAGTGGGCACATGG - Intronic
1134131852 16:11655616-11655638 TGTGAGGGGCAGAGGGGCCCAGG + Intergenic
1135152534 16:20021524-20021546 AGTGAGGTGCTGAGAGGACCAGG + Intergenic
1135525966 16:23213760-23213782 TGTGAGGTGCTGGGGGAACCAGG + Intronic
1136089229 16:27906555-27906577 CAGGAGGTGCAGAGGGCCCCGGG - Intronic
1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG + Intronic
1137293700 16:47070043-47070065 CGAGGGGTGCAGAGGGATTCTGG - Intergenic
1137460468 16:48656688-48656710 CGAGAAGTGCAGAGTGAAGCGGG - Intergenic
1138201333 16:55091110-55091132 CCCGAGATGCAGAGGAAACCAGG + Intergenic
1138659050 16:58507177-58507199 TGTGAGGGGCAGAGGGGAACAGG + Intronic
1139493726 16:67301312-67301334 CGTGAGGTGACGAGGGAATTTGG + Intronic
1140256838 16:73344952-73344974 GGGGAGCTGCAGAGAGAACCTGG + Intergenic
1143165039 17:4893395-4893417 CGTGAGGGGCAGGGAGAAGCTGG - Intronic
1143683762 17:8497090-8497112 GCTGAGGTGCTGAGGAAACCAGG - Intronic
1144810104 17:17993603-17993625 GCTGAGCTCCAGAGGGAACCAGG + Intronic
1145904010 17:28506551-28506573 CTTGAGCTGCAGTGAGAACCTGG - Intronic
1146423111 17:32707969-32707991 AGTGAGATCCAGAGGAAACCAGG - Intronic
1151201228 17:72469429-72469451 TGTGATGTGCAGTAGGAACCCGG + Intergenic
1152012413 17:77726709-77726731 TTTGAGGTGCAGAGTGAAGCTGG - Intergenic
1153500336 18:5742930-5742952 TGAGAGGTGCATAGGAAACCAGG - Intergenic
1154350196 18:13576629-13576651 TGTGAAGTGCAAAGAGAACCAGG - Intronic
1156192752 18:34738593-34738615 ACCGAGGTGCAGAGGGAACAGGG - Intronic
1156257208 18:35409771-35409793 CTTGAGGGGCAAAGGGAACGTGG + Intergenic
1157173513 18:45429872-45429894 CTTCAGGAGCAAAGGGAACCAGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159750237 18:72291968-72291990 TGTGAAATGCAGAAGGAACCTGG - Intergenic
1160029406 18:75245528-75245550 CGTCTGGTGCAGCGGGCACCTGG - Intronic
1160042866 18:75361154-75361176 CAGGTGGTGCAGAGGGAACGTGG + Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1161604415 19:5206717-5206739 CGGGAGGGGCAGAGGCATCCGGG + Exonic
1162309963 19:9900430-9900452 AGTGTGGTGCAGAGAGATCCCGG - Intronic
1163129996 19:15266378-15266400 CTTGAGATGCACAGGGAACATGG - Intronic
1163595096 19:18216694-18216716 CGGGAGGGGCAGAGGGGAGCGGG - Intronic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1164713181 19:30373857-30373879 CCTGAGCTGCAGTGGGAGCCGGG + Intronic
1165877183 19:39016377-39016399 CGTGAGGGGCTGGGGGAAACGGG + Intronic
1166698501 19:44867972-44867994 AGTGGGGGGCAGAGGGAAGCGGG + Intronic
1167292337 19:48631076-48631098 ACTGAGGTCCAGAGGGACCCAGG + Intronic
1168231449 19:55034920-55034942 GTTGGGGTGCAGAGGGAGCCTGG - Intronic
925879088 2:8335891-8335913 CAGGAGGTGCAGAGGAAACCTGG + Intergenic
926172532 2:10561340-10561362 GGTGATGTGCAGAGGGAAATGGG + Intergenic
926227980 2:10982013-10982035 CAGGAGGTGCTCAGGGAACCGGG - Intergenic
927023578 2:19042635-19042657 ATTGAGGTCCTGAGGGAACCTGG - Intergenic
929195073 2:39176948-39176970 AGTGAGGTGCCCAGGGAGCCAGG - Intronic
929776800 2:44935170-44935192 CGGGAGGAGCACGGGGAACCCGG + Intergenic
930880527 2:56265025-56265047 GGTAAGGGGCAGAGGTAACCTGG - Intronic
931173933 2:59834022-59834044 CCTGGGGTGCTGAGGGAGCCTGG - Intergenic
932320534 2:70819314-70819336 GGTGGGGTGCAGAGGGAACTGGG - Intronic
932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG + Intronic
932702356 2:74000536-74000558 GGGGAGGTGCGGAGGGATCCAGG + Intronic
935061820 2:99615300-99615322 TGTGTGGTGCAGAGGGGACCTGG - Intronic
937443050 2:121933152-121933174 CGTGTGGTCCACAGGGACCCTGG - Intergenic
938307731 2:130266407-130266429 CCTGAGGTCCAGATGGACCCTGG - Intergenic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
944615642 2:201456821-201456843 GGTGAAGTTCAGAGGAAACCAGG + Intronic
945437381 2:209834942-209834964 CCTCAGGTGCAGAGGATACCTGG - Exonic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948540344 2:238686842-238686864 CGTGATGTGGAGTGGGAGCCCGG + Intergenic
948668904 2:239553836-239553858 CTGGAGGTGCAGAGGGGCCCGGG - Intergenic
1169787390 20:9374526-9374548 GGTGAGGTGAAGAGGGAAGACGG + Intronic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1175405566 20:58723681-58723703 CCTAAGGTGCAGAGGGGACAAGG + Intergenic
1176093975 20:63331173-63331195 CGTGAGGCGCAGAGAGAGGCGGG - Intronic
1176111793 20:63414214-63414236 CGTGAGGGGCCGAGGGGGCCGGG + Intronic
1176613802 21:9011120-9011142 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1176711390 21:10152769-10152791 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1179890243 21:44331530-44331552 CGTGAGGTGCAGGGAGCCCCTGG - Intronic
1180084841 21:45503939-45503961 TGGGGGCTGCAGAGGGAACCCGG + Intronic
1181328508 22:22070229-22070251 CATGAGGAGCAGAGGGGTCCAGG - Intergenic
1181363693 22:22357799-22357821 GGTGAGGAGGAGAGGGAAGCCGG - Intergenic
1181366507 22:22380884-22380906 GGTGAGGAGGAGAGGGAAGCTGG - Intergenic
1182093691 22:27612493-27612515 TGTGGGGTGCAGTGGGAGCCAGG - Intergenic
1182859136 22:33544165-33544187 GGTGAAGTCCAGAGGAAACCAGG - Intronic
1183323803 22:37180683-37180705 CATGAGGGGCAGAGAGCACCTGG + Exonic
1184256589 22:43290521-43290543 GGGGAGGTGCAGAGGGCCCCAGG - Intronic
950393780 3:12718163-12718185 CTTGGGGGGCTGAGGGAACCCGG - Intergenic
952003333 3:28810849-28810871 AGTGAGGTGGATAGGGAGCCAGG + Intergenic
953415355 3:42712497-42712519 AGCCAGGTGCAGAGGGAAGCTGG - Intronic
953698516 3:45178618-45178640 CGTGAGGTGCACTGTGTACCAGG + Intergenic
954128453 3:48546961-48546983 GGTGAAGTCCAGAGGAAACCAGG - Intronic
956144368 3:66177520-66177542 TGTGAGGTGGAGGGGGAACAAGG - Intronic
958084558 3:88789737-88789759 GGTGAGGAGCAGAGGGACACAGG - Intergenic
961390131 3:126547655-126547677 GGTGTGGACCAGAGGGAACCTGG + Intronic
961556229 3:127698209-127698231 GGTGAGGGGCAGAGGGAAACTGG + Intronic
962185864 3:133258753-133258775 AGAGAGTTGGAGAGGGAACCAGG + Intronic
962445309 3:135458458-135458480 CCTGAGGAGCAGAGGAAACATGG - Intergenic
966074139 3:175916274-175916296 AGAGAAGTGCAGAGGGAATCAGG + Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969398811 4:6939997-6940019 CGTGAGGTGCCGCGGGAGCCAGG - Intronic
969856864 4:10007029-10007051 GGTGAAGTCCAGAGGAAACCAGG - Intronic
970230681 4:13907642-13907664 GGTAAGGTGCAGAGAGTACCAGG + Intergenic
978892636 4:113848316-113848338 CATGTGTTGCAGAAGGAACCTGG - Intergenic
982288847 4:153760114-153760136 CCTGAGGTTCTGAAGGAACCGGG - Exonic
983106831 4:163697046-163697068 AGTGAAGTCCAGAGGAAACCAGG + Intronic
985783759 5:1883782-1883804 CGCGAGGGGCAGGGGGAAGCCGG - Intronic
986507958 5:8472363-8472385 AGTGAAGTCCAGAGGAAACCAGG - Intergenic
986726867 5:10604981-10605003 CGTGAGTTGCAGTGGGATGCTGG + Intronic
987541567 5:19262042-19262064 AGAGAGGTGCAGAGTGAAGCAGG - Intergenic
989231528 5:39092721-39092743 AGTGAAGTCCAGAGGAAACCAGG + Intergenic
990497987 5:56367873-56367895 CATGTGGTCAAGAGGGAACCTGG - Intergenic
996581599 5:125037661-125037683 GGTGAGGCCCAGAGGAAACCAGG - Intergenic
1001489956 5:172148303-172148325 GGTGGGGGGCAGAGGGAAGCAGG + Intronic
1003175989 6:3752253-3752275 CCTGAGGCACGGAGGGAACCCGG - Intergenic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1006125867 6:31837693-31837715 CATAAGGTACAGAGGGAAGCAGG + Intronic
1006297507 6:33176468-33176490 CCTGAGGTCCAGAGGGACCCTGG + Exonic
1006670180 6:35725547-35725569 GGTGGGGTGCAGAGAGACCCTGG - Intronic
1006724317 6:36185885-36185907 AGTGAAGTCCAGAGGAAACCAGG + Intergenic
1007094184 6:39203343-39203365 AGTCAGGGGCAGAGGGAAACGGG + Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1007781542 6:44257422-44257444 CGTGGGGTGGAGGGGGAACCGGG + Exonic
1009475269 6:64083437-64083459 CTTGAGGGGCAGAAGTAACCTGG + Intronic
1012138921 6:95596177-95596199 GGTGAGGGGGAGAGGGAACGGGG + Intronic
1014127885 6:117797831-117797853 AGTGATGTGCAGAAGGAACAGGG + Intergenic
1018272352 6:162093840-162093862 GGTGAGGTGCAGAGGAAACAAGG - Intronic
1018371846 6:163175644-163175666 GGTGAGCTGCAGGTGGAACCAGG + Intronic
1018663730 6:166114077-166114099 CGAGAGCTGCTGAGGGAGCCAGG + Intergenic
1018812604 6:167308557-167308579 GGTGGGGTGCAGGAGGAACCAGG + Intronic
1019882760 7:3877426-3877448 TGTGGGGTGGAGAGGGAACACGG - Intronic
1020002529 7:4764033-4764055 GGAGAGCTGCAGAGGGACCCAGG + Exonic
1022047948 7:26638343-26638365 CGAGAAGTGCAGAGGGAAGGAGG - Intronic
1022184971 7:27958508-27958530 TGTGTGCTGCAGAGGGAACATGG + Intronic
1022813398 7:33890864-33890886 GGAGAGGAGCAGAGGGAAGCAGG + Intergenic
1022956604 7:35386707-35386729 TGTAAAGTGCAGAGGGTACCTGG + Intergenic
1023081598 7:36531985-36532007 CTTGAGGAGCCGAGAGAACCTGG - Intronic
1025034705 7:55586987-55587009 CCTGAGGTTCAGATGGACCCTGG - Intergenic
1033657266 7:143382198-143382220 GGTGAGGGGTAGAGGGACCCCGG + Intronic
1034649169 7:152675965-152675987 CGAGGGGAGCCGAGGGAACCCGG - Intronic
1036105017 8:5829424-5829446 CTTTAGGTGCAGAGGGAAATGGG + Intergenic
1036822026 8:11948544-11948566 GGTGAGGTGGAGAGGGACACAGG - Intergenic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041720546 8:60971566-60971588 CCAGAGGTGCAGAGTAAACCTGG + Intergenic
1047193307 8:122698526-122698548 TGTGAGGTCCAGAGTGACCCCGG + Intergenic
1048036347 8:130681024-130681046 TGTGTGGTGCAGTGGGAAGCAGG - Intergenic
1048065721 8:130966428-130966450 GGTTAGGTGCAGAGGGAAGAAGG + Intronic
1048262012 8:132953188-132953210 TGTGAGTTGCAGAGGGGAGCTGG + Intronic
1049221016 8:141428952-141428974 CGTGGGGTGGGGAGAGAACCCGG - Intronic
1049424342 8:142531448-142531470 CGTGGGGTGCACAGGGAGCAGGG + Intronic
1049575581 8:143388388-143388410 CTGGAGGTGCAGCGGGAACCAGG - Intergenic
1051671216 9:19512541-19512563 GGTCAGGTGCAGAGGGCAGCTGG + Exonic
1052512076 9:29434869-29434891 TGTGAGGGGCAGAGGGAGACAGG - Intergenic
1053293133 9:36895177-36895199 CGAGAGGCGCAGAGGGAAGCAGG + Intronic
1053648378 9:40138460-40138482 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1053757360 9:41325381-41325403 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1054329356 9:63736403-63736425 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1054536202 9:66237710-66237732 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1054744707 9:68843018-68843040 CGTGAAGGGCAGAGGGAAGCTGG - Intronic
1057294435 9:93827148-93827170 GGTGAGGTGCTGAGGGAGGCGGG + Intergenic
1057570361 9:96199684-96199706 CGTGACGTGCAGAGCAAACCAGG + Intergenic
1059405598 9:114097007-114097029 CTTGAGGTGCAGAGACCACCAGG + Intronic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1061665068 9:132155949-132155971 TGTGAGGTGCACAGGCAGCCTGG + Intergenic
1061950417 9:133932890-133932912 GGCCAGGAGCAGAGGGAACCAGG + Intronic
1061951352 9:133938074-133938096 TGTGAGGCGCAGAGGGAATTTGG - Intronic
1202796143 9_KI270719v1_random:121758-121780 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1187473261 X:19588178-19588200 AGTGAAGAGCAGAGGGAGCCTGG + Intronic
1191027574 X:55930962-55930984 CCTGAGGTACAGAGAGAAGCTGG - Intergenic
1192146542 X:68686503-68686525 CGTGGGGTGTGGAGGGCACCCGG + Intronic