ID: 1136392788

View in Genome Browser
Species Human (GRCh38)
Location 16:29975793-29975815
Sequence CCATATGCTGAGTGTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136392775_1136392788 28 Left 1136392775 16:29975742-29975764 CCCCAAAGGATTAAAGCTTTGTG 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1136392788 16:29975793-29975815 CCATATGCTGAGTGTCTGCATGG 0: 1
1: 0
2: 1
3: 19
4: 187
1136392786_1136392788 1 Left 1136392786 16:29975769-29975791 CCTTGGAGGCAGGGAAGGAAAAA 0: 1
1: 0
2: 1
3: 65
4: 646
Right 1136392788 16:29975793-29975815 CCATATGCTGAGTGTCTGCATGG 0: 1
1: 0
2: 1
3: 19
4: 187
1136392776_1136392788 27 Left 1136392776 16:29975743-29975765 CCCAAAGGATTAAAGCTTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 155
Right 1136392788 16:29975793-29975815 CCATATGCTGAGTGTCTGCATGG 0: 1
1: 0
2: 1
3: 19
4: 187
1136392774_1136392788 29 Left 1136392774 16:29975741-29975763 CCCCCAAAGGATTAAAGCTTTGT 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1136392788 16:29975793-29975815 CCATATGCTGAGTGTCTGCATGG 0: 1
1: 0
2: 1
3: 19
4: 187
1136392778_1136392788 26 Left 1136392778 16:29975744-29975766 CCAAAGGATTAAAGCTTTGTGGG 0: 1
1: 0
2: 1
3: 3
4: 110
Right 1136392788 16:29975793-29975815 CCATATGCTGAGTGTCTGCATGG 0: 1
1: 0
2: 1
3: 19
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136392788 Original CRISPR CCATATGCTGAGTGTCTGCA TGG Intronic
900837887 1:5020057-5020079 GCATATGCTGATTGTCAGGATGG + Intergenic
900929310 1:5726306-5726328 CCAGATGCTGACAGACTGCAGGG - Intergenic
901910484 1:12453476-12453498 CCATGTCCTGTGTGTCTCCAGGG - Intronic
902144954 1:14391008-14391030 CCATCTGCTGAGAATCTTCAAGG - Intergenic
902327642 1:15712442-15712464 CTGTATGGTGAGTGCCTGCAAGG - Intronic
903265322 1:22154510-22154532 TCATTTCCTGAGTGTCTCCAGGG - Intergenic
906441358 1:45848603-45848625 CCATATGCTGATTATATGCAGGG + Intronic
908023890 1:59927459-59927481 CCATCTGGTGAGTGCCTGCTTGG + Intergenic
919356840 1:196535766-196535788 CCATATGTACAGTGTCAGCATGG + Intronic
919824406 1:201493286-201493308 CCCTTTCCTGAGTGTCTGAATGG - Intronic
922043435 1:221919533-221919555 GCATCTGCTCAGTCTCTGCATGG - Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1062929480 10:1343236-1343258 TCATATGCTTATTGACTGCATGG - Intronic
1063549528 10:7017007-7017029 CCAGATGCTGGGTCTATGCAGGG + Intergenic
1064627125 10:17272899-17272921 CCATATGCACAGTGTCAGCCGGG + Intergenic
1064819283 10:19307334-19307356 CCATATGCTGTGATTCTGCTGGG + Intronic
1065867333 10:29925494-29925516 CCATCTGCTGAGGGTCTGAATGG + Intergenic
1066259953 10:33719861-33719883 CCACATGCTGAGTGGGTACATGG + Intergenic
1066592007 10:37005891-37005913 CCATCTCCTGAGTCTCTGCAAGG + Intergenic
1067728622 10:48792435-48792457 ACATGTACTGAGTGTCTTCATGG - Intronic
1068984907 10:63098522-63098544 ACATATGTTGAGTGTCAGGATGG + Intergenic
1069862652 10:71481193-71481215 GCTTATCCTGGGTGTCTGCAGGG + Intronic
1070731200 10:78829710-78829732 TGAACTGCTGAGTGTCTGCACGG - Intergenic
1072514793 10:96169303-96169325 CCATATGCTGATATTCTTCATGG + Intronic
1072901524 10:99411836-99411858 CCAAATGCTGAAAATCTGCAAGG + Intronic
1073527946 10:104203351-104203373 CCATAAGCGGAGAGTCTGCATGG + Intronic
1073663455 10:105503909-105503931 TCTTATGCTGAGTGGCTTCAGGG - Intergenic
1074431665 10:113399971-113399993 CCTTATGCTGAATGTTTCCATGG + Intergenic
1075181874 10:120218658-120218680 TCTTATGCTTAGTGTTTGCAGGG + Intergenic
1075310248 10:121407668-121407690 CCACATTCTGAGTTTCTGGATGG - Intergenic
1076576692 10:131474276-131474298 CCACAGGCTGCGTGTGTGCAGGG - Intergenic
1076775073 10:132690833-132690855 TCATGTGCTGTGTGTCTTCACGG + Intronic
1077015511 11:397424-397446 CCCGCTGCTGAGTCTCTGCAGGG - Exonic
1077258562 11:1602569-1602591 ACATATGTTGAGTGTGTGCCTGG + Intergenic
1078056213 11:8010989-8011011 CCCTGTGCTGAGTCTCTGGAAGG - Intergenic
1078060612 11:8040356-8040378 CCAGCTGCAGAGTGTCTGCTGGG + Intronic
1078916318 11:15782048-15782070 ATATATGTTGAGTGTCTGCTTGG + Intergenic
1080995572 11:37596300-37596322 CCATTTGCTGAGTATTTGAAAGG - Intergenic
1081702525 11:45161201-45161223 GCATTTACTGTGTGTCTGCATGG - Intronic
1082881355 11:58041264-58041286 CCCTAAGCTGGGTGTCTGCCTGG + Intronic
1084802962 11:71557419-71557441 ACATATGTTGAGTGTGTGCCTGG - Intronic
1085455351 11:76662342-76662364 TCAAATGCTGAGTGGCTGCTGGG - Intronic
1085896226 11:80642647-80642669 CCATCTCCTGAGTCTCTGCAAGG - Intergenic
1089597900 11:119593467-119593489 TCATCTGCTCAGTTTCTGCAAGG + Intergenic
1090714747 11:129420335-129420357 CCAAATACTGAGTGCTTGCATGG - Intronic
1093196540 12:16136201-16136223 CCATATGGTGAGTGGGTGGAGGG - Intergenic
1095496209 12:42787045-42787067 CCAGATCCTGAGTGTTTGCCTGG + Intergenic
1097192422 12:57225915-57225937 CCTTATGCGGAGTGCCCGCAAGG + Exonic
1098105153 12:67062013-67062035 CCATCTCCTGAGTAGCTGCACGG + Intergenic
1098182477 12:67862618-67862640 CCATATTGTGAGTGGCTCCATGG + Intergenic
1101651306 12:106679793-106679815 TCATATGCTGAAAGTCTGAAGGG + Intronic
1102628259 12:114253885-114253907 CAATATGCTGAACGTCTTCATGG + Intergenic
1102693153 12:114777605-114777627 CCAGGTGCTGTGTGGCTGCAGGG - Intergenic
1104110123 12:125696993-125697015 CCATATGAAGAGTGTCAGCTTGG + Intergenic
1104578869 12:129994410-129994432 CCATTTTCTGAATATCTGCATGG + Intergenic
1105518898 13:21114103-21114125 ACAAATGGTGAGTGGCTGCAGGG + Intergenic
1105980866 13:25514961-25514983 CATTATTCTGAGTGTCTGCGAGG + Intronic
1108993521 13:56694804-56694826 TGATATACTGAGTGTCTGCGAGG - Intergenic
1109448853 13:62482494-62482516 CCCTATGCACAGTGTCAGCAGGG + Intergenic
1109808434 13:67475302-67475324 CCATATGGTCCGTTTCTGCAAGG - Intergenic
1109883721 13:68514280-68514302 CCTTCTGCTTAGTGACTGCATGG + Intergenic
1110641283 13:77827694-77827716 CCATATGCTGAGTTAGTGGATGG + Intergenic
1112765320 13:102735713-102735735 GCATATACTGAGTCACTGCATGG - Exonic
1114064501 14:19050036-19050058 CCATCTGCTGAGAGCCTGCTGGG - Intergenic
1114097759 14:19349965-19349987 CCATCTGCTGAGAGCCTGCTGGG + Intergenic
1115839572 14:37453197-37453219 CCATATTCTTTGTGTCTTCAAGG + Intronic
1117011295 14:51473195-51473217 CCAAATCCTGATTGTCTCCAAGG - Intergenic
1118851591 14:69587836-69587858 CCATCTGCAGAGGGTCTACAGGG - Intergenic
1121741228 14:96253743-96253765 CCAGATGCTGAGCCTCTCCAGGG - Intronic
1122131885 14:99609018-99609040 TGTGATGCTGAGTGTCTGCAAGG + Intergenic
1124354335 15:28984026-28984048 CCAAAGTGTGAGTGTCTGCACGG - Intronic
1126048869 15:44669125-44669147 CCATCTGCTGCCTCTCTGCAAGG + Exonic
1127773330 15:62247352-62247374 CAGTATGCCGAGTATCTGCATGG - Intergenic
1129193062 15:73948617-73948639 CCACCTGCTGACTTTCTGCAGGG - Intronic
1130415823 15:83693851-83693873 ACATATGCTGAGTGATTGAATGG + Intronic
1130447842 15:84020715-84020737 TCTTTTGCTGAGTGTCAGCAGGG + Intronic
1131223446 15:90604581-90604603 CCATTTTTTGAGTGTCTACAGGG + Intronic
1131944213 15:97601347-97601369 GCAGATGCTGAGTTTCTGCCTGG - Intergenic
1131995863 15:98132182-98132204 CAAGATGCTGAGTGTCCCCACGG + Intergenic
1132113903 15:99121692-99121714 CTCTATGCTGAGTGTGTGTATGG - Intronic
1136392788 16:29975793-29975815 CCATATGCTGAGTGTCTGCATGG + Intronic
1141183964 16:81773963-81773985 ACATTTGCGGAGTGCCTGCAAGG - Intronic
1143655879 17:8293391-8293413 CCAAATGCTTACTGTCTGCCAGG + Intronic
1144686764 17:17231267-17231289 CCATGTCCTGAGTGTTTGCTAGG + Intronic
1145977969 17:28995220-28995242 CCCTCTGCTGAGCATCTGCAGGG + Intronic
1146572982 17:33968722-33968744 CCATATGGTGAGTCCCTGTAAGG - Intronic
1146748474 17:35353616-35353638 CCATGTGCTGGGTGCCTGCAAGG + Exonic
1146757012 17:35441843-35441865 CCATGTGCTGGGTGCCTGCAAGG + Exonic
1149514480 17:57269833-57269855 CCTTTGGCTGAGTGTCTGCTTGG + Intronic
1150343722 17:64388254-64388276 CCAAAGCGTGAGTGTCTGCAGGG + Intronic
1150976468 17:70092875-70092897 CAATCTGCTGAGGGTCTGGATGG - Intronic
1152533115 17:80932030-80932052 CCACATGCTGAGTGTCACCATGG + Intronic
1152738279 17:82008039-82008061 CCACATGCTGGGTGGCTGCAGGG + Intronic
1153371058 18:4316674-4316696 CCATATCCTGACTATGTGCAGGG + Intronic
1154449659 18:14463684-14463706 CCATCTGCTGAGAGCCTGCTGGG + Intergenic
1156405049 18:36775574-36775596 CCATTTACTGAGTGTTTACATGG - Intronic
1156969340 18:43136115-43136137 CCATATGCTTGGTGACTGCATGG - Intergenic
1158867209 18:61649250-61649272 CCCCATGCTGAGTGCCTGCCAGG + Intergenic
1159456246 18:68663089-68663111 CCAGATGGTAACTGTCTGCAGGG + Intergenic
1159524316 18:69568193-69568215 CCATATGCACAGCGTCAGCAGGG + Intronic
1160482720 18:79257376-79257398 CCATTTGCTCTGTGTCAGCAGGG - Intronic
1161519813 19:4717532-4717554 CCATAAGCTGAGAGCCTGCCCGG + Intronic
925315501 2:2919728-2919750 CCATGTGCTGCTTGCCTGCAGGG - Intergenic
927811218 2:26181278-26181300 CCAGATGGTGCGTGCCTGCAGGG - Intronic
931202269 2:60109679-60109701 GCATTTGTTGAGTATCTGCAGGG - Intergenic
934775396 2:96934049-96934071 CCATTTGCTGAGTGAATGCACGG - Intronic
935857308 2:107288975-107288997 GCATGTGCTGAGTGTCTGGAAGG + Intergenic
936525747 2:113240487-113240509 CCAGATGAGGAGTGTCTTCAGGG - Intronic
937320709 2:120959085-120959107 CCAAATGCTGAGTGCCCGGAAGG - Intronic
938481779 2:131669066-131669088 CCATCTGCTGAGAGCCTGCTGGG - Intergenic
941935106 2:170975809-170975831 GCATATGGTGAGTGCCTGCTGGG - Intergenic
942714130 2:178871655-178871677 CCACATCCTGAGTGTTTTCATGG - Intronic
942851990 2:180498304-180498326 TCTTATGCTTAGTGTTTGCATGG - Intergenic
946386093 2:219385423-219385445 CCGCAGGCTGGGTGTCTGCAAGG + Exonic
947391499 2:229643988-229644010 GCATTTGCTGAGTGTCTGCTTGG - Intronic
948571902 2:238922934-238922956 CTCTATGCTGAGTGCCAGCAGGG - Intergenic
948621357 2:239236720-239236742 CTTTATGCTGGGAGTCTGCAGGG + Intronic
1174142513 20:48425803-48425825 CCAGATGCGAAGTGTGTGCAGGG - Intergenic
1177615910 21:23519394-23519416 CCATATGCTTGGTGTATACAAGG + Intergenic
1178816011 21:35930047-35930069 CTATATCCTGTGTGTGTGCATGG - Intronic
1178833141 21:36072823-36072845 CCAGATGCTGAGGGTCCCCATGG + Exonic
1179367990 21:40776560-40776582 TCATATGCTCTCTGTCTGCAGGG - Intronic
1180117812 21:45723660-45723682 GCAGATACTGAGTGTCTGGAAGG + Intronic
1180482991 22:15772658-15772680 CCATCTGCTGAGAGCCTGCTGGG - Intergenic
1181530561 22:23514706-23514728 CCATATGCTCAGTGCGTGCTTGG - Intergenic
1182877853 22:33707936-33707958 CCATATCCTGGGTCTCTGCTTGG - Intronic
950472351 3:13194018-13194040 CCCTTTCCTGAGTCTCTGCATGG + Intergenic
951719747 3:25685966-25685988 ACATTTGCTGAGTATCTGCTAGG + Intergenic
952061426 3:29515682-29515704 CCAAGTGCTGAGTGTCTAGATGG - Intronic
953844626 3:46417679-46417701 CCATATGTCCAGTGTCAGCAGGG + Intergenic
953886127 3:46715301-46715323 CCATCTGCGGAATGACTGCACGG + Intronic
955645696 3:61134953-61134975 TCTTATGCTGGGAGTCTGCATGG - Intronic
956012463 3:64846021-64846043 CCAGCTGCCGAGTGTCTGCTAGG + Intergenic
956340493 3:68217986-68218008 CCATATGCTGTGTGCCTTCCTGG + Intronic
956861006 3:73323611-73323633 CCATGGGCTGAGTATCTTCATGG - Intergenic
960054726 3:113269030-113269052 CCATGTGCTGAGAGCCTGGATGG - Intronic
960164067 3:114381955-114381977 CCAAATCTTGAGTGTCTACATGG + Intronic
961110496 3:124279351-124279373 CCATGTGCTGAATGTCTTCAAGG - Intronic
963807554 3:149740095-149740117 CCTTATCCTGAGAGTCTTCATGG - Exonic
964048667 3:152363602-152363624 CCAAATGCTGAGCGTATGCCAGG + Intronic
965140453 3:164826823-164826845 TCAGATACTGAGTGTTTGCAGGG + Intergenic
968500169 4:946189-946211 CCACATGCTGTGTGTCTCCTGGG + Intronic
968607436 4:1542191-1542213 CCATAGCCGGGGTGTCTGCACGG - Intergenic
969158302 4:5232707-5232729 CCATTTGCTGAGTGTTTGCATGG + Intronic
969847648 4:9931872-9931894 CCACATGGAGAGTGACTGCAGGG + Intronic
972029244 4:34431928-34431950 ACATATGCTGTGTGTTTGCGTGG - Intergenic
972679837 4:41294782-41294804 CCATATGTACAGTGTCAGCAGGG - Intergenic
972979723 4:44681655-44681677 TCATCTGCTGAGTGTCTTTACGG - Intronic
974877377 4:67716017-67716039 CCATATTCTGAGAGACAGCATGG - Intergenic
977313929 4:95421292-95421314 TCTTATGCTGTCTGTCTGCATGG - Intronic
979721812 4:123909124-123909146 TCATATGATGAGTGTCTCCATGG - Intergenic
979730330 4:124016194-124016216 CCTTATGCTGAGAATCTTCATGG + Intergenic
981374038 4:143992878-143992900 CTAAATGCTGAGTGTCTCAAAGG - Intergenic
982124412 4:152172051-152172073 CCAAAGTCTGAGTGTCAGCAAGG - Intergenic
983051010 4:163047835-163047857 CCAGAGGCTGAGAGCCTGCAAGG - Intergenic
985695256 5:1336503-1336525 CCATCTCCTGAATGCCTGCAAGG + Intronic
986238345 5:5933658-5933680 CCAGTTGCTGCTTGTCTGCAAGG - Intergenic
988974518 5:36501746-36501768 CCACATCCTGAGTGACTGCTTGG - Intergenic
990347574 5:54884614-54884636 CTATATCCTCAGTGTCTGCCTGG + Intergenic
992410268 5:76498660-76498682 CCATTTACTGAGTGCTTGCAAGG - Intronic
992614418 5:78535202-78535224 CCATTTGCCGAGGGGCTGCACGG + Intronic
992769758 5:80035672-80035694 CCATCTGCTGAGTGAGTGGAGGG + Intronic
1000574174 5:162955152-162955174 CCATATGATGGGTGTATGAAAGG - Intergenic
1005810058 6:29508536-29508558 GCATCTGCTGAGTGGCTGGATGG + Intergenic
1007330747 6:41105871-41105893 GCCTATCCTGTGTGTCTGCAGGG + Intergenic
1007547961 6:42708530-42708552 CCATCTGCTCAGTGTGTCCAGGG - Intronic
1011756462 6:90503176-90503198 CCATAAACTAAGTGTCTCCAAGG + Intergenic
1012630828 6:101464896-101464918 CCATATACTTAGTCTCTGCCAGG - Intronic
1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG + Intergenic
1016513857 6:144872249-144872271 CCATAGGCAGAGTGGCGGCATGG + Intergenic
1017260380 6:152378791-152378813 CCTTGTGATGAATGTCTGCAAGG - Intronic
1017824611 6:158072022-158072044 ACAATTCCTGAGTGTCTGCATGG + Intronic
1018388180 6:163323168-163323190 CCAAAGCCTGAGTGTCTCCAAGG - Intergenic
1021958986 7:25853544-25853566 CCAGATCCTTAGTGTCTGCAGGG - Intergenic
1022110172 7:27225341-27225363 CCAGGGGCTGGGTGTCTGCAGGG + Intergenic
1024006237 7:45226424-45226446 CCATATGCTCTGTGTTTGCCTGG + Intergenic
1024254290 7:47528281-47528303 CCATCTGCTGGGGGTCTGCAGGG + Intronic
1024563817 7:50665591-50665613 CCAAATGCTGAGCAGCTGCAGGG + Intronic
1024571785 7:50729150-50729172 CCAAAAGCTGAGGCTCTGCAGGG + Intronic
1029611553 7:101629274-101629296 CCATAGCCTGCCTGTCTGCATGG - Exonic
1029861278 7:103575042-103575064 CCACATGCTGCATGGCTGCATGG - Intronic
1031150421 7:118047688-118047710 GCATCTGCTGAGTTTCTGCATGG + Intergenic
1039765882 8:40627089-40627111 TCATTTGCTGAGTATCTGCTAGG - Intronic
1041461991 8:58121154-58121176 CCAGATGCTGTGTGGCTGCTAGG + Intronic
1042733433 8:71962248-71962270 CCACATTCTGAGTCACTGCAGGG - Intronic
1043627682 8:82283554-82283576 CCGTATACTGAGTTTCTGCAAGG + Intergenic
1049317671 8:141977883-141977905 CCGTCTGCTGCCTGTCTGCAGGG + Intergenic
1053826013 9:42025311-42025333 CCATATGCAGAGAGGCTCCAAGG + Intronic
1054604550 9:67162085-67162107 CCATATGCAGAGAGGCTCCAAGG - Intergenic
1055383161 9:75731286-75731308 CCTTATTCTGAGTGTGTGAAGGG + Intergenic
1056070588 9:82982886-82982908 AGCCATGCTGAGTGTCTGCACGG + Intronic
1057183542 9:93042822-93042844 CCATGTGCTGAGGTTCTGGATGG - Intergenic
1057228333 9:93304173-93304195 CCACAGGCTGAGGGTCTGGATGG + Intronic
1059219584 9:112601547-112601569 CCATGTTCTGAGGATCTGCAAGG + Intronic
1060941223 9:127544114-127544136 CCATTTGCTGACTCTCTGCTGGG + Intronic
1061249795 9:129420120-129420142 CCATATGCTCAGTGGGTGCTTGG + Intergenic
1061437647 9:130575914-130575936 CCAGATGCTGAGGGTCTTTAGGG + Intergenic
1203624777 Un_KI270750v1:4491-4513 ACATATGCTGAGTTTTTGAAAGG - Intergenic
1186409849 X:9337058-9337080 CCATCTGCTGAGAATGTGCAGGG + Intergenic
1186413897 X:9366718-9366740 CCAGATGATGACTGTCTCCAAGG + Intergenic
1186528865 X:10275434-10275456 CCAAATCCTGAGTGTATGCTCGG - Intergenic
1188587418 X:31794648-31794670 CCAAATGCTGAATAGCTGCATGG + Intronic
1188835775 X:34952640-34952662 CCATATGCTTATTCACTGCATGG - Intergenic
1189552499 X:42107724-42107746 ATATTTGCTGAGTTTCTGCAAGG + Intergenic
1194589051 X:95773895-95773917 CCATATGGTCAGGGTCTTCATGG - Intergenic
1196138959 X:112239593-112239615 CCCTATCCTCAGTGTCAGCAGGG + Intergenic
1197957986 X:131973628-131973650 CCATAAGCTGAGAGTAAGCATGG + Intergenic
1200158929 X:153994475-153994497 CCAGATCCTGAGTGACTGTAGGG + Intergenic