ID: 1136390730

View in Genome Browser
Species Human (GRCh38)
Location 16:29962473-29962495
Sequence ACTTTAACACAGGAGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136390730_1136390740 26 Left 1136390730 16:29962473-29962495 CCCTACCCCTCCTGTGTTAAAGT 0: 1
1: 0
2: 1
3: 14
4: 332
Right 1136390740 16:29962522-29962544 ATTTTTTGCCTCGCCTTACCCGG 0: 1
1: 0
2: 0
3: 1
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136390730 Original CRISPR ACTTTAACACAGGAGGGGTA GGG (reversed) Intronic
901213311 1:7538858-7538880 ACTTTGACACTGGAGGAGCATGG + Intronic
902353484 1:15877825-15877847 ACTTGAACCCAGGAGGTGGAGGG - Intronic
903270724 1:22186618-22186640 ACTTGAACCCGGGAGGGGGAGGG - Intergenic
904201594 1:28823277-28823299 ACTTGAACCCAGGAGGTGGAAGG - Intronic
904820850 1:33243237-33243259 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
906464047 1:46060015-46060037 ACTTGAACCCAGGAGGCGGAGGG + Intronic
906844145 1:49172551-49172573 ACTTTAACAAAGGAGAGGCTGGG + Intronic
908626461 1:66049412-66049434 GCTTTAAAACAGGAGTAGTATGG + Intronic
908806968 1:67941665-67941687 ACATTAACAGAGCAGGGGTACGG - Intergenic
908950412 1:69555148-69555170 TCTTTAACTCAAGTGGGGTAAGG + Intergenic
910299594 1:85690941-85690963 ACTTGAACCCAGGAGGTGGAGGG + Intronic
911777149 1:101828941-101828963 AATTTAATAGTGGAGGGGTAGGG + Intronic
911851426 1:102826415-102826437 ACCTGAACAAAGGAGGGGAAGGG - Intergenic
912165275 1:107036067-107036089 ACAGGAACTCAGGAGGGGTAAGG + Intergenic
912443508 1:109716148-109716170 ACTTCAACACAGGTGAGGGATGG - Intronic
914711662 1:150220362-150220384 ACTTTTACACAGGTGTAGTATGG - Exonic
915150443 1:153826546-153826568 ACTTGAACCCAGGAGGTGGAGGG + Intronic
916181616 1:162088855-162088877 ACGTTACCACAGGAAGGGGAAGG - Intronic
916618307 1:166468015-166468037 TCTGGAACACAGGAGAGGTAAGG + Intergenic
917311498 1:173683903-173683925 ACTTGAACAAGGGAGGGGAAGGG + Intergenic
917818114 1:178731363-178731385 ACTTGAACCCAGGAGGTGGAGGG - Intronic
918031724 1:180819935-180819957 ACTTGGACCCAGGAGGGGGAGGG + Intronic
918636920 1:186787652-186787674 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
922126660 1:222733161-222733183 ACTTTAATTCAGGAGGTGGAGGG - Exonic
1062828620 10:589813-589835 ACCTTAACACACAAGGGGGAAGG + Intronic
1063288957 10:4721373-4721395 ACAGTAACTAAGGAGGGGTAAGG + Intergenic
1064037235 10:11924493-11924515 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1065641215 10:27784036-27784058 TCTTGAACAGAGGAGTGGTAAGG + Intergenic
1066588307 10:36963170-36963192 ACTTGAACCCAGGAGGCGGAAGG - Intergenic
1067414626 10:46094131-46094153 GCTGGAACACAGGAGGGGTGGGG + Intergenic
1067439045 10:46297980-46298002 GCTGGAACACAGGAGGGGTGGGG - Exonic
1068096246 10:52495019-52495041 ACTATAACACAGTAGAGGCAAGG - Intergenic
1068583313 10:58767121-58767143 AATTGGCCACAGGAGGGGTAGGG - Intronic
1070108680 10:73461362-73461384 ACTTTAACCCAGGAGGCGGAGGG + Intronic
1071752950 10:88502282-88502304 CCTTTAGCAGAGGTGGGGTAGGG + Intronic
1072284430 10:93899428-93899450 ATTTTAACCCAGGGAGGGTAGGG - Intronic
1072574638 10:96688713-96688735 ACTTAAACCCAGGAGGCGGAGGG + Intronic
1072598696 10:96901850-96901872 ACTTGAACCCAGGAGGTGTAAGG - Intronic
1072701776 10:97647199-97647221 CTTTTAACAAAGGAGGGGTGAGG - Intronic
1072948203 10:99829707-99829729 ACTTGAACACAGGAGGTTGAAGG - Intronic
1075235813 10:120727813-120727835 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1075888589 10:125924724-125924746 ACTTGAGCACAGGAGGTGGAGGG + Intronic
1076438931 10:130466119-130466141 ACTTGAACCCAGGAGGTGTGAGG - Intergenic
1077494479 11:2880254-2880276 CCTTTAAAACAGGAGGGGCTAGG - Intergenic
1077549175 11:3192377-3192399 GCTCTAACAGAGGAGGGGAACGG + Intergenic
1078471034 11:11586903-11586925 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1082074927 11:47968814-47968836 ACTTGAACCCAGGAGGTGGAAGG + Intergenic
1082133602 11:48520994-48521016 ACTTTCTAACAGGAAGGGTAAGG + Intergenic
1082139092 11:48585779-48585801 ACTTTCTAACAGGAAGGGTAAGG + Intergenic
1082566624 11:54687386-54687408 ACTTTCTAACAGGAAGGGTAAGG + Intergenic
1082621307 11:55425647-55425669 ACTTTCTAACAGGAGGGATAAGG + Intergenic
1082624877 11:55471463-55471485 ACTTTCTAACAGGAAGGGTAAGG + Intergenic
1082931074 11:58606142-58606164 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1083101632 11:60313184-60313206 ACTTGAACCCAGGAGGTGTAGGG - Intergenic
1083561610 11:63677446-63677468 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1083748314 11:64746979-64747001 ACTTTAAACCTGGAGGGGAAAGG + Exonic
1085133831 11:74066254-74066276 ACTTGGACACAGGAGGGGGGAGG + Intronic
1085218457 11:74852278-74852300 AATTTCAGACAGGAGGGGCAAGG - Intronic
1085966169 11:81529617-81529639 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1087150885 11:94858588-94858610 ACTGGAAAACAGGAGGGGAATGG + Intronic
1088496779 11:110439288-110439310 GCTTTAACCCAGGAGGTGAAGGG - Intronic
1089663157 11:119998864-119998886 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG + Intergenic
1090112449 11:123928431-123928453 ACTTGAACCCAGGAGGTGGATGG - Intergenic
1090483261 11:127086577-127086599 ATCTTCACACAGGAAGGGTAGGG - Intergenic
1090618526 11:128540228-128540250 ACTTCAACCCAGGAGGCGGACGG + Intronic
1090742478 11:129677615-129677637 AATTCAACACAGGCTGGGTATGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1095449996 12:42320529-42320551 ACTTGAACCCAGGAGGCGGATGG - Intronic
1096201550 12:49687174-49687196 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1096316497 12:50571633-50571655 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1096631630 12:52930641-52930663 ACTTGAACCCAGGAGGTCTAGGG - Intronic
1096684580 12:53279564-53279586 GCTTTAAAACAGTAGGGGTGGGG + Intronic
1097519700 12:60651944-60651966 ACCTGAACACAGGAGAGGAAGGG + Intergenic
1103778874 12:123386296-123386318 ACTTGAACACAGGAGAGGGAGGG - Intronic
1104305818 12:127610293-127610315 ACTTGAACCCAGGAGGTGTAAGG - Intergenic
1105328189 13:19389390-19389412 ACTTGAACCCAGGAGGTGGAAGG - Intergenic
1107464292 13:40635394-40635416 ACTTTAACCCACGAAGGTTAAGG + Intronic
1107702565 13:43062799-43062821 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1109950110 13:69490224-69490246 ACAGGAACTCAGGAGGGGTAAGG - Intergenic
1114395431 14:22354807-22354829 ACTTGGACACAGGAAGGGGAAGG + Intergenic
1115942475 14:38624669-38624691 ACTTTAACCAAGGAGGTGAAAGG + Intergenic
1117061467 14:51967842-51967864 ACTTGAACAAAGGAGGGCCATGG - Exonic
1117895436 14:60480337-60480359 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1118655991 14:67949407-67949429 ACTTGAACAGATGAGGGATAAGG - Intronic
1118814640 14:69301434-69301456 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1118881761 14:69833538-69833560 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1120746827 14:88159774-88159796 AAGTTAACTTAGGAGGGGTAAGG - Intergenic
1122897947 14:104769626-104769648 ACTGTGACACAGAAGGGGAAGGG + Exonic
1123907128 15:24932315-24932337 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1124856825 15:33397215-33397237 ACTTTGAAGGAGGAGGGGTAGGG + Intronic
1126616498 15:50586931-50586953 ACTTGAACCCGGGAGGCGTAGGG + Intronic
1127055648 15:55128473-55128495 CCTCTAACACAGCAGGGCTATGG + Intergenic
1127288187 15:57548631-57548653 TCTTTTACACAGGTTGGGTAGGG + Exonic
1127796049 15:62439393-62439415 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1128050193 15:64657174-64657196 ACTTGAACCCAGGAGGTGAAGGG + Intronic
1128493861 15:68179656-68179678 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1128623820 15:69178423-69178445 ACTGAAACACAGGAAGGTTAGGG - Intronic
1131042237 15:89280372-89280394 ACTTTAACAATGGAAAGGTAGGG - Intronic
1131232311 15:90668160-90668182 ACTTAAACCCAGGAGGCGGATGG + Intergenic
1132924025 16:2418032-2418054 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1133958103 16:10464911-10464933 ACCTAAACCCAGGAGGGGAAAGG - Intronic
1136390730 16:29962473-29962495 ACTTTAACACAGGAGGGGTAGGG - Intronic
1136528868 16:30853016-30853038 GCTTGAACACAGGAGGCGGAGGG - Intronic
1137418470 16:48308542-48308564 ACTTGAACCCAGGAGGCGGATGG + Intronic
1137459401 16:48646352-48646374 ACTTGAACCCAGGAGGGAGAGGG - Intergenic
1137600655 16:49753946-49753968 ACTTGAACACGGGAGGAGAAGGG + Intronic
1138163669 16:54779411-54779433 ATTTTAACACAGCAGGGCCAGGG + Intergenic
1138365141 16:56469524-56469546 GCTTTACCACAGGAGGAGTAGGG + Intronic
1138666330 16:58572198-58572220 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1139862417 16:70034954-70034976 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1140219840 16:73035819-73035841 ACTTGAACCCAGGAGGAGGAAGG + Intronic
1141087214 16:81104582-81104604 ACTTAAACCCGGGAGGGGGAGGG + Intergenic
1144121606 17:12159824-12159846 ACTTAAACTCAGGAGGCGGAAGG - Intergenic
1144545210 17:16188526-16188548 ACGTGAACCCAGGAGGGGGAGGG + Intronic
1144561170 17:16321321-16321343 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1146091876 17:29887437-29887459 AGTTTAAGACAAGAAGGGTAAGG + Intronic
1146123625 17:30215714-30215736 CCTGGAACACAGCAGGGGTAAGG + Exonic
1146357674 17:32147735-32147757 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1146411406 17:32588858-32588880 ACTTGAACTCAGGAGGTGGAGGG + Intronic
1146767401 17:35535736-35535758 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1147368551 17:39975364-39975386 GCTTGAACCCAGGAGGGGGAGGG + Intronic
1147962977 17:44178932-44178954 ACTTAAACACAGGAGGAGAAGGG - Exonic
1149745459 17:59093291-59093313 ACTTTAACAGAAGAGTGGCATGG - Intronic
1150495191 17:65602658-65602680 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1152707929 17:81854757-81854779 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1153612126 18:6896993-6897015 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1154474646 18:14744557-14744579 ACTTGAACACAGGAGGTGGAGGG + Intronic
1154934186 18:21034086-21034108 AATTTAACCAAGGAGGTGTAAGG + Intronic
1157084222 18:44562029-44562051 ACCATAATACAGGAGGGGGAAGG - Intergenic
1158529448 18:58245761-58245783 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1161063025 19:2224547-2224569 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1162139255 19:8576077-8576099 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1162256635 19:9495622-9495644 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1163002576 19:14377234-14377256 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1163490934 19:17616840-17616862 GCTTGAACTCAGGAGGGGGAGGG - Intronic
1163734101 19:18968227-18968249 ACTTGAACTCAGGAGGTGGAGGG - Intergenic
1163753674 19:19093758-19093780 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1164961504 19:32434947-32434969 AGTCTAACACAGGAGTGTTATGG - Intronic
1165740866 19:38204312-38204334 ACTCAAACACAGGAGGTGTGGGG - Intronic
1165954439 19:39493330-39493352 ACTTGAACCCAGGAGGTGCAGGG - Intronic
1166945740 19:46395105-46395127 GCTTGAACCCAGGAGGGGGAGGG - Intergenic
1168038965 19:53742838-53742860 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1168545131 19:57243953-57243975 ACTTTCACCCAGGAGGAGTGGGG + Exonic
924969468 2:112165-112187 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
925972793 2:9118786-9118808 AAGTTAACACAGGATGGTTAGGG - Intergenic
928278791 2:29925778-29925800 ACTTTTAAACAGGAGAGATAAGG - Intergenic
928565455 2:32542880-32542902 ACTTGAACCCAGGAGGTGGAAGG - Intronic
929153956 2:38772992-38773014 ACTTGAACCCAGGAGGGGTAGGG - Intronic
929482291 2:42321411-42321433 ACTTGAACACATCAGGGATATGG + Intronic
931852243 2:66263403-66263425 ACGTGAACACATGAGGAGTAAGG - Intergenic
932243847 2:70179853-70179875 ACTTTAGCCCAGGAGGGTCAAGG + Intronic
932247364 2:70206898-70206920 ACTTTAACTCAGGAGGCTGAGGG - Intronic
933380464 2:81536834-81536856 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
933863013 2:86488838-86488860 ACTGTAAAAGAGGAGGGGTGAGG - Intronic
934699740 2:96430062-96430084 GCTTCAACTCAGAAGGGGTAGGG - Intergenic
934927975 2:98395250-98395272 ACTTGAACCCAGGAGGTGGAGGG - Intronic
935694185 2:105756886-105756908 ACTTGAACCCAGGAGGGGGGAGG - Intronic
936594391 2:113833958-113833980 ACTTGAACCCAGGAGGCGGAGGG + Intergenic
939034400 2:137113517-137113539 ACTTGAACCCAGGAGGCGGAGGG - Intronic
940656203 2:156490135-156490157 ACTTTAAGACAAGAGGGCTTTGG - Intronic
940704086 2:157082007-157082029 ACTTGAACCCAGGAGGTGGAAGG + Intergenic
941574256 2:167211178-167211200 ACTTGAACCCAGGAGGTGGAGGG - Intronic
942164923 2:173232584-173232606 ACTTGAACCCAGGAGGCGGAGGG - Intronic
942239432 2:173946042-173946064 ACTTGAACCCAGGAGGTGGAGGG + Intronic
942280331 2:174356383-174356405 ACTTGAACACAGGAGGTTGAGGG + Intronic
944121198 2:196242773-196242795 ACTTGAACCCAGGAGGCGGAGGG - Intronic
944402681 2:199346230-199346252 ACTTGAACCCAGGAGGTGGAGGG - Intronic
944492880 2:200276141-200276163 ACATTAACTAAGGAGGAGTAAGG + Intergenic
945965849 2:216185756-216185778 ACTTGAACCCAGGAGGTGGAGGG - Intronic
945981709 2:216317495-216317517 ACTTGAACCCAGGAGGTGGAAGG - Intronic
946116861 2:217470567-217470589 ACTTTAACCCAGGAGGTGAAGGG - Intronic
947429471 2:230013497-230013519 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
947709340 2:232302641-232302663 ACTTGAACCCAGGAGGCGGAGGG - Intronic
948217471 2:236242535-236242557 ACTTGAACCCAGGAGGTGGAGGG - Intronic
948820389 2:240540554-240540576 ACAGGAACTCAGGAGGGGTAAGG - Intronic
1169212298 20:3773475-3773497 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1169531294 20:6487928-6487950 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1170879154 20:20279231-20279253 CCTTGAACACATGAGGAGTAAGG + Intronic
1172148129 20:32771549-32771571 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1173480268 20:43393099-43393121 ACTCTAACACATGAGAGGTTTGG - Intergenic
1173501188 20:43554995-43555017 ACTTGAACCCGGGAGGGGGAGGG + Intronic
1175152576 20:56946644-56946666 ACTTTCACAGGGGAGGGGTGGGG + Intergenic
1175830288 20:61961328-61961350 AATATAACACATGAGGGGAAGGG - Intronic
1178415811 21:32404149-32404171 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1178473220 21:32913642-32913664 ACTATAAAACAGGCTGGGTATGG - Intergenic
1178557455 21:33605602-33605624 GCTTGAACCCAGGAGGGGGAGGG - Intronic
1178618971 21:34158049-34158071 ACTTGAACTCAGGAGGTGGAAGG - Intergenic
1178836696 21:36104606-36104628 ACTTGGACAAAGGAGGGGAAGGG - Intergenic
1178856075 21:36251500-36251522 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1179714245 21:43279678-43279700 CATCTAACACAGGAGGGGTAGGG + Intergenic
1183167484 22:36158733-36158755 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1183337576 22:37259330-37259352 ACTTCAAAAGAGGAGGGGTTGGG - Intergenic
1184029972 22:41886949-41886971 ACTTGAACCCAGGAGGTGGAGGG + Intronic
949620058 3:5800656-5800678 GCTTTAAAACAGGATGAGTATGG + Intergenic
950286020 3:11745246-11745268 ACTTGAGCACAGGAGGCCTAGGG + Intergenic
950610912 3:14125960-14125982 ACTTTCACAGAGGAGGGGAGAGG - Intronic
951520550 3:23606926-23606948 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
953476162 3:43207625-43207647 GCTTTAACACAGAAGGGCTGAGG + Intergenic
954703882 3:52468174-52468196 ACTTGAACCCAGGAGGTGGAGGG + Intronic
954945440 3:54420165-54420187 ACTTGAACTCAGGAGGCGGAGGG - Intronic
955604650 3:60688512-60688534 ACTTGAACCCAGGAGGTGAAGGG - Intronic
956100715 3:65765267-65765289 CCTTTACCAAAGGAGGGGAAAGG + Intronic
956966456 3:74467158-74467180 ACTTTAACACAGAAAGATTATGG + Intronic
958156463 3:89761768-89761790 ATTTTTATACAGGAAGGGTAGGG + Intergenic
958421248 3:93933924-93933946 ACTTGAACCCAGGAGGCGGAGGG + Intronic
958920634 3:100101582-100101604 AGTCCAACACAGGAGGGGTTGGG + Intronic
958952900 3:100435649-100435671 ACTTCAAAGGAGGAGGGGTAGGG + Intronic
959032608 3:101318051-101318073 ACTTGAACCCAGGAGGTGGAGGG + Intronic
959140572 3:102481763-102481785 ACTTTAATGCAGGCTGGGTATGG + Intergenic
959951047 3:112180816-112180838 GCTTGAACCCAGGAGGGGGAGGG - Intronic
960598978 3:119436252-119436274 ACTTAAACACAGGAGAAGCAGGG + Intronic
961231458 3:125315624-125315646 ATTTGAACCCAGGAGGGGAAGGG + Intronic
961744280 3:129053873-129053895 ACTTTGAAAGAGGAGGGGTTGGG + Intergenic
962582936 3:136814619-136814641 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
963348009 3:144119070-144119092 ACTTTACCCCAGGAGGCGAAGGG + Intergenic
964357841 3:155866607-155866629 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
965268179 3:166575836-166575858 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
965966259 3:174494143-174494165 ACTTTAAGGCAGGAGGTTTAAGG + Intronic
967120400 3:186377727-186377749 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
967410617 3:189163188-189163210 ACTTGAACCCAGGAGGTGGAGGG + Intronic
968771316 4:2509298-2509320 ACTTGAACCCAGGAGGTGGAGGG - Intronic
969089820 4:4685377-4685399 ACTTTAACCCTGGTGGGGTCAGG + Intergenic
970480769 4:16471436-16471458 ACTTTAACACACGAATTGTAGGG + Intergenic
970508215 4:16754612-16754634 ACTTGAACCCAGGAGGCGGATGG - Intronic
972203741 4:36747360-36747382 ACCTTAACTCAGAAGGGGCAGGG - Intergenic
972442580 4:39109732-39109754 ACTTGAACCCAGGAGGTGGAGGG - Intronic
975573098 4:75837758-75837780 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
976073251 4:81266540-81266562 AATTTAACAAAGGAGGTGAAAGG - Intergenic
976164032 4:82234491-82234513 ACTTTCACACAGAGGGGGCAAGG + Intergenic
976779236 4:88739702-88739724 GCTTGAACACAGGAGGCGGAGGG + Intronic
977511079 4:97963570-97963592 ACTTGAACCCAGGAGGGCAAGGG + Intronic
977561954 4:98541590-98541612 GCTTGAACCCAGGAGGGGGAGGG + Intronic
978314450 4:107419898-107419920 ACTTGAACAAGGGAGGGGAAGGG - Intergenic
978486994 4:109266001-109266023 ACTTTAACACAGGAAATGTTTGG - Intronic
978515550 4:109564764-109564786 ACTTTAACTCAGGTGGGGATGGG + Intronic
978532831 4:109731261-109731283 ACTTGAACCCAGGAGGTGGATGG + Intergenic
979981112 4:127256486-127256508 AATTTTACAAAGGAGTGGTAGGG - Intergenic
981710376 4:147703531-147703553 ACTTGAACCCAGGAGGGTTCAGG + Intergenic
982695456 4:158593968-158593990 ACAAAAACACTGGAGGGGTATGG + Intronic
985175844 4:187199957-187199979 ACAGAAACGCAGGAGGGGTAAGG - Intergenic
986291700 5:6405187-6405209 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
988270937 5:29015996-29016018 ACTTTAACATAGAATGGATATGG - Intergenic
988651680 5:33158755-33158777 AATTTACCACAGAAGTGGTAGGG - Intergenic
988846355 5:35131791-35131813 ACTTTCTCACTGGAGGGGTCAGG - Intronic
989196178 5:38718785-38718807 ACTTTCTCCCAGGAGGGGCAGGG - Intergenic
989405896 5:41060283-41060305 ACATTAACAATAGAGGGGTATGG - Intronic
990865269 5:60373148-60373170 ACCTCAACACAGGACGGGTATGG - Intronic
993238592 5:85348480-85348502 AATTTAACGCAGCAGTGGTAAGG - Intergenic
994255832 5:97595108-97595130 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
995642096 5:114268529-114268551 ACTTTTCCATAGGAGGGGTCAGG + Intergenic
995849673 5:116532022-116532044 ACTTGAACAAGGGAGGGGAAGGG - Intronic
996571234 5:124934378-124934400 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
996669093 5:126095833-126095855 ACTTGAACTCAGGAGGTGAAAGG + Intergenic
998209712 5:140185721-140185743 ACTTTAACACAGGAGCCCCAGGG - Intronic
998703928 5:144737569-144737591 ATTTCTGCACAGGAGGGGTAGGG + Intergenic
998853617 5:146374117-146374139 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
999273168 5:150309942-150309964 ACTTCAACAAAGGAAGGGAAAGG - Intronic
1000805419 5:165784266-165784288 ACTTGAACACGGGAGGCGGAGGG + Intergenic
1002943538 6:1739328-1739350 AATTAAACACAGTAGGGGTGCGG + Intronic
1004655668 6:17657479-17657501 ACTTGAACTCAGGAGGTGGAGGG + Intronic
1005432368 6:25771489-25771511 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1005829705 6:29660789-29660811 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1007866462 6:44975086-44975108 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1007987425 6:46220815-46220837 ACTTTAACAATGAAGGGGAAGGG - Exonic
1008580085 6:52898802-52898824 ACTTGGACAAAGGAGGGGAAGGG + Intronic
1012934044 6:105347015-105347037 ACTTGAACCCAGGAGGCGGAAGG + Intronic
1013255416 6:108380043-108380065 ATCTTTACACAGGAGGGGTGGGG + Intronic
1014607707 6:123498522-123498544 ATTTTCCCACAGGAGAGGTAGGG + Intronic
1014697954 6:124647414-124647436 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1015690480 6:135916473-135916495 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1017275765 6:152566152-152566174 GGTTCAACACTGGAGGGGTAAGG - Intronic
1017840283 6:158216615-158216637 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
1018308262 6:162480886-162480908 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1018439940 6:163802228-163802250 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1021653025 7:22850118-22850140 ACTTGAACCCAGGAGGTGGATGG - Intergenic
1023071762 7:36441808-36441830 ACGTTAACACAGGAGGGAGCTGG + Intronic
1025927450 7:65971139-65971161 TCTTGAACACAGGAGGTGGATGG + Intronic
1025938085 7:66053073-66053095 ACAGGAACTCAGGAGGGGTAAGG - Intergenic
1025993731 7:66514821-66514843 ACTTAAGCCCAGGAGGGGTTTGG + Intergenic
1026034691 7:66822614-66822636 ACTTAAGCCCAGGAGGGGTTTGG - Intergenic
1026682193 7:72475370-72475392 ACTTGAACCCAGGAGGTGGACGG + Intergenic
1026984941 7:74548819-74548841 ACTTAAGCCCAGGAGGGGTTTGG + Intronic
1027207965 7:76118568-76118590 ACATTTACACAAGAGAGGTAAGG + Intergenic
1028195586 7:87903775-87903797 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1029228807 7:99049006-99049028 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1029288876 7:99486233-99486255 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1029569798 7:101362123-101362145 ACTTGAACTCAGGAGGCGGAGGG - Intergenic
1030018675 7:105250250-105250272 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1030019267 7:105256895-105256917 ACTTTAAAAGATGAGTGGTATGG - Intronic
1031204333 7:118735973-118735995 ACTTTAACCAAGGAGGTGAAAGG + Intergenic
1032494767 7:132352594-132352616 ACCTGAATACAGGAGGGATATGG + Intronic
1034085696 7:148320464-148320486 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1035613612 8:986217-986239 TGTTTAGCACAGCAGGGGTAGGG + Intergenic
1039669214 8:39577769-39577791 ACTTCAAACCAGGAGTGGTAAGG + Intergenic
1041412325 8:57570260-57570282 ACTTGGACACAGGAGGGGGGAGG + Intergenic
1041492439 8:58449312-58449334 TCTTTAACACAGGAGTGGAGCGG - Exonic
1041661797 8:60408009-60408031 ACTTGAACCCAGGAGGAGGAGGG + Intergenic
1042370912 8:67990066-67990088 GCTTTAACCCAGGAGGGAGAGGG - Intronic
1042611247 8:70603632-70603654 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1045489887 8:102660060-102660082 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
1046427692 8:114077007-114077029 ATTTTAAGACAGTAGGGGTTAGG - Intergenic
1047004776 8:120609287-120609309 ACATTAACACAGGAGGGAAGGGG - Intronic
1047052715 8:121130776-121130798 ACTTAAACAAAGGAGGTGTCTGG - Intergenic
1047672683 8:127165584-127165606 ACTTGAACCCAGGAGGAGGAGGG - Intergenic
1048009041 8:130442243-130442265 AATCTAACACAGAAGGGGCATGG + Intronic
1049492808 8:142914109-142914131 CCCTTAACAAAGGAGGGGGAAGG + Intronic
1049863711 8:144919450-144919472 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1050718809 9:8561486-8561508 ACTATAACACAGGTGGGCTAGGG + Intronic
1052304625 9:26992608-26992630 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1054703641 9:68439280-68439302 TCTTGAACACAGGAGGGACAAGG + Intronic
1055049892 9:71968761-71968783 ACCTGAACAAAGGAGGGGAAGGG + Intronic
1055092891 9:72380562-72380584 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1055833137 9:80406508-80406530 ACTTTAACACAGCTGGAATAAGG + Intergenic
1056178997 9:84063294-84063316 TCTTAAACAGAGGAGGGATAGGG + Intergenic
1057107205 9:92430876-92430898 ACTTGAACTCAGGAGGCGGAGGG - Intronic
1057869122 9:98705534-98705556 ACTTTAACACAGGGTGGATGTGG - Intronic
1058066738 9:100556927-100556949 ACTTGAACCCAGGAGGTGGAAGG - Intronic
1059305109 9:113347953-113347975 GCTTTAGCACCTGAGGGGTAAGG - Intergenic
1059830724 9:118092843-118092865 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
1060365923 9:123013412-123013434 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1060804110 9:126564105-126564127 ACTTTTACCCTGGATGGGTAGGG + Intergenic
1061118782 9:128630437-128630459 ACTTTAAGCCAGGAAGGGAAGGG - Intronic
1061729588 9:132603484-132603506 GCTGTAATACAGGAGGGGTTTGG + Intronic
1185467816 X:365293-365315 GCTTCAACACAGGAGGCGGAGGG + Intronic
1185467932 X:366283-366305 GCTTCAACACAGGAGGCGGAGGG + Intronic
1185467953 X:366448-366470 GCTTCAACACAGGAGGCGGAGGG + Intronic
1185504524 X:621390-621412 ACTTTAAAAGGGGAGGGGGAAGG + Intergenic
1186338807 X:8621281-8621303 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1187883488 X:23867015-23867037 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1188054169 X:25522462-25522484 GCTTTAACCCAGGAGGCGGAAGG - Intergenic
1189034087 X:37478665-37478687 ACTTGGACAAAGGAGGGGAAGGG - Intronic
1189345642 X:40239302-40239324 ACAGGAACTCAGGAGGGGTAAGG - Intergenic
1190076102 X:47318251-47318273 ACTTGAACCCAGGAGGAGGAGGG + Intergenic
1192886475 X:75340061-75340083 AATTTAACAAAGGAGGTGCAAGG - Intergenic
1193131241 X:77921821-77921843 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1195024722 X:100864907-100864929 ACTTTCTAAAAGGAGGGGTATGG + Intronic
1195486695 X:105416706-105416728 TCTTTAATACAGGAAGGCTACGG - Intronic
1195957022 X:110342452-110342474 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1196841637 X:119864745-119864767 ACTTGAACCCAGGAGGCGGAGGG + Intergenic
1197615061 X:128681668-128681690 ACATTTACAAAGGAGTGGTAGGG - Intergenic
1198230272 X:134682636-134682658 ACTTGAACTCAGGAGGCGGAGGG - Intronic
1199279009 X:145977588-145977610 ACTTGGACAAAGGAGGGGAAGGG - Intergenic
1200256967 X:154587759-154587781 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1200260802 X:154616643-154616665 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1200789970 Y:7291087-7291109 ACTTGAACCCAGGAGGTGGATGG - Intergenic
1200949186 Y:8877402-8877424 GCTTTAAAAGAGGATGGGTAAGG - Intergenic
1201728771 Y:17184064-17184086 ACAGGAACTCAGGAGGGGTAAGG - Intergenic