ID: 1136392404

View in Genome Browser
Species Human (GRCh38)
Location 16:29973916-29973938
Sequence CTCTCTCCGCACCACAGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 307}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136392404_1136392409 8 Left 1136392404 16:29973916-29973938 CCGGGGCTGTGGTGCGGAGAGAG 0: 1
1: 0
2: 0
3: 38
4: 307
Right 1136392409 16:29973947-29973969 GGAGAAGAGGAGAGGCAGAGAGG 0: 1
1: 2
2: 25
3: 330
4: 2357
1136392404_1136392412 15 Left 1136392404 16:29973916-29973938 CCGGGGCTGTGGTGCGGAGAGAG 0: 1
1: 0
2: 0
3: 38
4: 307
Right 1136392412 16:29973954-29973976 AGGAGAGGCAGAGAGGGCGCGGG 0: 1
1: 0
2: 5
3: 112
4: 1053
1136392404_1136392411 14 Left 1136392404 16:29973916-29973938 CCGGGGCTGTGGTGCGGAGAGAG 0: 1
1: 0
2: 0
3: 38
4: 307
Right 1136392411 16:29973953-29973975 GAGGAGAGGCAGAGAGGGCGCGG 0: 1
1: 2
2: 11
3: 227
4: 1857
1136392404_1136392408 0 Left 1136392404 16:29973916-29973938 CCGGGGCTGTGGTGCGGAGAGAG 0: 1
1: 0
2: 0
3: 38
4: 307
Right 1136392408 16:29973939-29973961 GCTGAGACGGAGAAGAGGAGAGG 0: 1
1: 0
2: 2
3: 56
4: 609
1136392404_1136392407 -5 Left 1136392404 16:29973916-29973938 CCGGGGCTGTGGTGCGGAGAGAG 0: 1
1: 0
2: 0
3: 38
4: 307
Right 1136392407 16:29973934-29973956 GAGAGGCTGAGACGGAGAAGAGG 0: 1
1: 0
2: 6
3: 96
4: 844
1136392404_1136392413 16 Left 1136392404 16:29973916-29973938 CCGGGGCTGTGGTGCGGAGAGAG 0: 1
1: 0
2: 0
3: 38
4: 307
Right 1136392413 16:29973955-29973977 GGAGAGGCAGAGAGGGCGCGGGG 0: 1
1: 0
2: 6
3: 155
4: 1715
1136392404_1136392410 9 Left 1136392404 16:29973916-29973938 CCGGGGCTGTGGTGCGGAGAGAG 0: 1
1: 0
2: 0
3: 38
4: 307
Right 1136392410 16:29973948-29973970 GAGAAGAGGAGAGGCAGAGAGGG 0: 3
1: 3
2: 35
3: 449
4: 3245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136392404 Original CRISPR CTCTCTCCGCACCACAGCCC CGG (reversed) Exonic
900579792 1:3403299-3403321 TTCTCCCCGCAGCGCAGCCCTGG - Intronic
901202530 1:7474860-7474882 CTCTCCCCGCACCCCACTCCAGG + Intronic
901236011 1:7667974-7667996 CTGTCTCCACACCACAGCAGGGG + Intronic
901929928 1:12590686-12590708 CTTCCTCCCCAGCACAGCCCTGG + Intronic
903642304 1:24868324-24868346 TTCTTTCTGCACCACAGCCCAGG - Intergenic
903694259 1:25195787-25195809 CTATTTCCCCTCCACAGCCCAGG + Intergenic
903755207 1:25655913-25655935 CTCTCCCCGACCCACAGCCCTGG - Intronic
905123031 1:35696315-35696337 CTCTTTCCCCACCACTGACCTGG + Intergenic
905247779 1:36626910-36626932 CACTATCCCCACCACAGTCCTGG + Intergenic
905473930 1:38212610-38212632 CTCCCTCTGCACCCCACCCCAGG - Intergenic
907638549 1:56161118-56161140 CTCTCACCTCATCTCAGCCCCGG + Intergenic
910802647 1:91161159-91161181 GTCTCTCAGCTCCACATCCCAGG - Intergenic
912477697 1:109950801-109950823 CTTTCTTAGCACCACAGCCAGGG - Intergenic
912702528 1:111888858-111888880 GCCTCTCCTCACCAAAGCCCAGG - Intronic
913088281 1:115458870-115458892 CTTTATCCGCATAACAGCCCAGG + Intergenic
914899295 1:151703369-151703391 CCCTCTCCGCACACCTGCCCTGG - Exonic
915734603 1:158076687-158076709 CTCTCTCCTCCCCGCTGCCCAGG + Intronic
916069618 1:161162220-161162242 ATCTCTCCAGACCACTGCCCAGG - Intronic
917876899 1:179294045-179294067 CCTTCTCCGCAGCACAGCCCAGG - Intronic
918361677 1:183765103-183765125 CTCTCTACTTACCACAGGCCAGG + Intronic
919469184 1:197957731-197957753 TTTTCTCAACACCACAGCCCAGG - Intergenic
920057105 1:203200823-203200845 CACTCTCCCCACCCTAGCCCAGG - Intergenic
922720933 1:227900004-227900026 TTCTCTCCGTCCCACAGCCAAGG - Intergenic
922763335 1:228145523-228145545 CCCGCTCAGCACCACAGGCCTGG - Exonic
923171574 1:231421958-231421980 CTCTCCCCGCTCCCCAGCCTCGG - Exonic
924568862 1:245220100-245220122 CTCTCTCCGCACCATGTTCCAGG + Intronic
1062823396 10:551252-551274 CCCCCTCCTCCCCACAGCCCTGG + Intronic
1066649121 10:37638966-37638988 GTCTCTCCACACCACTGCCATGG - Intergenic
1067031975 10:42884379-42884401 GTCTCTCCACACCACTGCCATGG - Intergenic
1067238041 10:44468170-44468192 CTGTGTCCTGACCACAGCCCAGG + Intergenic
1067773857 10:49147236-49147258 CTCTCTGCCCAGCACTGCCCTGG + Intergenic
1068939230 10:62664567-62664589 CTCTTTCCACACCCCAGCCCTGG - Intronic
1069557485 10:69407617-69407639 CTCTCTCCTAACCCCATCCCTGG + Intronic
1069616654 10:69810821-69810843 CGCTCTCCCAGCCACAGCCCTGG + Intronic
1070730118 10:78821311-78821333 CTTCATCCTCACCACAGCCCTGG - Intergenic
1070916940 10:80161061-80161083 CATTCTCGGCACCACAGCCAGGG + Intronic
1073911845 10:108354624-108354646 CTCTCCCTCCACCACAGCCCTGG - Intergenic
1074312725 10:112336299-112336321 CTCCCTCCCCTCGACAGCCCAGG - Intergenic
1076334687 10:129697777-129697799 CTCTCTCAGGAACACAGCCAAGG - Intronic
1076621591 10:131792513-131792535 CTTTCTCCACACCCCTGCCCAGG + Intergenic
1077334337 11:1996809-1996831 CCCTCTCCGCACCAGACCCTGGG + Intergenic
1077377945 11:2214420-2214442 CTCTCTTCTAACCACAGTCCAGG + Intergenic
1084267948 11:68014601-68014623 GCCTCCCAGCACCACAGCCCCGG + Intronic
1084440364 11:69169321-69169343 CTCTCACCCCACCACATTCCCGG - Intergenic
1087909557 11:103737438-103737460 ATCTCTCTGTACCACAGCCCAGG - Intergenic
1088817953 11:113434275-113434297 CTCCCTCCCCAGCACAGCCTTGG + Intronic
1090037554 11:123262015-123262037 CTCCATCGACACCACAGCCCAGG + Intergenic
1090732182 11:129581509-129581531 CTCTTTCCGCCCCACAGACTGGG + Intergenic
1202817320 11_KI270721v1_random:51991-52013 CCCTCTCCGCACCAGACCCTGGG + Intergenic
1092408289 12:8235668-8235690 CTCTCACGGTACCACAGGCCTGG - Intergenic
1092825598 12:12395816-12395838 CACTATCCCCACCCCAGCCCAGG - Intronic
1096106134 12:48997963-48997985 CTCTGGCCGCTCCACAGCCTGGG + Exonic
1096778451 12:53978186-53978208 CTCTAGCCGCAGCACTGCCCGGG + Intergenic
1098851599 12:75602460-75602482 ATCTCTCACCACCACAGACCCGG + Intergenic
1099182287 12:79482617-79482639 CTCTCTGTGAAGCACAGCCCAGG + Intergenic
1101602110 12:106219220-106219242 CCCTCCCTGCACCACAGCCTGGG + Intergenic
1102059520 12:109922241-109922263 CTCCCGCCGCACCACTGCCAGGG + Intronic
1103069127 12:117926240-117926262 CTCTCTCCCCATCCCAGCCTTGG + Intronic
1103959547 12:124600332-124600354 CTCTCTCAGCACCACACAGCAGG - Intergenic
1104639162 12:130456453-130456475 TTCTCTCCCCACCACAGCCAAGG + Intronic
1104792171 12:131490287-131490309 TTCTCTCCACACTCCAGCCCAGG + Intergenic
1104860287 12:131919861-131919883 CTCCCTCCCTGCCACAGCCCTGG - Intronic
1104993672 12:132641107-132641129 CTCTGTCCCCACATCAGCCCAGG - Intronic
1105518515 13:21111609-21111631 CAGTCTCCACACTACAGCCCAGG - Intergenic
1108268046 13:48732091-48732113 CTCTGTCCGCGGCTCAGCCCTGG + Intergenic
1108272439 13:48774732-48774754 GTCTCTCCCCACCACAGCCAGGG + Intergenic
1111338142 13:86848078-86848100 CAGTCTGCCCACCACAGCCCTGG - Intergenic
1112326595 13:98446010-98446032 CTCTCCCTGCACCAGGGCCCTGG - Intronic
1112880875 13:104104878-104104900 TTCTCTCCCCACCCCAGGCCTGG - Intergenic
1113646157 13:111998057-111998079 ATCTCCCCTCGCCACAGCCCGGG + Intergenic
1114472626 14:22974319-22974341 CTCCCTCTGTACAACAGCCCTGG + Intronic
1119547312 14:75481637-75481659 CTCTCTCCTCCCTGCAGCCCTGG - Intergenic
1120538870 14:85731326-85731348 CACTCTCCACACCACAGCCTGGG - Intergenic
1121215225 14:92242509-92242531 CTCACTCCTCACCCCAGGCCTGG + Intergenic
1121435370 14:93915637-93915659 CTGTCTGCCCACCACAGCACAGG - Intergenic
1122061529 14:99139501-99139523 GTGTCTCCACTCCACAGCCCAGG - Intergenic
1122264763 14:100541440-100541462 CTGTCCCCCCACCACGGCCCTGG + Intronic
1122349888 14:101082987-101083009 GTCCCTCCTCAGCACAGCCCAGG + Intergenic
1202921688 14_KI270723v1_random:34207-34229 CTCACTCCCCACCACCTCCCAGG + Intergenic
1124229909 15:27935527-27935549 ATCTCTCAGCACCCCAGCCCAGG + Intronic
1124632925 15:31347499-31347521 CTCTCTCATCACCACAGTCAAGG - Intronic
1125367435 15:38932889-38932911 GTTCCTCCGCACCTCAGCCCAGG + Intergenic
1126100015 15:45113276-45113298 CTCTCCCCGCCCCACCTCCCAGG + Intronic
1126208579 15:46074274-46074296 CTCTCTCCCCTCTCCAGCCCTGG - Intergenic
1126544780 15:49861508-49861530 CTCTCTCAGCATCACTGGCCTGG + Intronic
1127165716 15:56243597-56243619 ATCTCACCCCCCCACAGCCCCGG - Intergenic
1128311431 15:66633607-66633629 GGCTCTCCTCTCCACAGCCCAGG + Intronic
1128547667 15:68578950-68578972 CTCCCCCCGCCCCCCAGCCCGGG + Exonic
1128799107 15:70486385-70486407 CTCTCTCCACTTCACAGGCCAGG - Intergenic
1129225811 15:74169734-74169756 CTCTCCCCCATCCACAGCCCTGG + Intergenic
1129756648 15:78103000-78103022 CTCTCTGGGGACCACAGACCTGG + Intronic
1130517086 15:84633807-84633829 CTCTCTCCGCTCCCCAGCCTCGG + Intergenic
1130736368 15:86554449-86554471 CTCTCTCCACACCACCACCCGGG - Exonic
1131426129 15:92346779-92346801 TTCCCTCTGCACCACAGACCAGG - Intergenic
1132703674 16:1232114-1232136 CCCTCTGCACACCACAGCCCCGG - Intergenic
1132704835 16:1239247-1239269 CCCTCTGCACACCACAGCCCCGG + Intergenic
1132707844 16:1254281-1254303 CCCTCTGCACACCACAGCCCCGG + Intergenic
1132998493 16:2836782-2836804 CTGTGTGCGCACCACAGTCCAGG + Intronic
1133224789 16:4335682-4335704 TTCACTCCTCACTACAGCCCAGG + Intronic
1133237301 16:4393190-4393212 CACTCTCCTCTCCAGAGCCCAGG - Intronic
1133924652 16:10182852-10182874 CCCTCTCCGCAACCCAGCTCCGG + Intergenic
1134314353 16:13104680-13104702 CTCCATCCCCACCCCAGCCCAGG - Intronic
1134642752 16:15842345-15842367 CTCTCACCGCACTCCAGCCTGGG + Intronic
1134743141 16:16566275-16566297 TTTTCTCCTCCCCACAGCCCTGG + Intergenic
1134924419 16:18146185-18146207 TTTTCTCCTCCCCACAGCCCTGG - Intergenic
1135602600 16:23796013-23796035 CTATCTCCCCACCCCACCCCTGG - Intergenic
1135930060 16:26728748-26728770 TTCTCTCCGCAGCTCAGCCCAGG + Intergenic
1136021469 16:27443106-27443128 CACATTCCTCACCACAGCCCAGG - Exonic
1136271866 16:29153394-29153416 CTCTTTCCACACCACCGTCCTGG - Intergenic
1136392404 16:29973916-29973938 CTCTCTCCGCACCACAGCCCCGG - Exonic
1137236594 16:46623337-46623359 CTCCTTCCGCCCCAGAGCCCGGG + Intergenic
1137707192 16:50543852-50543874 CTCTCTCTGCTCCAGAGCCAGGG + Intergenic
1137888523 16:52132697-52132719 CCCTCTCCAAACCCCAGCCCTGG - Intergenic
1138496289 16:57411284-57411306 CTCTGTCCGCCCTGCAGCCCTGG + Intronic
1139474800 16:67197801-67197823 CTCTCCACCCACCAAAGCCCAGG - Intronic
1140043327 16:71424017-71424039 CTCCCTGCGCACCAAAGTCCTGG + Intergenic
1141509709 16:84504571-84504593 CTCACTGCGAACCTCAGCCCAGG + Intronic
1141597919 16:85108463-85108485 GTCTCTCTACACGACAGCCCTGG + Intronic
1142075532 16:88115550-88115572 CTCTTTCCACACCACCGTCCTGG - Intronic
1142363158 16:89636708-89636730 CTCCCTCCTGACCACAGCCCGGG - Intronic
1142759762 17:2035508-2035530 CTCCCTCCCCACCACAGGCAGGG - Intronic
1143094506 17:4470608-4470630 ATCTCTCTGCTCCCCAGCCCGGG + Intronic
1143107441 17:4536733-4536755 CTCTCTCCTCTCCCCACCCCTGG + Intronic
1144378251 17:14667126-14667148 TTCTCTTCTCCCCACAGCCCTGG - Intergenic
1145217315 17:21061724-21061746 CTCGCTCCCCACCACATCCCGGG - Intergenic
1146762977 17:35494766-35494788 CACTCTCCTCACCCCAGTCCTGG - Intronic
1147423111 17:40332240-40332262 CTCCCTCCTCCCCCCAGCCCTGG - Intronic
1147948934 17:44096255-44096277 CACTCTCCTCGCTACAGCCCAGG + Intronic
1148910901 17:50942192-50942214 CTCTCTCCGGCCCACTGCCTTGG + Intergenic
1149836382 17:59916681-59916703 CTCTTTCTTCACCACAACCCTGG + Intronic
1150249511 17:63698286-63698308 CTCCCTCCCCACCTCACCCCAGG - Exonic
1150714223 17:67557688-67557710 CTCTCTGTCCACGACAGCCCTGG + Intronic
1151428319 17:74045749-74045771 CTCTTTCCGGAGCCCAGCCCAGG + Intergenic
1151836577 17:76586119-76586141 CTCTCTCCAGAGCCCAGCCCCGG + Exonic
1152241350 17:79163014-79163036 CTCTCTCCCCCAGACAGCCCTGG - Intronic
1152259002 17:79256553-79256575 CTTTCTCCTCCCCACAGCCATGG - Intronic
1152482665 17:80565559-80565581 CTCCCTCCGCCTCCCAGCCCTGG - Intronic
1152482681 17:80565611-80565633 CTCCCTCCGCCTCCCAGCCCTGG - Intronic
1152482697 17:80565663-80565685 CTCCCTCCGCCTCCCAGCCCTGG - Intronic
1152551401 17:81032169-81032191 CTCTGTCCCCACCCCAGACCAGG - Intergenic
1152625694 17:81387030-81387052 CTCCCTCCGCGCCCCAGCTCCGG - Intergenic
1153515009 18:5894899-5894921 CTCTCACCGAACACCAGCCCGGG + Intronic
1155358470 18:24977193-24977215 CTGTCTCCCCACCAGAGCTCAGG - Intergenic
1157433592 18:47650878-47650900 TTCCCTCCACACCCCAGCCCTGG + Intergenic
1157761091 18:50266272-50266294 ATCTCTCCGCACTCCAGGCCTGG - Intronic
1160180597 18:76632043-76632065 CTCCCTCCTCCCCACAGCTCCGG + Intergenic
1160724103 19:610082-610104 CTATCTCCCCGCCACAGGCCGGG + Intronic
1160895574 19:1400496-1400518 CTCTCGCCTCCCCACAGGCCTGG - Intronic
1161298453 19:3531610-3531632 CTCTCTCCTCACCAGGGCTCTGG - Intronic
1161346489 19:3771025-3771047 CCCTCTGCACACCCCAGCCCTGG + Intronic
1161778921 19:6279009-6279031 TTCTCTCCCAACCCCAGCCCTGG - Intronic
1162129274 19:8515501-8515523 CTCTCTCTGCACCACTCCCATGG - Intergenic
1162809282 19:13154460-13154482 CACTCTCCTCCCCACTGCCCAGG - Exonic
1162830012 19:13278544-13278566 CCCTCTGCCCACCACACCCCCGG + Intronic
1163582501 19:18146895-18146917 ATCCCTGCGGACCACAGCCCTGG + Exonic
1163860962 19:19742624-19742646 GTCTCTCCCCACCCCACCCCTGG - Intergenic
1165923137 19:39311027-39311049 ATCTCTCCTCTCCAGAGCCCTGG + Intronic
1167331985 19:48861682-48861704 CTCTCTCCCCAGGACAGCTCGGG - Exonic
1167579690 19:50334170-50334192 CTCTCTCCGCCCCCAACCCCGGG + Intronic
925600479 2:5603973-5603995 CTCTCTCCGTACAGCATCCCTGG + Intergenic
925668856 2:6290492-6290514 CTCTCTCCACCCCACAGGCTGGG - Intergenic
926848059 2:17163848-17163870 CTCTCACCAAACCACAGCCCTGG + Intergenic
927088278 2:19691243-19691265 CTCTCTCCTCTACACAGGCCAGG - Intergenic
927519914 2:23692486-23692508 CTCTCTGCACTCCACACCCCAGG - Intronic
929040780 2:37742342-37742364 CTCTCTCCACCTCACAGGCCTGG + Intergenic
929892804 2:45932784-45932806 CTCTCTACTCCCCCCAGCCCCGG + Intronic
936020939 2:108994314-108994336 CTCTCTCTGCTCCCCAGCCAGGG + Intergenic
937856167 2:126673360-126673382 CTCTGTCCTCACCACAGCCTGGG + Intronic
938082226 2:128376351-128376373 CCCTCCCAGCACCCCAGCCCAGG - Intergenic
940890743 2:159033129-159033151 CTCTCTCCCAACCACAGACTAGG - Intronic
941468074 2:165854191-165854213 CTCTCTGCCCACCATAGCCAGGG - Intergenic
943527176 2:189031014-189031036 CTCACTCCTCACCACAACTCAGG - Intergenic
945221929 2:207492461-207492483 CTCAGTCCTCACAACAGCCCTGG + Intergenic
946242445 2:218364946-218364968 CTCACTGCACACCACAGGCCTGG + Intronic
946409629 2:219509590-219509612 CTCCCTCCACACCAGAGCCCAGG - Intergenic
946786610 2:223251837-223251859 CTGGCTGCGCGCCACAGCCCTGG - Intergenic
946899071 2:224355024-224355046 CTCTCCCCGCACCCCACCCCGGG - Intergenic
948397876 2:237661085-237661107 CTCTCCCCGCAGCCCAACCCAGG - Intronic
948803574 2:240443534-240443556 CCTCCTCCCCACCACAGCCCTGG - Intronic
948807300 2:240458593-240458615 CTCTCTTCCCACACCAGCCCTGG - Intronic
948888631 2:240896427-240896449 CACCCTCCTCCCCACAGCCCAGG + Intronic
1173128459 20:40363251-40363273 CTCTCCACGTACCACAACCCAGG - Intergenic
1174489148 20:50879971-50879993 CCCTTTCCCCATCACAGCCCGGG - Intronic
1174711761 20:52714360-52714382 CTCTCTCTGCATCACAGCCTGGG + Intergenic
1175072402 20:56345465-56345487 CTCTCTCCCCAACACAGACCTGG + Intergenic
1175659179 20:60797551-60797573 CTCTCCCTTCACCACTGCCCAGG + Intergenic
1175998910 20:62823506-62823528 CTCTCTCCTCACCCCACCCCGGG + Intronic
1176189294 20:63800331-63800353 CTCTCCCCCTACCCCAGCCCAGG - Intronic
1176376910 21:6091402-6091424 CTCCCGCCGCGCCACCGCCCCGG - Intergenic
1176521689 21:7829517-7829539 CTCTCTCGGCATCTCAGACCCGG - Intronic
1178655709 21:34459529-34459551 CTCTCTCGGCATCTCAGACCCGG - Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179601007 21:42477060-42477082 CCCCCTCCACCCCACAGCCCGGG + Intronic
1179601025 21:42477101-42477123 CCCCCTCCACTCCACAGCCCGGG + Intronic
1179601041 21:42477142-42477164 CCCCCTCCACCCCACAGCCCGGG + Intronic
1179601089 21:42477256-42477278 CCCCCTCCACCCCACAGCCCGGG + Intronic
1179714890 21:43281533-43281555 TTCTCCCAGCACCACAGCCCCGG - Intergenic
1179746565 21:43446842-43446864 CTCCCGCCGCGCCACCGCCCCGG + Intergenic
1180988114 22:19917517-19917539 CACTGTCCCCTCCACAGCCCCGG + Intronic
1181013703 22:20056536-20056558 CTGGCTCTGCACCACTGCCCAGG + Intronic
1181031034 22:20149013-20149035 GGCTCCCCGCACCGCAGCCCTGG + Intronic
1181182360 22:21077299-21077321 CTCACTCCGCAGCACACTCCTGG + Intergenic
1181512292 22:23394389-23394411 GGCTCCCCGCACCGCAGCCCTGG - Intergenic
1181618224 22:24069896-24069918 CTCTAACCTCGCCACAGCCCAGG - Intronic
1183086163 22:35488601-35488623 CCATCTCTGCACCACAGTCCAGG - Intergenic
1183218031 22:36493798-36493820 CTCTCTCCTCCCCACAGAACAGG - Exonic
1183302027 22:37063200-37063222 CTCTCCCCGCCCCCCAGGCCAGG - Exonic
1183354272 22:37350055-37350077 CCCTCTGCGTACCACAGCCCAGG - Intergenic
1184094219 22:42307924-42307946 ATCTCCCAGCTCCACAGCCCTGG + Intronic
1184118265 22:42434409-42434431 ATGTCTGCGCTCCACAGCCCAGG - Intergenic
1184418044 22:44363553-44363575 CCCTCTGCTCGCCACAGCCCCGG + Intergenic
1184476219 22:44722877-44722899 CTCTCTTTGCACCACAGTGCAGG + Intronic
1184693330 22:46127281-46127303 CTGGCTCCCCAGCACAGCCCTGG + Intergenic
1184755083 22:46511342-46511364 CTGGCTGCTCACCACAGCCCAGG + Intronic
1184803483 22:46776676-46776698 CTCTCTCCTCCCCACGGCCATGG - Intronic
1185187443 22:49410361-49410383 CACCTTCCCCACCACAGCCCTGG + Intergenic
1185275462 22:49948695-49948717 CGCTCTCTGCACCTCTGCCCTGG - Intergenic
1185395144 22:50582943-50582965 CTCTCTCCGTGCCCCGGCCCGGG + Exonic
950298071 3:11849034-11849056 CTCTCTCCGCTCCCTTGCCCTGG - Intergenic
952965928 3:38621265-38621287 CAATCTCCTCACCCCAGCCCTGG + Intronic
953791280 3:45950004-45950026 CTCCATCCACATCACAGCCCAGG + Intronic
956891215 3:73616012-73616034 CTCTCTGCCCACCACCACCCTGG - Intronic
959873880 3:111359863-111359885 CACCCTCCCCACCACAGCCCTGG + Intronic
961578150 3:127855471-127855493 CCCTCTCCCCACCCTAGCCCTGG + Intergenic
961749714 3:129088035-129088057 CTCCTTCCGCCCCAGAGCCCGGG + Exonic
962318179 3:134371494-134371516 CTCTCTCCCCACCCCACTCCAGG - Exonic
962722246 3:138187071-138187093 CTCTCTCTGCACCAAACTCCCGG - Intergenic
966851216 3:184166280-184166302 CTCTATCCACACCACCGCCTAGG - Intronic
967889580 3:194355552-194355574 CCCTCTCTGAACCACAGCCATGG + Intronic
968472560 4:788709-788731 CGCTCTCCCCAGCACACCCCTGG - Intronic
968632836 4:1661105-1661127 TGCTCTCCGCCCCTCAGCCCGGG + Intronic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969099331 4:4757082-4757104 CTCCATGTGCACCACAGCCCTGG - Intergenic
969483043 4:7456955-7456977 CTCACCCCTCACCACAACCCTGG - Intronic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
969886361 4:10218989-10219011 CACTCACCACCCCACAGCCCAGG + Intergenic
970498988 4:16657624-16657646 CTCTCTCCCCACAACTGCCCTGG + Intronic
971706439 4:30049228-30049250 CCCTCACCCCACCACAGGCCCGG - Intergenic
973634837 4:52852278-52852300 CTCCCTCCCCACTCCAGCCCCGG + Intergenic
975043224 4:69770007-69770029 TTCTGGCTGCACCACAGCCCTGG - Intronic
976724973 4:88206936-88206958 ATCTCTCACCACCACAGCCCAGG + Intronic
977569454 4:98614360-98614382 CACTCTACCCGCCACAGCCCAGG - Intronic
978549814 4:109913391-109913413 GTCTCTCAGCACCGCAGCACTGG + Exonic
978770067 4:112446793-112446815 TTCCCTCCCCACCACAACCCAGG + Intergenic
980257605 4:130402567-130402589 CTCTCTGTGCACCACAGGCAGGG + Intergenic
981697802 4:147576240-147576262 CTCACAGCTCACCACAGCCCCGG + Intergenic
983623299 4:169782343-169782365 TTCTCTCCCCACCCCACCCCCGG - Intergenic
984636145 4:182111874-182111896 CTCTCTCAAGACCCCAGCCCAGG + Intergenic
984661622 4:182381125-182381147 CTCACTCCTCAGCTCAGCCCTGG - Intronic
984859712 4:184227140-184227162 CTCTCTCCGCACCTCCACCAAGG - Intergenic
984954236 4:185030013-185030035 CTCTGCCCTCACCACAGGCCAGG + Intergenic
985369003 4:189265460-189265482 CACTCTCAGCTCTACAGCCCTGG + Intergenic
986221848 5:5775488-5775510 CTGTCTCCCCAGTACAGCCCTGG - Intergenic
992105838 5:73448414-73448436 CTCCCTCTGCGCCCCAGCCCGGG + Intergenic
992980417 5:82165149-82165171 CTCACTCTGCAGCACAGCCATGG + Intronic
993721300 5:91324233-91324255 CTCTCTCCACCCCTCACCCCAGG + Intergenic
995183947 5:109252693-109252715 CTCCCTTCACCCCACAGCCCTGG + Intergenic
997212855 5:132087691-132087713 CTTTCTCTGCCCCACAGGCCAGG - Intergenic
997444281 5:133930037-133930059 CTCTCTCCTCAGCACATCCGTGG + Intergenic
997899975 5:137754886-137754908 CTCTCTCCCCGGCAAAGCCCTGG - Intergenic
998192821 5:140042144-140042166 CTCCCTCCGCCCCCCACCCCTGG + Intronic
998229027 5:140347495-140347517 CTCTCTCCCCAGCACGTCCCTGG - Intergenic
998557816 5:143142878-143142900 CTCTCTCCTGACCACAGCACAGG + Intronic
998983136 5:147726349-147726371 GGCTCGCCACACCACAGCCCTGG - Intronic
999812150 5:155137966-155137988 TTCTTTCAGCCCCACAGCCCTGG - Intergenic
1002329203 5:178429881-178429903 CTCCCTCTGCACCACTCCCCAGG + Intronic
1002349899 5:178576684-178576706 CTCTCTCCTCCCCACGGCCGCGG + Intronic
1002379794 5:178818318-178818340 CTCTCTCCCCACCCCCGCCATGG - Intergenic
1002874961 6:1202560-1202582 CTCCCTCCTCACCCCAGCCATGG + Intergenic
1002946065 6:1762381-1762403 CTCACTCCTGACCACAACCCGGG - Intronic
1005843752 6:29761925-29761947 CTCTCTCCCCAACAGAGCACTGG - Intergenic
1006106093 6:31717784-31717806 CCCTATCCGCTCCACAGTCCTGG - Exonic
1006418858 6:33921040-33921062 CTCTGTCTGCACTCCAGCCCTGG - Intergenic
1006952489 6:37835200-37835222 CTGTCACCGCACCCCAGCCTGGG - Intronic
1007221865 6:40285176-40285198 CTCTGTCTCCACCACAGCACAGG + Intergenic
1007351452 6:41276491-41276513 CTCTCTCCCTACCACATCACAGG - Intronic
1007969403 6:46035701-46035723 CTCTGGCTGCAACACAGCCCTGG - Intronic
1009456949 6:63868645-63868667 CTCTGATAGCACCACAGCCCAGG + Intronic
1010252650 6:73724206-73724228 CACTCACCTCACCATAGCCCTGG + Intronic
1011477942 6:87765930-87765952 CTCTCTCCGTGCAGCAGCCCAGG - Intergenic
1013527814 6:110990975-110990997 CTTTTTCCTTACCACAGCCCTGG + Intronic
1015410220 6:132885905-132885927 GTCACGCCGCCCCACAGCCCAGG + Intergenic
1017884972 6:158591351-158591373 CTGTCCCAGCAGCACAGCCCAGG - Intronic
1019473792 7:1234492-1234514 CGCACACCGCACCACAGACCTGG - Intronic
1020018410 7:4845864-4845886 CTCTCTCCTCGGCACAGCCCCGG - Intronic
1020085667 7:5308944-5308966 CTCTCTCCCCCACACAGCACTGG - Exonic
1020992599 7:15219648-15219670 CATTCTCCACACCACAGCCTGGG - Intronic
1021711061 7:23415645-23415667 CTCTCTCCTCCCCACATCCCAGG + Intronic
1024632607 7:51262127-51262149 CACTCACCGCACAGCAGCCCTGG + Intronic
1025208643 7:57008220-57008242 CTCTCTCCCCCACACAGCACTGG + Intergenic
1025663304 7:63568658-63568680 CTCTCTCCCCCACACAGCACTGG - Intergenic
1026742668 7:72988999-72989021 CTCTCTCATACCCACAGCCCAGG + Intergenic
1026802519 7:73409399-73409421 CTCTCTCATACCCACAGCCCAGG + Intergenic
1026807843 7:73438848-73438870 CGCTCTCCTAACCCCAGCCCTGG - Intergenic
1027101067 7:75376078-75376100 CTCTCTCATACCCACAGCCCAGG - Intergenic
1028709911 7:93895074-93895096 CTTTCTCACCACCACACCCCTGG + Intronic
1030162101 7:106519479-106519501 CTCACTGCCCACCCCAGCCCTGG + Intergenic
1032898883 7:136283593-136283615 ATGTCTCCAAACCACAGCCCAGG - Intergenic
1033223671 7:139544701-139544723 CCCTCTCCTCACTGCAGCCCTGG + Exonic
1033916868 7:146336929-146336951 CTCTCCCTGCACTACAGCCATGG - Intronic
1036656329 8:10679667-10679689 CTCTCTCCAGGCCACAGCCACGG + Intronic
1038241016 8:25807959-25807981 CTCTCCCCTCCCCATAGCCCTGG + Intergenic
1038433121 8:27515701-27515723 CTCTTTCCCTTCCACAGCCCAGG + Exonic
1038491646 8:27976117-27976139 CTCTCTCCACCCCTCAGCCCCGG - Intronic
1039858469 8:41436506-41436528 CTTTCTCCGCACAAATGCCCAGG + Intergenic
1040445673 8:47490839-47490861 CTCTCCCCGCACCCTAGCACAGG - Intronic
1041304811 8:56447504-56447526 CTCCCTCCCCACCACACTCCTGG - Intergenic
1042936334 8:74062388-74062410 CCCTCCCCGCACCCCAACCCCGG + Intergenic
1045737892 8:105318377-105318399 GTCTCCCCTCCCCACAGCCCCGG + Intronic
1048234344 8:132675327-132675349 GGCCCTCCGCACCGCAGCCCCGG - Intronic
1048590343 8:135815503-135815525 CTCTCCCCACCCCACAGCCTGGG + Intergenic
1049202936 8:141350674-141350696 CTCGCCCGGCACCACAACCCAGG - Intergenic
1049537313 8:143188407-143188429 ATCTCTAGGCACCACAGCCGAGG - Intergenic
1049623735 8:143610935-143610957 CTCTCACCTCCCCACAGCCTTGG - Intergenic
1050010825 9:1184416-1184438 CTCTCTCTGCACCTCAGACCTGG + Intergenic
1051151826 9:14088321-14088343 CTCTCTCCTCTCAACAGTCCTGG - Exonic
1052044300 9:23776437-23776459 CTCTCTCCCCAACACAGCCAAGG + Intronic
1054886714 9:70206777-70206799 CTCTCTCCCCACCCCACCACAGG + Intronic
1055595133 9:77858113-77858135 CTCTCTGCTCACCCCAACCCTGG + Intronic
1056195665 9:84226000-84226022 CTCTTTCTGCACCCAAGCCCAGG - Intergenic
1056592552 9:87974948-87974970 CTCTTTCCACAACGCAGCCCGGG - Intergenic
1057064676 9:92037819-92037841 CTGTCCCCGCAGCACAGCTCAGG - Intronic
1057193103 9:93098120-93098142 CTCACTCCCCGGCACAGCCCAGG - Intronic
1057443166 9:95096465-95096487 CTCTCTGCTTACCACATCCCAGG - Intergenic
1059438575 9:114290246-114290268 CTGTCTCCCCACCACGCCCCGGG - Exonic
1059769901 9:117415046-117415068 CTCTCTCCGCTCCTTAGCTCGGG - Exonic
1060002195 9:119968843-119968865 GGCCCTCCGCACCACAGCACTGG + Intergenic
1061061412 9:128252266-128252288 CTCACACCGCACCATAGACCTGG - Intronic
1061149432 9:128820527-128820549 CTCTGTCCCTCCCACAGCCCAGG - Exonic
1061801900 9:133117353-133117375 CTCTCTTCTCTCCAGAGCCCAGG + Intronic
1061804275 9:133129309-133129331 CTCTCGCCCCACCATGGCCCGGG - Intronic
1061910060 9:133717647-133717669 CCCCCTCCCCACCCCAGCCCAGG + Intronic
1061993532 9:134172926-134172948 CTGTCTCTGCAGCACAGGCCGGG - Intergenic
1062056838 9:134473160-134473182 CCCTCACAGCGCCACAGCCCTGG + Intergenic
1062121317 9:134835480-134835502 CTCACTCCACGCCACAGCCCTGG - Intronic
1062145624 9:134988205-134988227 TTCTCTTCCCACCAAAGCCCGGG + Intergenic
1062221721 9:135419663-135419685 TCCTCTCCCCACCTCAGCCCCGG + Intergenic
1062440474 9:136567305-136567327 CCCTCCCCCCCCCACAGCCCGGG - Intergenic
1186291732 X:8107729-8107751 GTCTCTCAGCAGGACAGCCCTGG - Intergenic
1187266413 X:17737750-17737772 CTCTCTCCTCAGGAGAGCCCCGG - Intronic
1190246762 X:48696127-48696149 CTCTCCACCCACCATAGCCCTGG - Intronic
1191095982 X:56673423-56673445 CTCTCCCCCCACCCCCGCCCAGG + Intergenic
1192340354 X:70258877-70258899 CTCTCTCCGCACCATAGCTGTGG - Exonic
1193658345 X:84225269-84225291 CTCTCTCTGCACCACGGAGCTGG + Intergenic
1194283661 X:91983550-91983572 CTGCCTCCGCACGGCAGCCCCGG - Intronic
1200601234 Y:5208114-5208136 CTGCCTCCGCACAGCAGCCCCGG - Intronic