ID: 1136392204

View in Genome Browser
Species Human (GRCh38)
Location 16:29972866-29972888
Sequence ATGTGTGCAGAAATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136392204 Original CRISPR ATGTGTGCAGAAATTGAGGA AGG (reversed) Intronic
901111618 1:6801365-6801387 ATGTCTGGAGGAACTGAGGATGG + Intronic
901348735 1:8572341-8572363 CTGTGTGCTAAAATGGAGGAAGG - Intronic
902263695 1:15246626-15246648 ATGTTTGCAGAGATAGAGAAAGG + Intergenic
902345208 1:15811588-15811610 CCGTGTGCAGAATTTGAGCATGG + Intergenic
903249642 1:22043451-22043473 ATGTGGGCATAAGTGGAGGAGGG + Intergenic
905299135 1:36974127-36974149 AGGTGTGGAGAAACTGAGGCAGG - Intronic
906278965 1:44540180-44540202 ATGTGGGCAGTGGTTGAGGAAGG - Intronic
907118248 1:51988632-51988654 ATGGATGAAGAAATTGAGGCAGG + Intronic
907457284 1:54583823-54583845 ATGTGTGAGAAAAATGAGGAGGG - Intronic
908009110 1:59757584-59757606 CTGTGTCCAGATAGTGAGGAGGG + Intronic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910361527 1:86417230-86417252 ATAGTTGCAGAAATTTAGGAGGG + Intergenic
912264086 1:108137957-108137979 ATGTGTGAAGACACTGAGGCAGG - Intronic
915614036 1:157021293-157021315 ATGTGTCAAGTATTTGAGGATGG + Intronic
915729517 1:158043360-158043382 ATCTGAGCAGGAATGGAGGAGGG - Intronic
917226656 1:172790787-172790809 ATGTGGGGATAAATGGAGGAGGG + Intergenic
917344445 1:174014458-174014480 ATGTGGGAAGAAAATGAGAATGG + Intronic
917598511 1:176553100-176553122 ATGTGTGATGGAATTGAGGAGGG + Intronic
917701501 1:177586155-177586177 ATTTGTTCTGAAATTGGGGAAGG + Intergenic
918417724 1:184329382-184329404 ATGGGAGCAGTGATTGAGGAAGG - Intergenic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
920234154 1:204491905-204491927 ATATTTGTAGGAATTGAGGAGGG - Intronic
923317425 1:232794749-232794771 ATCTGTGGAGAAGTAGAGGAGGG + Intergenic
924058741 1:240149380-240149402 ATGTGTGCATAAAATGAACAAGG + Intronic
924626953 1:245703522-245703544 ATGTGTGGAGGACTTGAGGGGGG - Intronic
924651271 1:245929597-245929619 TTGGGTGAAGAAGTTGAGGACGG - Intronic
1062890948 10:1059433-1059455 AAGTGTGTATAATTTGAGGAAGG - Intronic
1063266973 10:4462917-4462939 ATGTGTCCAGTCATTGACGACGG - Intergenic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1066000476 10:31100228-31100250 AATTTTGCAGAAATTGAGGAGGG + Intergenic
1067927025 10:50519930-50519952 ATAAGGGCAGAAAATGAGGAAGG + Intronic
1068155406 10:53191095-53191117 ACGTGTCTAGAAATTGATGAGGG - Intergenic
1069629925 10:69891431-69891453 ATGTCTGCAGAACCGGAGGAAGG + Intronic
1070284822 10:75075333-75075355 ATGTGTGAAGGATTAGAGGAGGG - Intergenic
1070826528 10:79393552-79393574 TTGTGTGCAGAGATTGAGTGTGG - Intronic
1071481875 10:86070683-86070705 ATGTGTGCAGGGATGGATGAGGG - Intronic
1072189557 10:93068840-93068862 ATGTGTGCCGGACTCGAGGAAGG + Intergenic
1073275847 10:102310677-102310699 ATTTGAGCAGGGATTGAGGAAGG + Intronic
1073363263 10:102917527-102917549 AGGTGTGCAGAAGTTACGGATGG - Intergenic
1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG + Intronic
1075620310 10:123922706-123922728 AAGTGGGCAGAAATTTGGGATGG + Intronic
1076429505 10:130391692-130391714 AAGCGTCCAGAAATGGAGGAGGG + Intergenic
1078858508 11:15226148-15226170 ATCTGAACAGAGATTGAGGAAGG - Intronic
1078877988 11:15417244-15417266 ATGAGTGCTGAAATGGAGTAAGG - Intergenic
1078916209 11:15781248-15781270 ATTGGTGCAGAAAATGAGGAAGG - Intergenic
1079525341 11:21380388-21380410 ATGTTTCCAGAAATTAAGAATGG + Intronic
1081193725 11:40135974-40135996 ATGTGAGCAGAACTAGAAGAGGG + Intronic
1083087988 11:60169770-60169792 AACTGTGCAGAAATTGGGAAAGG + Intergenic
1084057581 11:66646280-66646302 TTGTGTGCAGAAACTGTGGTGGG + Exonic
1084615509 11:70233125-70233147 ATATGTGCAGAAATGGAGTGTGG + Intergenic
1086017568 11:82184829-82184851 ATGTGTGCGGGAATTTAAGAAGG + Intergenic
1087044078 11:93829928-93829950 AAGTTTGCAGAAGGTGAGGAAGG + Intronic
1087173160 11:95070930-95070952 ATGGGTGTAGAAATTGAGAAAGG + Exonic
1087399512 11:97647276-97647298 ATGAGTGCAAAGCTTGAGGATGG + Intergenic
1088030883 11:105248998-105249020 ACGTGTGAAGAACTTGAGGTGGG - Intergenic
1088595862 11:111439650-111439672 AAGTGTGCAGAAACTGAGAGGGG - Intronic
1090118686 11:124001610-124001632 ATTTGAATAGAAATTGAGGAAGG + Intergenic
1090147686 11:124343103-124343125 ATTGGAGCAGAAATTGAGTAAGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091556643 12:1578755-1578777 ATCTGTGCAGTGATTCAGGAGGG + Intronic
1093692042 12:22119867-22119889 AGGTTTGCAGAAAGTGTGGAAGG - Intronic
1094156736 12:27345315-27345337 GTTTCTGCAGTAATTGAGGATGG + Intronic
1094362849 12:29649017-29649039 ATGTGGGCAGAGGTGGAGGATGG - Intronic
1095318901 12:40801483-40801505 TTGTGAGCATAAATTGAAGAAGG + Intronic
1095492672 12:42751019-42751041 AAATGTACTGAAATTGAGGAAGG + Intergenic
1096727403 12:53575699-53575721 ATGTGTGCAATAAGTGAGGGCGG + Intronic
1097140192 12:56896075-56896097 ATGTGTGCACAAGGTAAGGATGG - Intergenic
1097606593 12:61762232-61762254 ATGTGTTTAGAACTTCAGGAAGG - Intronic
1097631890 12:62073989-62074011 ATGTGTGCTGAATTCGAGGTTGG + Intronic
1100729938 12:97453790-97453812 ATGTTTGAAGAAATGGAGGGAGG - Intergenic
1102850463 12:116239420-116239442 ATATGTACAGAAAAAGAGGAAGG - Intronic
1103151624 12:118644868-118644890 TTATGTGAAGAAATTGAGGCAGG - Intergenic
1104216015 12:126734678-126734700 ATGTGTGCAGAAAAGGATGTAGG - Intergenic
1104227173 12:126846704-126846726 CTTTGTGGAGAAATAGAGGAGGG - Intergenic
1104971745 12:132533940-132533962 GTGTGTGCAGAACCTGAGGCGGG + Intronic
1105483493 13:20802356-20802378 AAGTGTGCAGACAGTGAAGAAGG - Intronic
1106552382 13:30783478-30783500 ATGTGTGCAGAGGATGAGCAGGG - Intergenic
1106895261 13:34293418-34293440 ATGTTTGCAGTATTTGATGATGG + Intergenic
1108827790 13:54436403-54436425 GTTTGTGAAGTAATTGAGGATGG - Intergenic
1109553002 13:63930359-63930381 ATATTTGTAGAAATTAAGGAAGG + Intergenic
1109653639 13:65361632-65361654 AAGTGTTCTAAAATTGAGGATGG + Intergenic
1110246060 13:73325978-73326000 ATGGGTGCAGAAAGTCAGCATGG - Intergenic
1110522562 13:76498102-76498124 ATGTGTGCAGAAATAGAGGAAGG + Intergenic
1111324860 13:86681291-86681313 GTGTGTGCATAAATTGATCATGG - Intergenic
1111623145 13:90749609-90749631 TAGTGTGAAGAAAATGAGGAGGG - Intergenic
1112162824 13:96887263-96887285 ATGTATGCAGAAAATCAGTAAGG - Intergenic
1112489183 13:99846910-99846932 ATACCTGCAGAAATTGATGATGG + Intronic
1113509606 13:110842623-110842645 ATGATTGCAGCAATTGAGGGGGG - Intergenic
1113830624 13:113292746-113292768 TTGAGTGCAGAGCTTGAGGATGG - Intergenic
1115373224 14:32643281-32643303 ATGTATGAAGAAAATGAAGAAGG - Intronic
1115722359 14:36177012-36177034 ATGGGCACAGAAAGTGAGGAAGG - Intergenic
1116204168 14:41840056-41840078 ATGTGTGCAATAACTGTGGAAGG + Intronic
1116372487 14:44153986-44154008 ATATATTCAGAAATTGAGAATGG + Intergenic
1116397864 14:44468564-44468586 ATGTCTGCAGATTTTAAGGAAGG - Intergenic
1118162995 14:63309631-63309653 TTGTGGGCAGTATTTGAGGAAGG + Intergenic
1119222966 14:72924374-72924396 ATCTGTGAAGAAACTGAGGTTGG + Intergenic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1120312128 14:82842444-82842466 TTGTGTGCATATCTTGAGGAAGG + Intergenic
1121105913 14:91279668-91279690 CTCTGTGCAGTAATAGAGGAGGG - Intronic
1122025493 14:98872963-98872985 ATGGGAGCAGAAATTGATGCTGG - Intergenic
1122435328 14:101691404-101691426 AGCTGTGCAGATCTTGAGGAAGG - Intergenic
1123218582 14:106836059-106836081 ATTGTTGCAGAAATTTAGGAGGG + Intergenic
1124985957 15:34613967-34613989 ACAGGTGCAGAAATTGATGAGGG - Intergenic
1125078952 15:35654220-35654242 AAGTGTAGAGAAATAGAGGAGGG + Intergenic
1125186346 15:36935272-36935294 CTGTATGCAGAAGTTGGGGAGGG - Intronic
1125406221 15:39354835-39354857 ATGTGTGTAGAAATGAAGGTGGG - Intergenic
1125715520 15:41817745-41817767 ATGTGGGCAGAGTCTGAGGAGGG - Intronic
1127268755 15:57381993-57382015 AGGTTTGCAGAACTTGAAGAAGG - Intronic
1128394305 15:67208486-67208508 ATCTGGGCAGAAATTGTTGAGGG - Intronic
1128541955 15:68542234-68542256 ATGAGTTCAGAAATTGATTAAGG - Intergenic
1135055126 16:19225743-19225765 ATGTGGCAAGGAATTGAGGAAGG - Intronic
1135466480 16:22690634-22690656 ATGTGGGCAGAGATTAAGTAGGG - Intergenic
1136392204 16:29972866-29972888 ATGTGTGCAGAAATTGAGGAAGG - Intronic
1138727761 16:59159513-59159535 ATGTGTGCAGGAATTTACCATGG - Intergenic
1138856881 16:60704938-60704960 ATGTTTGCAGAAAATGCAGAGGG - Intergenic
1140115655 16:72039199-72039221 ATATGGGCAGAAATGGTGGAGGG + Intergenic
1140266620 16:73426876-73426898 ATGTGGGCAGAACTCGGGGAAGG - Intergenic
1142710171 17:1718695-1718717 AGGCGTGGAGAAATTGAGCAGGG + Intronic
1143491206 17:7286189-7286211 CTGAGTGCAGTAACTGAGGATGG + Intronic
1143941245 17:10544272-10544294 ATGTGTGCTAAAGTTGGGGAGGG - Intronic
1145263119 17:21366381-21366403 TGGTGTTCAGAAGTTGAGGAAGG - Intergenic
1146192898 17:30785966-30785988 GTGTGTGCAGAAAAACAGGATGG - Exonic
1146554033 17:33807659-33807681 ATGTGTGAAGAGGATGAGGAGGG - Intronic
1148644710 17:49212928-49212950 AGGTGTGCAGAAGTTATGGAAGG - Intronic
1149204421 17:54227457-54227479 ACTTGTTCAGAAATGGAGGAAGG + Intergenic
1149624142 17:58067747-58067769 AGGTGGGTAGAAATGGAGGAAGG - Intergenic
1150446963 17:65233570-65233592 ATGTGAGCAGGAATTCACGAGGG - Intergenic
1150549988 17:66201546-66201568 AACTGTGCAAAAATAGAGGATGG + Intergenic
1151344165 17:73491632-73491654 ATCTGAGCAGACGTTGAGGAAGG - Intronic
1153625075 18:7015756-7015778 AAGTGTGAAGAATGTGAGGATGG - Exonic
1153961856 18:10147029-10147051 AGGTGTGTGGGAATTGAGGAGGG - Intergenic
1155623260 18:27805950-27805972 GTGTGTAGAAAAATTGAGGATGG - Intergenic
1156109095 18:33702110-33702132 ATGTTTACATAAATTAAGGAAGG - Intronic
1156676329 18:39530838-39530860 ATGTTTTCAGACAATGAGGAGGG - Intergenic
1156851836 18:41737599-41737621 ATGTGTGCAGGAAGAAAGGAAGG - Intergenic
1156987406 18:43364499-43364521 ATGTGAGCAGGAGATGAGGAGGG - Intergenic
1157272223 18:46284730-46284752 ATGAGTTCAGAAAGAGAGGAAGG + Intergenic
1158561904 18:58521455-58521477 ATGAGAGCAGAAATAGAGGAAGG + Intronic
1158846668 18:61450656-61450678 ATGTGTACAGAAAATCTGGAAGG - Intronic
1159384660 18:67707833-67707855 ATGTTTGCAGAAAATAAGAAGGG + Intergenic
1164740169 19:30569979-30570001 ATGTCTGGAGATATTGGGGAGGG + Intronic
1165638449 19:37363699-37363721 ATATTTGCAGAAAGTGTGGACGG + Exonic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1168359574 19:55727683-55727705 ATGTGTGCTGAAAATAATGAAGG - Intronic
1168538681 19:57192411-57192433 ATGTCTGCAGTAGTTGCGGATGG - Intronic
927972047 2:27312022-27312044 TTGTGTGCAGAAGTTGGGGTAGG - Intronic
929411725 2:41704210-41704232 GTATGCGCAGAAATGGAGGAAGG - Intergenic
930162524 2:48172727-48172749 ATGTGTGTGGAAGATGAGGATGG + Intergenic
931195518 2:60048900-60048922 ATGTGGGCAGAGAATGAGTATGG - Intergenic
931932665 2:67158092-67158114 ATGTGTTCAGAAATTCACCATGG + Intergenic
931958382 2:67453556-67453578 ATGAGTGCAGAAAGAGAAGAGGG - Intergenic
932148755 2:69348751-69348773 ATTTTGGCAGAAATGGAGGATGG - Intronic
935100685 2:99992709-99992731 AGGTGTTAAGAAAATGAGGATGG + Intronic
938727254 2:134119985-134120007 AGGTTGCCAGAAATTGAGGACGG + Intronic
939113879 2:138038888-138038910 ATTTGAGCAGAAATGGTGGAGGG + Intergenic
942671288 2:178378744-178378766 ATGTGTGCAGTAACTAAGGCTGG - Intronic
943428360 2:187765295-187765317 ATATCTACAGAAACTGAGGAGGG + Intergenic
944087857 2:195870112-195870134 ATGAGTGCATAAAGAGAGGAAGG - Intronic
944332929 2:198493833-198493855 ATATGTGAAGAAATAAAGGAGGG + Intronic
948572916 2:238928540-238928562 GTGTGTGCAGAATTTCAGGAGGG + Intergenic
1169225356 20:3853181-3853203 ATGTTTACAGAAATTAAAGATGG + Intronic
1169317480 20:4604706-4604728 ATGTGTGCAAAATAAGAGGATGG - Intergenic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1169827898 20:9789994-9790016 ATGCTTGAAGACATTGAGGAGGG + Intronic
1172938308 20:38636956-38636978 AGGTGTGGAGAAAATGTGGAAGG + Intronic
1173049215 20:39542915-39542937 GTGTGAGCAGAAATTGTGGAAGG - Intergenic
1173420952 20:42900627-42900649 ATGGATGAAGAAACTGAGGAGGG - Intronic
1173653306 20:44681515-44681537 ATGTGTGAACAAATGCAGGATGG + Intergenic
1173697935 20:45037300-45037322 ATGTGTGCAAAAGGGGAGGAAGG + Intronic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1174637957 20:52018045-52018067 GAGTCTGAAGAAATTGAGGAGGG + Intergenic
1174908415 20:54577764-54577786 CTGTGTTCAGAAATCCAGGAAGG + Intronic
1177353854 21:19981497-19981519 ATGTTTGCAGGAATTTAGAAAGG - Intergenic
1177656854 21:24028131-24028153 GTGTGTCCAGAAGTTCAGGATGG - Intergenic
1177729837 21:25014647-25014669 AAGTGTGAAGAAATTGAAGAGGG - Intergenic
1177879770 21:26678374-26678396 ATGAAAGCAGAAATTAAGGAGGG - Intergenic
1178243044 21:30924402-30924424 ATGTATGCTGAAACTGAGAAAGG - Intergenic
1181393951 22:22604718-22604740 ACCTGTGCAGAGAGTGAGGAGGG - Intergenic
1181403895 22:22668351-22668373 ACCTGTGCAGAGAATGAGGAGGG - Intergenic
1181406223 22:22686794-22686816 ACCTGTGCAGAGAGTGAGGAGGG - Intergenic
1181414174 22:22747446-22747468 ACCTGTGCAGAGAGTGAGGAGGG - Intronic
1181422547 22:22811807-22811829 ACCTGTGCAGAAAGTGAGGAGGG - Intronic
1181426995 22:22850195-22850217 ACCTGTGCAGAGAGTGAGGAGGG - Intronic
1182428619 22:30287700-30287722 ATGTGTGCAAAGACTGAGAAAGG + Intronic
1182444845 22:30384102-30384124 ATGCCTGCAGAACATGAGGACGG + Intronic
1183336271 22:37248697-37248719 ATTTGGGCTGAAAATGAGGAAGG - Intergenic
1184216385 22:43070211-43070233 ATCTGTACCGAAATTCAGGAAGG + Intronic
1184612993 22:45617679-45617701 ATTTGTGCATAATTTGAGGTAGG + Intergenic
950655293 3:14432712-14432734 ATGTGTGCAGAATCTGCAGATGG + Intronic
951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG + Intronic
952846276 3:37690447-37690469 ATGAGTGCAGAAATCCAGAATGG - Intronic
953430828 3:42839057-42839079 AGGTGTGGAGAAAATGAGAAAGG - Intronic
953642520 3:44722579-44722601 ATGTTTCCAGAAATGGAGGTGGG + Exonic
953880137 3:46687183-46687205 GTGGGTGCAGGAATGGAGGAAGG - Intronic
955142910 3:56287404-56287426 ATTTGTGCAGAATTTATGGAGGG + Intronic
955494097 3:59513038-59513060 CCGTGTGCTGAAATTTAGGAGGG + Intergenic
955711451 3:61783577-61783599 ATGTGTGCTGTGGTTGAGGAGGG + Intronic
956387830 3:68739623-68739645 ATGTGTCCATCAATGGAGGACGG + Intronic
957005478 3:74940930-74940952 ATGTGTAAATAAATTGAGAAGGG + Intergenic
957154535 3:76530713-76530735 ATGTGTGCACAAACTTTGGAAGG + Intronic
957211272 3:77261641-77261663 ATGTGTGCAGGAGGTGAGGGGGG + Intronic
957765438 3:84619015-84619037 TTGTGTGCAAAAATTAAGGCTGG - Intergenic
959040311 3:101414721-101414743 ATGAATGAAGAAATTAAGGATGG + Intronic
959907587 3:111727753-111727775 ATATGTTCAGAAATTGAGGCAGG - Intronic
959941854 3:112088537-112088559 CTGAGTGAAGAAATTGAGGGAGG + Intronic
960247411 3:115414712-115414734 ATGTTCACAGAAATGGAGGAAGG - Intergenic
961819756 3:129569956-129569978 ATCTGTGCAGAGGTTGGGGAAGG + Exonic
962321569 3:134394964-134394986 ATGTGTCAAGAAACTGAGGGTGG - Intergenic
963123956 3:141798175-141798197 AGGTGTCCAGACATTGGGGAAGG - Intronic
965770532 3:172177086-172177108 AGATGATCAGAAATTGAGGATGG + Intronic
966040076 3:175472976-175472998 AAGTATCCAGAAATAGAGGAGGG + Intronic
967773964 3:193365661-193365683 ATGTGTGCAAAAATAGAAGCAGG + Intronic
969453975 4:7290658-7290680 ATGTGTGCATACATGGATGAGGG - Intronic
971036760 4:22701855-22701877 CTGTGTTCAGGAATTGAGGGAGG - Intergenic
972935443 4:44129083-44129105 ATGTGTAAAGAAGTTGAGGCCGG + Intergenic
973137942 4:46730274-46730296 ATGTCAGCAGAAATGGAGGTTGG + Intergenic
974970254 4:68815451-68815473 GTGGGTGCAGAAATTCAGGTGGG + Intergenic
976127538 4:81849922-81849944 TTGTGTTCAGAAGTTTAGGATGG - Intronic
976359640 4:84162298-84162320 GTGAGTGAAGCAATTGAGGAAGG + Intergenic
977113709 4:92994152-92994174 ATAGATGCAGAAATGGAGGAAGG + Intronic
977196616 4:94069961-94069983 AGTTGTGCAAAAATTGAGTAAGG + Intergenic
978054152 4:104242237-104242259 ATGTTTGCAGATATTGTAGAGGG + Intergenic
981490624 4:145335931-145335953 TTGTGGGCAGGAATTCAGGATGG + Intergenic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
981671060 4:147287476-147287498 ATTTGTCCAGATATGGAGGAGGG + Intergenic
983082632 4:163406002-163406024 ATGGGGGCAGAAAATGAGGAAGG - Intergenic
983121711 4:163893518-163893540 AGATGTGCAGAAATGCAGGATGG + Intronic
984891806 4:184500812-184500834 ATGTGTGAAGAACTTTAGGCAGG - Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
986630141 5:9763919-9763941 ATGTTTGTAGAAATTCAGAAAGG + Intergenic
986878182 5:12136575-12136597 GTGTGTGCAGAAATTGTGAATGG - Intergenic
987222925 5:15808921-15808943 TTGTCTTCAGAAATTCAGGATGG - Intronic
987351315 5:17024698-17024720 ATGTGTGCAGAGAATAAAGAAGG + Intergenic
987791479 5:22574353-22574375 ATGAATGCTGAAATTGAAGACGG - Intronic
988788991 5:34590092-34590114 ATGTGTTCTCAAATTGAGAAGGG - Intergenic
988908132 5:35810890-35810912 AGGTGTGGAGGACTTGAGGAGGG - Intronic
989725948 5:44586982-44587004 ATGTGTGCAGGGATGGATGAGGG - Intergenic
990026689 5:51200427-51200449 AGGTGTGCAGACATTGAGCCAGG + Intergenic
992258501 5:74946528-74946550 ATGTATGCATAAAATGAGCAGGG + Intergenic
992760562 5:79947842-79947864 ACGTGTGCAGTAGTTTAGGAGGG + Intergenic
993204409 5:84861910-84861932 ATGTGTGCTTAAATAGAGTAAGG - Intergenic
994880686 5:105490693-105490715 AAGAGTGCAGTAATTGAGTATGG + Intergenic
995660754 5:114480341-114480363 ATGAGTTCTGAAATTGAGGCAGG + Intronic
998292752 5:140930618-140930640 AGGTGTGTAGAAATTAAGGAAGG + Intronic
998500161 5:142625615-142625637 ATGTGTGCAGGTCTTCAGGATGG - Intronic
999230098 5:150056701-150056723 ATGTGTGCAGAGTTTAGGGAAGG - Intronic
999320437 5:150611600-150611622 AGGTGGGCAGAAATGGAGGGAGG + Intronic
1000023292 5:157337526-157337548 AAGTGTGCAGAAATGGTTGAAGG - Intronic
1000078668 5:157822021-157822043 ATGTGTGCAAAACTTGAGGATGG - Intronic
1000657062 5:163891990-163892012 ATGTTTACAGAAATACAGGAGGG - Intergenic
1001182339 5:169532112-169532134 ATGTGGACAAAAATTGTGGAGGG + Intergenic
1001945581 5:175774987-175775009 ATGTGAACAGGAAATGAGGATGG + Intergenic
1002717274 5:181235329-181235351 ATGGAGGTAGAAATTGAGGACGG - Exonic
1003268823 6:4589707-4589729 ATGTGTGCATATTTTTAGGAAGG - Intergenic
1003521127 6:6859450-6859472 ATATGTACAGGAATTGAGGATGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004355383 6:14925761-14925783 ATGTGGGCAGAAATATATGAAGG + Intergenic
1004797624 6:19105472-19105494 ATGTGTGTGGAAATTGTGAATGG - Intergenic
1004815540 6:19308187-19308209 ATATGTGAAGGAATTGAGCACGG - Intergenic
1005764298 6:28995736-28995758 ATGAGTGCAGCAAGTGTGGAAGG - Exonic
1006102459 6:31693971-31693993 ATGGCTGCAGGAGTTGAGGAAGG - Intronic
1006958673 6:37903016-37903038 CTGTGTGCAGTAATTTAGGATGG + Intronic
1006992916 6:38230698-38230720 ATGTGTGCAGAACAGAAGGATGG - Intronic
1008847118 6:55981239-55981261 ATTAATGCAGAAATTGAGTAGGG - Intergenic
1009717501 6:67418134-67418156 ATGTAAGAAGAAACTGAGGATGG + Intergenic
1010302954 6:74282765-74282787 ATGAATGAAGAAATTAAGGATGG + Intergenic
1012276849 6:97284468-97284490 GTGTGTGCAGAGAGAGAGGAGGG - Intergenic
1012624057 6:101384860-101384882 ATGTGTGAAAAAAATGAGGTAGG + Intergenic
1014056440 6:117021213-117021235 ATCTGTGCAGATACTGAGGGAGG + Intergenic
1014095364 6:117453998-117454020 AGGAGTGCTGGAATTGAGGAAGG - Intronic
1014100567 6:117506840-117506862 ATGTCTGCTGAAATTCAGCAGGG + Intronic
1014942194 6:127455768-127455790 ATGAGGTCAGAAATTGAGCATGG - Intronic
1015009465 6:128327503-128327525 ATGTGTGGAGAAAATAATGAGGG - Intronic
1015360579 6:132334648-132334670 AGGTGTGCATAAATTGGGAAAGG - Intronic
1016097960 6:140061298-140061320 TGGTATGCAGAAATTGAGAAAGG + Intergenic
1017631181 6:156397545-156397567 ATGTCTGCAGAGCTTGAGGTTGG + Intergenic
1020522356 7:9207559-9207581 ATGTGTGCAGAAGGAGAGGATGG - Intergenic
1023557626 7:41439545-41439567 TTGTGTGCAGACATTCTGGAGGG - Intergenic
1023989789 7:45121882-45121904 ATGTGTACAGGAAGAGAGGAAGG - Intergenic
1024516516 7:50263838-50263860 ATGTGTGCAGACATGGAACATGG + Intergenic
1027751467 7:82152622-82152644 ATTGTTGCAGAAATTGGGGAGGG + Intronic
1027880658 7:83831133-83831155 ATGTGGCCAGAAACTGAGGAAGG + Intergenic
1028306420 7:89270816-89270838 ATGTTTGAAGAAATTGTGAATGG + Intronic
1028470258 7:91198072-91198094 ATGTCTGCAGACAGTGATGAGGG - Intronic
1028678787 7:93500598-93500620 GTGTTTGCAGAAATGGAGGTGGG + Intronic
1030519211 7:110576525-110576547 AGGTATGCAAAGATTGAGGAGGG - Intergenic
1031886407 7:127250485-127250507 ATGTGGGGAGAAATAGATGACGG - Intronic
1032297746 7:130657280-130657302 ATGTGTTGAGAAAATGAAGAAGG + Intronic
1032303616 7:130712462-130712484 ATGTGAGCAGAGATTAAGCAAGG - Intergenic
1032753188 7:134863170-134863192 ATGTGGGCAGGAGTTGGGGAGGG + Intronic
1032951764 7:136922535-136922557 ATGTGTGTAGACATAGAGTATGG - Intronic
1035983296 8:4397057-4397079 AAGTGTGCATAATTTGAGAAGGG - Intronic
1036012532 8:4743247-4743269 ATGTGTGAAAAATTTGATGAAGG + Intronic
1036443788 8:8804238-8804260 ATGTGTGCTGAAAATGAAAACGG - Intronic
1036616932 8:10395381-10395403 ATGTGTGTAGAAAGAGAGTAGGG + Intronic
1037223214 8:16551613-16551635 AAATGTGAAGAAAGTGAGGAGGG + Intronic
1038385141 8:27136993-27137015 ATGTGTGAATAAATTGATAAAGG - Intergenic
1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG + Intergenic
1038854121 8:31313049-31313071 ATCTGAGCAGAAATTAAGGAAGG + Intergenic
1039044313 8:33436014-33436036 TTGTGTGCAGAAACTGTGGTGGG - Intronic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1041602912 8:59742776-59742798 ATGTGTCCAGAAAAGGGGGATGG + Intergenic
1042755703 8:72208245-72208267 ATGTGTGCATAAATGGATAAAGG + Intergenic
1043006982 8:74831920-74831942 ATGTTTGATGAAGTTGAGGAAGG + Intronic
1043320426 8:78978135-78978157 ATCTGTGCAGAAAATGTGAAAGG - Intergenic
1044238164 8:89855807-89855829 GTGTATGCAGAAACTGAGGGTGG - Intergenic
1044270004 8:90230699-90230721 ATGTGTGCAAAAGTGTAGGAGGG - Intergenic
1044303080 8:90607915-90607937 AAGTTTGGAGAAATTGAAGAGGG - Intergenic
1044363994 8:91321639-91321661 ATCTGTGAAGGAATTTAGGAAGG - Intronic
1044937503 8:97307377-97307399 ATTTGTTCAGAAATTCAGGGAGG + Intergenic
1046577621 8:116050855-116050877 GTGTGGGAAGAAGTTGAGGAAGG - Intergenic
1046751750 8:117934012-117934034 CTGTGTCCAGAATTTGAGGCAGG - Intronic
1048258314 8:132923133-132923155 ATGTGTGCAGAACTTAGGGTGGG + Intronic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1049404308 8:142444910-142444932 AACTGTGCAGATGTTGAGGAAGG - Intergenic
1049409989 8:142468799-142468821 ATGTGTGCAGAGACAGAGGCAGG - Intronic
1052651845 9:31313787-31313809 ATGTATGCAGAAATACAGAATGG - Intergenic
1053416430 9:37949721-37949743 ATGTGTGCAGACATGGATGGTGG + Intronic
1055510420 9:76990809-76990831 AGGTGTGGAGAAATGGAGTAGGG - Intergenic
1055926293 9:81513670-81513692 ATGTGTGTATAAAATAAGGAAGG + Intergenic
1058952310 9:109915271-109915293 ATGTGTGGAGAAGTTCAAGAAGG + Intronic
1059005912 9:110402544-110402566 ATGTGTGAAGAAACTAATGAAGG + Intronic
1059155480 9:111985109-111985131 ATCTGTGCAGAACTTCAGGCTGG + Intergenic
1059703698 9:116800400-116800422 CTGTGTGCAAAAATTAAGCATGG - Intronic
1059740791 9:117147566-117147588 ATGTCTGAAAAAATTGAAGAGGG - Intronic
1059834325 9:118133645-118133667 AATTGGGCAGAAATTGAGGCAGG - Intergenic
1059847752 9:118300120-118300142 ATCTGTGCTTAGATTGAGGATGG + Intergenic
1059866642 9:118521928-118521950 ATGTGCGCAGAAAATGACAACGG + Intergenic
1060827031 9:126693423-126693445 ATGTGCGGAGAGATGGAGGATGG - Intronic
1060928885 9:127475588-127475610 ATGTGTGCCAATCTTGAGGAAGG - Intronic
1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG + Intergenic
1062537514 9:137027466-137027488 ATGGGTGCAGAGATTCAGGCTGG + Exonic
1186248377 X:7639102-7639124 ATATGGACAGAAATTGATGAAGG - Intergenic
1186252161 X:7679998-7680020 ATGTGTGCAAAAAATGAAGCAGG + Intergenic
1187061957 X:15795157-15795179 ATGTGTCCAGATATTGTGCATGG - Intronic
1187075090 X:15927061-15927083 ATGGGAGCAGAAAAGGAGGAAGG + Intergenic
1187269733 X:17768898-17768920 ATGAATGAAGAAATTAAGGATGG - Intergenic
1189174366 X:38940231-38940253 GTGTGGCAAGAAATTGAGGATGG + Intergenic
1191969465 X:66797527-66797549 ATGGGCACAGGAATTGAGGAAGG + Intergenic
1192359369 X:70429417-70429439 ATGAGTGAAGATAGTGAGGATGG + Intronic
1192543476 X:71994322-71994344 GTGTGTGTAAAAGTTGAGGAAGG + Intergenic
1192798634 X:74445196-74445218 ATGTGTGCATGCATTGAGGTGGG + Intronic
1193018922 X:76768986-76769008 AAGTATGAAGAAATTCAGGAAGG + Intergenic
1194530429 X:95041596-95041618 ATGTGAGAAGAAATTAAGCATGG + Intergenic
1195389515 X:104347092-104347114 ATGTTTTCAGAATTTCAGGAGGG - Intergenic
1195994333 X:110716636-110716658 ATGGGTGGAGAAATTAGGGATGG + Intronic
1197505829 X:127303731-127303753 ATGTGTTAAGTAATTGAAGAAGG + Intergenic
1198183194 X:134230027-134230049 GTGTATGCACAAATTAAGGAGGG - Intergenic
1199517298 X:148692721-148692743 ATGTGTGCAGAGACAAAGGATGG + Intronic