ID: 1136389164

View in Genome Browser
Species Human (GRCh38)
Location 16:29951464-29951486
Sequence CAGCTCGGACACAGTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 9, 3: 39, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136389164 Original CRISPR CAGCTCGGACACAGTGGGGT AGG (reversed) Intronic
900458984 1:2791142-2791164 TTGCTCAGACACACTGGGGTGGG - Intronic
901066287 1:6496292-6496314 CAGCTCAGGAACAGTGGAGTCGG - Intronic
903153578 1:21429676-21429698 CAGCAGGGACATAGTGGGGCTGG + Intergenic
903233551 1:21936108-21936130 CACCTCGGAGAGAGTGGGGGTGG + Intronic
903551438 1:24159688-24159710 CAGCCAGGACAGAGTGGGGTTGG + Intronic
903812476 1:26042522-26042544 GAGCTGGGACACAGGGTGGTGGG - Intronic
904306480 1:29593285-29593307 CAGCTCTGATGCAGGGGGGTTGG + Intergenic
904341588 1:29838387-29838409 CAGCTGGGGGGCAGTGGGGTGGG - Intergenic
905627343 1:39497831-39497853 CAGGTGGGACAGAGTGGGGCCGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
910289728 1:85588478-85588500 CAGCTCAGCCACAGTGGGATAGG + Intergenic
910330668 1:86069131-86069153 CAGCTTGGCCACAGTAGGGTAGG + Intronic
910515443 1:88054774-88054796 CAGTTCAGACACAGTAGGATAGG - Intergenic
911656645 1:100451311-100451333 CAGCAGGGAGACAGTGGGGTTGG - Intronic
912871534 1:113311295-113311317 CAGCTTGGTCACAGTGGGGAAGG + Intergenic
913100330 1:115558074-115558096 CAGCTAGAAAACTGTGGGGTTGG - Intergenic
915485398 1:156216723-156216745 CGGCACGGAGCCAGTGGGGTGGG - Intronic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
915693697 1:157716684-157716706 CAGCTCAGCCACAGTAGGGTAGG - Intergenic
916566573 1:165983993-165984015 CATCCTGGACACACTGGGGTGGG + Intergenic
917061754 1:171048988-171049010 CAGCTCAGCCACAGTAGGATAGG - Intronic
917387319 1:174491413-174491435 CAGCTCAGCCACAGTAGGATAGG - Intronic
918357955 1:183723963-183723985 CAGCTCAGTCACAGTAGGATAGG + Intronic
918989988 1:191685492-191685514 CAGCTCAGCCACAGTGGGATAGG - Intergenic
919272006 1:195360271-195360293 CAGCTCAGCCACAGTAGGATAGG + Intergenic
921002213 1:211055715-211055737 CAGCTCAGCCACAGTAGGATAGG + Intronic
922358163 1:224796016-224796038 CAGCTCAGCCACAGTAGGATAGG - Intergenic
922863325 1:228837920-228837942 CAGTTGTGACATAGTGGGGTTGG - Intergenic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1065431494 10:25661608-25661630 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1066154646 10:32661720-32661742 CAGCTCAGCCACAGTAGGATAGG - Intronic
1068447885 10:57146632-57146654 CAGCTCAGACACAGTAGGACAGG + Intergenic
1069900109 10:71702158-71702180 CAGCTCGGCCTCATGGGGGTCGG - Intronic
1070782461 10:79145596-79145618 CAGCCCTGAGACAGTGGGGTGGG + Intronic
1072344362 10:94488841-94488863 CAGCTCAGCCACAGTAGGATAGG - Intronic
1073218637 10:101851493-101851515 CAGCTCTGACAGAAGGGGGTTGG + Intronic
1073470696 10:103720452-103720474 CAGCCCAGACTCAGTGGGGGAGG - Intronic
1073823389 10:107291405-107291427 CAGCTCGGCCACAGTGGGTAGGG - Intergenic
1073827161 10:107337033-107337055 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1074765156 10:116694968-116694990 CAGCAAGGTCACTGTGGGGTGGG - Intronic
1077378299 11:2215783-2215805 CAGGACGGCCACTGTGGGGTAGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078992590 11:16664853-16664875 CAGCTCAGTCACAGTAGGATAGG + Intronic
1079473935 11:20808353-20808375 CAGCTCAGTCACAGTAGGATAGG - Intronic
1079516982 11:21281109-21281131 CAGCTCAGTCACAGTAGGATAGG + Intronic
1079565569 11:21878205-21878227 CAGCTCAGACACAGTAGGATAGG + Intergenic
1082195398 11:49298524-49298546 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1084001741 11:66299180-66299202 CAGATAGGACACAATGGGGATGG + Intergenic
1084492598 11:69486852-69486874 CAGTTCGGGGACAGTGGGGCAGG - Intergenic
1086660534 11:89411028-89411050 CAGCTCAGCCACAGTAGGATAGG + Intronic
1087299254 11:96413425-96413447 CAGCTCAAACACAGTAGGATAGG + Intronic
1088154902 11:106790824-106790846 CAGCTCAGCCACAGTAGGATAGG - Intronic
1088501944 11:110491699-110491721 CCACTCAGATACAGTGGGGTAGG + Intergenic
1089711474 11:120317805-120317827 CAGCTGGGATGCAGTGGGGCAGG + Intronic
1089762255 11:120736274-120736296 CAGCTCAGCCACAGTAGGATAGG - Intronic
1090606198 11:128425068-128425090 CTGCTGGGACACACTGTGGTGGG + Intergenic
1090676896 11:129007214-129007236 CAGCTTGGCCACAGTGGGATAGG - Intronic
1093259502 12:16917871-16917893 CAGCTCAGTAACAGTGGGGTAGG - Intergenic
1093619951 12:21277199-21277221 CAGCTCAGCCACAGTAGGATAGG + Intronic
1094091434 12:26654594-26654616 CAACTCTGATACAGTGTGGTAGG - Intronic
1095507348 12:42911548-42911570 CAGCTCTTACACAGAGAGGTGGG + Intergenic
1095573270 12:43706119-43706141 CAGCTCAGCCACAGAAGGGTAGG - Intergenic
1096334027 12:50739512-50739534 CAGCTCAGACACTCTGGGCTCGG + Exonic
1096343997 12:50829040-50829062 CAGCTCAGTCACAGAAGGGTAGG - Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097508578 12:60507380-60507402 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1098667376 12:73180691-73180713 CAGCTCAGACACAGTAGAATAGG - Intergenic
1098736674 12:74113369-74113391 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1099433788 12:82619729-82619751 CAGCTCAGCCACAGGGGAGTAGG + Intergenic
1099610080 12:84857214-84857236 CAGCTCCGCCACAATGGGCTAGG - Intergenic
1099610137 12:84857568-84857590 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1099616092 12:84937989-84938011 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1099794536 12:87382562-87382584 CAGGTGGGACAAAGTGGAGTGGG - Intergenic
1100061063 12:90575956-90575978 CAGCTCAGTCACAGTAGGATAGG - Intergenic
1101607434 12:106258341-106258363 CAGCTCAGCCACAGTAGGATAGG + Intronic
1102148027 12:110669356-110669378 CAGCAGGGACACAGTCAGGTTGG - Intronic
1102187074 12:110957297-110957319 CAGCTCCTACACAGTGCAGTTGG - Intergenic
1102459966 12:113094015-113094037 CTGCAGGGACACAGCGGGGTGGG - Intronic
1102915687 12:116750203-116750225 CAGCTCGGACAGGGCGGGGGCGG - Exonic
1103684797 12:122723474-122723496 CACCAGGGACACAGTGGGGAAGG - Intergenic
1104300118 12:127557396-127557418 CAGCTAGGACACACTGGGAGTGG + Intergenic
1105576870 13:21661929-21661951 CCTCTTGGACACACTGGGGTTGG + Intergenic
1106072361 13:26424733-26424755 CTGCTAGGACACAGTGTGGTAGG - Intergenic
1106350039 13:28921367-28921389 CAGCTCAGCCACAGTAGGATAGG - Intronic
1106561400 13:30849524-30849546 CAGCTCTGACTCAGTGGGTCTGG + Intergenic
1108857994 13:54819719-54819741 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1108972989 13:56401081-56401103 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1109058335 13:57581305-57581327 CAGCTCTGACACAGTTGGCAAGG + Intergenic
1109876377 13:68409229-68409251 TAGCTCAGAATCAGTGGGGTGGG + Intergenic
1109961698 13:69639553-69639575 CAGCTCGGCCACAGTAGAGTAGG - Intergenic
1110237411 13:73231170-73231192 CAGCTCTGTGATAGTGGGGTAGG + Intergenic
1111639321 13:90947445-90947467 CAGCTTGGCCACAGTGGGGTAGG + Intergenic
1114098949 14:19361301-19361323 CAGCCAGGACACAGCGGGGCGGG - Intergenic
1114458876 14:22874336-22874358 CACATCTGGCACAGTGGGGTGGG + Intronic
1115645565 14:35366585-35366607 CAGCGCTGTCACAGAGGGGTCGG - Intergenic
1115660953 14:35494065-35494087 CAGCTCAGTCCCAGTAGGGTAGG + Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116106412 14:40513738-40513760 CAGCTCAGCCACAGTAGGGTAGG + Intergenic
1116354831 14:43914828-43914850 CAGCTCAGTCAATGTGGGGTAGG + Intergenic
1116458442 14:45144825-45144847 CAGCTCAGCCACAGTGGGGAAGG - Intronic
1117159369 14:52973658-52973680 CAGCTCGGCCACAGTATAGTAGG - Intergenic
1117920430 14:60722320-60722342 AAGCTCAAACCCAGTGGGGTGGG + Intronic
1118096876 14:62546851-62546873 CAGCTCAGGCACAGTAGGATAGG + Intergenic
1118164400 14:63321755-63321777 CATCTGTAACACAGTGGGGTTGG + Intergenic
1118318276 14:64738474-64738496 AAGCTAGCACACAGTGGGGCTGG + Intronic
1118543500 14:66858322-66858344 CAGCTCAGCCACAGTAGGATAGG + Intronic
1125874771 15:43134018-43134040 CAGATCGGGCACCGTGCGGTGGG + Intronic
1127022189 15:54760470-54760492 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1127173444 15:56328142-56328164 CAGCTCAGCCACAATAGGGTAGG + Intronic
1128016807 15:64355571-64355593 CAGCTCTGTCCCAGCGGGGTGGG + Intronic
1128516943 15:68348268-68348290 CAGCACCCACACAGTGGGGGGGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1130045385 15:80440277-80440299 CATCTCGCACAGAGTGGGGCAGG + Intronic
1130631881 15:85577998-85578020 TAGGTGGGACACAGTGGTGTAGG + Intronic
1131060017 15:89398905-89398927 CAGCTGGGAAGCAGTGGAGTCGG + Intergenic
1131721234 15:95170832-95170854 CAGGGCAGACAAAGTGGGGTGGG + Intergenic
1131950225 15:97673589-97673611 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1132326805 15:100977408-100977430 CTTCTCTGACACCGTGGGGTGGG - Intronic
1132539786 16:503374-503396 CGACTCAGACACAGTGGGGGTGG - Intronic
1132574814 16:659496-659518 CAGGTGGAACACAGTGGGGTCGG + Intronic
1132574831 16:659555-659577 CAGGTGGAACACGGTGGGGTCGG + Intronic
1133739018 16:8637758-8637780 CAGCTCTGGCTGAGTGGGGTAGG - Intronic
1133739648 16:8641470-8641492 CAGCTGGTACACAGCAGGGTAGG + Intronic
1133834238 16:9351886-9351908 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1136389164 16:29951464-29951486 CAGCTCGGACACAGTGGGGTAGG - Intronic
1136679182 16:31945515-31945537 CAGCTCAGCCACAGTAGGTTAGG + Intergenic
1138390987 16:56669716-56669738 CGGCTCGGACTCAGTGGGTCGGG + Intronic
1138806817 16:60100088-60100110 AAGCTTGGCCACAGTGGAGTAGG - Intergenic
1140049520 16:71467946-71467968 TAGCTCCGACTCAGTGGGGGGGG + Intronic
1140470546 16:75211774-75211796 GAGCTGGTACACAGTGGGTTAGG + Intergenic
1141659159 16:85432443-85432465 CACCTGGGAGACAGTGGGCTGGG - Intergenic
1146399754 17:32493600-32493622 CAGCTGGGGCTCAGTGGGGAAGG + Exonic
1148337748 17:46852478-46852500 CACCTGGGGGACAGTGGGGTAGG + Intronic
1148747829 17:49928180-49928202 AGGCTGGGATACAGTGGGGTGGG + Intergenic
1149092861 17:52804744-52804766 CAGCTCAGACATAGTAGGATAGG - Intergenic
1152259995 17:79261678-79261700 CAGCTCGCACACAGGCGGGTGGG + Intronic
1152800698 17:82329478-82329500 CAGCCCTGACAGGGTGGGGTGGG - Intronic
1153074610 18:1148321-1148343 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1154494880 18:14948274-14948296 CAGCTGGGAACCAGTGGGCTGGG + Intergenic
1155316730 18:24579072-24579094 CAGCTAGAACTCAGTGGTGTGGG + Intergenic
1156155827 18:34300854-34300876 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157548984 18:48567737-48567759 CTGCTCTGTCACAGTGGGGTTGG + Intronic
1157879262 18:51304615-51304637 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1158468448 18:57712799-57712821 CAGCTCAGCCACAGTAGGATAGG + Intronic
1160138452 18:76296138-76296160 CAGCTCAGACACAGTAGGATAGG - Intergenic
1161604254 19:5205885-5205907 GAGCTCGGACCCAGTGGCGTTGG - Exonic
1162693022 19:12449448-12449470 CAGCTTGTCCACAGTGGGGTAGG - Intronic
1162693073 19:12449774-12449796 CAGCTCAGCCACAGTAGGATAGG - Intronic
1162779145 19:12997556-12997578 CAGCTCAGACACCGCTGGGTAGG - Intronic
1165283802 19:34820366-34820388 AAGCTTGGACACAGTGGTGGTGG + Intergenic
1165529549 19:36386582-36386604 CTACTTGGACACACTGGGGTGGG - Intronic
1166757206 19:45200626-45200648 TAGCTCTGTCACAATGGGGTTGG + Intronic
1167582233 19:50351984-50352006 CAGCTCAGACACAGTAGGATGGG - Intronic
1167849727 19:52192156-52192178 CAGCAAGTACAAAGTGGGGTGGG + Intronic
925129542 2:1484687-1484709 CACGTTGGACACAGTGGGGTTGG - Exonic
925493871 2:4424607-4424629 CAGGTGGGACACAGTGGGATGGG - Intergenic
926243487 2:11105223-11105245 CGGGTGGGGCACAGTGGGGTGGG - Intergenic
927424971 2:22971293-22971315 CAGCTCAGCCACAGCAGGGTAGG + Intergenic
928168950 2:28991250-28991272 GGGCTCAGACACAGTGGGGCTGG - Intronic
930439720 2:51390760-51390782 CAGCTCAGCCACAGTAGGATAGG - Intergenic
931958058 2:67450585-67450607 CAGACAGGACACAGTGGGCTTGG - Intergenic
933097862 2:78210555-78210577 CAGCTCAGCCACAGTAGGATAGG + Intergenic
933446583 2:82387485-82387507 CAGCTCTGTCACAGTAGGATAGG + Intergenic
934775377 2:96933860-96933882 AAGATCGGACTCAGTGGGATGGG - Intronic
935078674 2:99770826-99770848 CAGCTCAGCCACAGAGGGATAGG - Intronic
935750907 2:106233015-106233037 CAGCTCAGCCACAGTAGGATAGG + Intergenic
935812896 2:106817375-106817397 CAGCTCAGCCACAGTAGGATAGG + Intronic
938716916 2:134029253-134029275 CAGCTGCCAGACAGTGGGGTGGG + Intergenic
939144482 2:138396158-138396180 CAGCTCAGTCACAGTAGGATAGG + Intergenic
939710335 2:145509412-145509434 CAGCTCAGACACAGCAGGATTGG - Intergenic
939930811 2:148230889-148230911 CAGCTCAGCCACAGCAGGGTAGG - Intronic
940738436 2:157480006-157480028 CAGCTCAGCCACAGCGGGATAGG + Intronic
941059303 2:160827481-160827503 CAGCTCAGGCACAGAGGGGCAGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
944760103 2:202806253-202806275 CAGCTCAGCCACAGTAGGATAGG + Intronic
944760318 2:202807774-202807796 CAGCTCAGCCACAGTAGGATAGG + Intronic
945575619 2:211525346-211525368 CAGCTCAGCCACAGTAGGATAGG + Intronic
947130960 2:226924353-226924375 CAGCTCAGCCACAGTAGGATAGG - Intronic
947247851 2:228069934-228069956 CAGCTGGGACACAGTGAGGTGGG - Intronic
947669964 2:231929791-231929813 CAGCTCTGCCACAGTAGGCTGGG + Intergenic
948475550 2:238216669-238216691 CAGCTCAGCCACAGTAGGATAGG - Intergenic
948845855 2:240682541-240682563 CTGCAGGGACACGGTGGGGTTGG + Exonic
948848004 2:240692189-240692211 CTGCAGGGACACAGTGGGGTTGG - Exonic
948869524 2:240791322-240791344 CAGCTCTGACACAGAGGCCTGGG + Intronic
1170235992 20:14105805-14105827 CAGCTCAGCCACAGTAGGATAGG + Intronic
1170864156 20:20138094-20138116 CAGCTCAGCCACAGTTGGATAGG - Intronic
1171431407 20:25085104-25085126 GTGCTCAGACACAATGGGGTGGG + Intergenic
1172770861 20:37381903-37381925 CAGCTCAGAGAATGTGGGGTTGG - Intronic
1173204272 20:40980290-40980312 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1174691000 20:52504273-52504295 CAGCTCAGTCACAGTAGAGTAGG + Intergenic
1175530907 20:59673805-59673827 CAGTTCGGACACATTTGGGAGGG - Intronic
1175546549 20:59781772-59781794 CTCCTAGGACACAGTGGGGCAGG - Intronic
1177494635 21:21873046-21873068 CAGCTCAGACACAGTAGAATAGG - Intergenic
1177849793 21:26332915-26332937 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1179652452 21:42820506-42820528 CAGCTCGGCCACAGTAGGACAGG + Intergenic
1181134993 22:20758906-20758928 CAGCTGGGAGCCAGTGGAGTTGG - Intronic
1181473673 22:23155965-23155987 CAGCTGGGACACAGCTGGGCAGG + Exonic
1183602634 22:38848950-38848972 CAGCACTGAGACAGTGTGGTGGG - Intergenic
1183986928 22:41575208-41575230 CAGCTCAGTCACCGTGGGGACGG - Exonic
1184045711 22:41971225-41971247 CAGCCACCACACAGTGGGGTGGG - Intergenic
1184850379 22:47116281-47116303 CTGCTTAGACACAGTGGGGACGG + Intronic
1185159814 22:49216736-49216758 CACCTCGGAGGCGGTGGGGTTGG - Intergenic
949448522 3:4161788-4161810 CAGCTCAGCCACAGTGGGGTAGG - Intronic
950472862 3:13197360-13197382 CAGCTCAGCCCCAGTGGGGCAGG - Intergenic
950868531 3:16209283-16209305 CTGAAAGGACACAGTGGGGTTGG + Intronic
951172189 3:19555077-19555099 CAGCTCAGCCACAGTAGGATAGG - Intergenic
952416845 3:33097217-33097239 CGGCTCGGCCACAGCGGGGCGGG - Exonic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
952673030 3:35993990-35994012 CAGCTTGACCACAGTGGAGTAGG + Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
958682843 3:97353305-97353327 CAGCTCGGCCACAGTGGGATAGG + Intronic
958850069 3:99314262-99314284 CAGTTAGGTAACAGTGGGGTTGG + Intergenic
959443806 3:106412548-106412570 CAGCTCAGCCACAGTAGGATAGG - Intergenic
959903471 3:111685103-111685125 CAGGTGGGACACAGTGGAGATGG + Intronic
960378106 3:116928031-116928053 CAGCTCTGCCAAACTGGGGTGGG + Intronic
961952247 3:130762275-130762297 CAGCTCAGCCACAGTAGGATAGG + Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
962767534 3:138579520-138579542 CAGCTCAGTCACAGTAGGATAGG + Intronic
963763403 3:149308162-149308184 CAGCTCAGCCACAGTAGGATAGG - Intergenic
964209447 3:154211012-154211034 CAGCTCAGCCACAGTGGGAGAGG - Intronic
964239461 3:154574528-154574550 CAGCTCAGACACAGCTGGATAGG + Intergenic
964804044 3:160587483-160587505 CAGCTCAGCCACAGTAGGATAGG + Intergenic
966151623 3:176873286-176873308 CAGCTCAGCCACAGTAGGATAGG + Intergenic
966329040 3:178790422-178790444 CAACTTGGCCACAGTAGGGTAGG + Intronic
966453981 3:180094256-180094278 CAGCTCAGACACAGTAGAATAGG - Intergenic
966689351 3:182726949-182726971 CAGCTCGGACACAGAAGGGGCGG - Intergenic
967930315 3:194686195-194686217 CAGCTCGCCCAAAGTGCGGTCGG - Intergenic
968613662 4:1567943-1567965 CAGCTCGGCCCCAGTGTGTTAGG + Intergenic
973348504 4:49082705-49082727 CAGCTCAGCCACAGTAGGTTAGG + Intergenic
973786483 4:54337283-54337305 CAGGTGGGACACGGTGGGGCTGG + Intergenic
973919860 4:55673862-55673884 CAGCTCAGCCACAGTAGGATAGG - Intergenic
974414958 4:61595154-61595176 CAGCTCAGCCACAGTGGGATAGG - Intronic
974415018 4:61595502-61595524 CAGCTCAGCCACAGTAGGATAGG - Intronic
974469606 4:62302071-62302093 CAGCTCAGCCACAGTAGGATAGG + Intergenic
975095408 4:70450979-70451001 CAGCTCAGAGACAGTGGACTGGG - Intronic
975406462 4:73996251-73996273 CTGGTGGGACACACTGGGGTTGG - Exonic
975629630 4:76387230-76387252 CAGTTCAGCCACAGTAGGGTAGG + Intronic
976041039 4:80885523-80885545 CAGCTCAGTCACAGTGGGATAGG + Intronic
977744999 4:100535952-100535974 CAGCATGGCCACAGAGGGGTAGG + Intronic
979504499 4:121480097-121480119 CAGCTCAGACACAGTAGACTAGG - Intergenic
980660703 4:135854897-135854919 CAGCGCGGTCACAGTGGTGGTGG - Intergenic
981975517 4:150723360-150723382 CAGCTCAGCCACAGTAGGATAGG + Intronic
982933548 4:161440304-161440326 AAGTTTGGACACAGTGGTGTAGG - Intronic
983683969 4:170385545-170385567 CAACTAGGTCACTGTGGGGTAGG - Intergenic
983869351 4:172807149-172807171 CAGCTTGCACACAGTGGAGAAGG + Intronic
985716678 5:1466970-1466992 CAGCTCTGACAAAGCGGGGCAGG - Intronic
986544491 5:8880453-8880475 CAGCTCAGCCACAGTAGGATAGG - Intergenic
986631223 5:9775780-9775802 CAGCTCAGCCACAGTAGGATGGG - Intergenic
986719824 5:10552989-10553011 CTGCTCAGACCAAGTGGGGTGGG + Intergenic
986738905 5:10688885-10688907 CAGCTACTACACAGTGGGGCTGG - Intronic
987152466 5:15056609-15056631 CAGCTCAGACCCAGAGGGGTGGG + Intergenic
987537354 5:19206419-19206441 CAGCTCAGCCACAGTAGGGTAGG + Intergenic
987772922 5:22330159-22330181 CAGCTCAGCCACAGTAGGATAGG + Intronic
988117792 5:26919726-26919748 CAGCTCAGTCACAGTAGGATAGG + Intronic
988340079 5:29959929-29959951 CAGCTCAGGCACAGTAGGATAGG + Intergenic
988608570 5:32703696-32703718 CAGCTCAGCCACAGTAGGATAGG - Intronic
991395343 5:66198856-66198878 CAGCTCAGCCACAGTAGGATAGG - Intergenic
992934485 5:81687656-81687678 CAGCTCGGTCACAGTAGGATAGG + Intronic
994320264 5:98386847-98386869 CAGCTCAGCCACAGTGGAATAGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995835386 5:116395345-116395367 CAGCTGGGACTCTGCGGGGTTGG + Intronic
996944983 5:129055880-129055902 CAGCTCAGCCACAGTAGGATTGG + Intergenic
997186183 5:131884349-131884371 CAGCTCAGCCACAGCAGGGTAGG + Intronic
997472541 5:134124851-134124873 CAGCTCAGACATGGTGGAGTGGG - Intronic
998291243 5:140916627-140916649 CAGCTCAGCCACAGTAGGATAGG - Intronic
999849531 5:155523446-155523468 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1000433478 5:161179755-161179777 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1000806838 5:165805824-165805846 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1001910554 5:175513929-175513951 CAGCTGGGGCACAGTGGGAGGGG + Intronic
1002853867 6:1020717-1020739 CTGCTTGTACACAGTGGGGCAGG - Intergenic
1003157805 6:3611052-3611074 CAGCTTGGACTCAGAGAGGTGGG - Intergenic
1005279965 6:24262663-24262685 CAGCTCAGCCACAGTAGGATAGG + Intronic
1006018686 6:31103706-31103728 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1006554234 6:34852109-34852131 CAGCTTGGCCATAGTGGGGTAGG - Intronic
1007022269 6:38532588-38532610 CAGCTCAGCCACAGTAGGATAGG + Intronic
1008586374 6:52954183-52954205 GAGCACGGACACAGTGTGGGTGG - Intergenic
1008848562 6:55996810-55996832 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1009353411 6:62709432-62709454 CAGCTCAGCCACAGTGGGGTAGG - Intergenic
1010313728 6:74420534-74420556 CTGTTCAGCCACAGTGGGGTAGG + Intergenic
1011598340 6:89037560-89037582 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1011882930 6:92053351-92053373 CAGCTCTTACACAGAAGGGTGGG + Intergenic
1012190735 6:96276839-96276861 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1012661850 6:101908094-101908116 CAGCTCGGACAGAATGATGTAGG - Intronic
1012892067 6:104908041-104908063 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1015189759 6:130459852-130459874 CAGTTCTGAAACAGTGGAGTTGG + Intergenic
1015460716 6:133487892-133487914 CAGCTTGGCAACAGTGGGATAGG + Intronic
1015691838 6:135933105-135933127 GAGCTAGGATACAGTGGAGTTGG + Intronic
1015907241 6:138129737-138129759 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1017523262 6:155220523-155220545 CACCTAGCACACAGTGAGGTTGG + Intronic
1018535791 6:164817975-164817997 CATCTTGGCCACAGCGGGGTAGG + Intergenic
1018703307 6:166445212-166445234 CGGCCCAGTCACAGTGGGGTGGG + Intronic
1019315062 7:380518-380540 CAGCTCGGACAGAGGGAGGGAGG + Intergenic
1021842623 7:24733079-24733101 CAGCTCAGCCACAGTAGGATAGG + Intronic
1022223584 7:28340123-28340145 GAGTTTGGCCACAGTGGGGTAGG - Intronic
1023646221 7:42318718-42318740 AAGCTCAGCCACAGTGGGATAGG + Intergenic
1023836642 7:44072528-44072550 CAGCTCGGGGCCAGTGGGGCTGG + Exonic
1023867805 7:44247090-44247112 CACCTGGCACAGAGTGGGGTGGG + Intronic
1029286356 7:99468636-99468658 CTGCCCGGACACAGTGCAGTCGG - Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030222394 7:107110568-107110590 CAGCTCAGCCACAGTAGGGTAGG + Intronic
1030408373 7:109143493-109143515 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1031353526 7:120763421-120763443 CAGCTCAGCCACAGTAGAGTAGG - Intergenic
1031480802 7:122276272-122276294 AAGATCTAACACAGTGGGGTTGG - Intergenic
1031905703 7:127457939-127457961 CAGCTCAGTCACAGTAGGATAGG + Intergenic
1032939086 7:136768033-136768055 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1033230494 7:139593833-139593855 CAGCTGGGACACAGAAGGGCTGG + Intronic
1033403768 7:141052375-141052397 CAACTGGTAAACAGTGGGGTGGG - Intergenic
1033849243 7:145474435-145474457 TAGCTAGGTCATAGTGGGGTGGG + Intergenic
1035633841 8:1128469-1128491 CAGCTGGAACACAGTGGCGAGGG - Intergenic
1036814861 8:11894563-11894585 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1036936245 8:13004825-13004847 CAGCTCGGCCACAGTGGGGAAGG + Intronic
1038689616 8:29749374-29749396 CAGCTAGGGCACATTGTGGTTGG - Intergenic
1041415963 8:57609204-57609226 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1041883394 8:62779051-62779073 CAGCTCAGCCACAGTAGGATAGG - Intronic
1042428134 8:68672926-68672948 CAGCTCAGTCACAGTAGGATAGG + Intronic
1042821585 8:72935864-72935886 CAGCTAGGAGACAGATGGGTCGG - Intronic
1043005393 8:74811864-74811886 CAGCTGGGAAACAGTGGGGCTGG + Intronic
1043226938 8:77745349-77745371 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1043227062 8:77746154-77746176 CAGCTCAGCCACAGTGGGGTAGG + Intergenic
1043559086 8:81469604-81469626 CAGCTCCAACACAGAGTGGTGGG + Intergenic
1043567440 8:81563006-81563028 CAGCACAGACCCAGTGGGGGTGG + Intergenic
1044193114 8:89342874-89342896 CAGCTCAGACACAGCAGGATAGG - Intergenic
1046273105 8:111921801-111921823 CTCCTCTGACACTGTGGGGTGGG + Intergenic
1048293453 8:133197675-133197697 CAGATTGGAGACGGTGGGGTGGG - Intronic
1050121987 9:2317230-2317252 CAGCTCAGCCACAGTGGGTAAGG - Intergenic
1050359433 9:4815501-4815523 CAGATCTGGCCCAGTGGGGTGGG + Intronic
1050508170 9:6368878-6368900 CAGCTAAGACACAGTAGGATAGG + Intergenic
1050807194 9:9695287-9695309 CAGCTCAGTCACAGTAGGATAGG - Intronic
1051291715 9:15552469-15552491 CAGCTGGGATACAATGGGGACGG + Intergenic
1051923836 9:22299347-22299369 CAGCTCAGACACAGCAGGATAGG - Intergenic
1052204963 9:25828053-25828075 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1052405811 9:28059358-28059380 AAGCTGGGACCCGGTGGGGTGGG - Intronic
1052774989 9:32724185-32724207 CGGGTGGGACACAGTGGGGATGG + Intergenic
1053204385 9:36173864-36173886 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1055580017 9:77698614-77698636 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1056063697 9:82911131-82911153 GAACCTGGACACAGTGGGGTAGG - Intergenic
1056136238 9:83631880-83631902 CAGATAGGACACTGTGGGCTGGG - Intronic
1057550973 9:96050673-96050695 CAGCTACCGCACAGTGGGGTGGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1059900666 9:118921643-118921665 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1062417858 9:136462340-136462362 CTGCTCTGGGACAGTGGGGTTGG - Intronic
1062553471 9:137101590-137101612 CACCTCGGCCACAGTGCTGTCGG - Exonic
1062663662 9:137654652-137654674 CAGCTGGGGCCCAGTGAGGTGGG + Intronic
1185955817 X:4487795-4487817 CAGCTCTCAGACAGTAGGGTAGG + Intergenic
1187314817 X:18183544-18183566 CAGCTTGGCCACAGTGGGGTAGG + Intronic
1187618742 X:21027350-21027372 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1188078511 X:25807772-25807794 CAGCTGGGCAGCAGTGGGGTAGG - Intergenic
1188578937 X:31686973-31686995 CAGCTCAGCCACAGTAGGATGGG + Intronic
1188897404 X:35686272-35686294 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1188972350 X:36633145-36633167 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1189013500 X:37071231-37071253 CAGCTCAGCCACAGTAAGGTAGG - Intergenic
1189160845 X:38806201-38806223 CAGCTTATACACACTGGGGTGGG - Exonic
1189640705 X:43067901-43067923 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1189890090 X:45591944-45591966 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1192135007 X:68588973-68588995 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1192614767 X:72608271-72608293 CAGCTCAGCCACAGTAGGATAGG - Intronic
1193092564 X:77510450-77510472 CAGCTCAGCCACAGTGGGCTAGG + Intronic
1193194892 X:78619934-78619956 CAGCTCAGAAACAGTAGGATAGG - Intergenic
1193232668 X:79066524-79066546 CAGCTCAGCCACAGCAGGGTAGG - Intergenic
1193344442 X:80388582-80388604 CAGCTCAGCCACAGTAGGATAGG - Intronic
1193449630 X:81649745-81649767 CATCTTGGTCACAGCGGGGTGGG - Intergenic
1193561423 X:83022359-83022381 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1193650317 X:84123342-84123364 CAGCTCAGCCACAGTGGGGTAGG + Intronic
1194329182 X:92560111-92560133 CAGCTCAGCCACAGTAGGATAGG + Intronic
1194415495 X:93606556-93606578 CACCTCGGGCACAGTGAGGTAGG + Intergenic
1194526434 X:94983314-94983336 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1194783884 X:98058170-98058192 CAGCTCAGCCACAGTAGGATCGG - Intergenic
1195090170 X:101450907-101450929 CAGCTCAGACACAGTAGGATAGG - Intronic
1195783091 X:108485650-108485672 TAGCTCAGACACAGTAGGATAGG - Intronic
1196243074 X:113366224-113366246 CAGCTCAGCCACAGTAGGATAGG - Intergenic
1196247396 X:113415758-113415780 CAGCTTGGCCACAGAGGGGTAGG + Intergenic
1196385035 X:115140162-115140184 CAGCTCAGCCACAGTAGGATGGG + Intronic
1196552467 X:117045483-117045505 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1197178031 X:123505247-123505269 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1197399647 X:125974540-125974562 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1197508917 X:127346571-127346593 CAGTTCAGACACAGCAGGGTAGG - Intergenic
1197558820 X:127992244-127992266 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1197670636 X:129273334-129273356 CAGCTCAGCCACAGTAGAGTAGG - Intergenic
1198611935 X:138411434-138411456 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1199303896 X:146244836-146244858 CAGCTCAGCCATAGTAGGGTAGG + Intergenic
1199393248 X:147306196-147306218 CAGCTCAGCCACAGTAGGATAGG + Intergenic
1200637883 Y:5679300-5679322 CAGCTCAGCCACAGTAGGATAGG + Intronic