ID: 1136395218

View in Genome Browser
Species Human (GRCh38)
Location 16:29988747-29988769
Sequence AGGCATTACCCTAGTGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136395211_1136395218 13 Left 1136395211 16:29988711-29988733 CCATGGCTGCAGGGGACCAAATT 0: 1
1: 0
2: 2
3: 15
4: 207
Right 1136395218 16:29988747-29988769 AGGCATTACCCTAGTGGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 76
1136395210_1136395218 17 Left 1136395210 16:29988707-29988729 CCAACCATGGCTGCAGGGGACCA 0: 1
1: 0
2: 3
3: 63
4: 617
Right 1136395218 16:29988747-29988769 AGGCATTACCCTAGTGGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 76
1136395209_1136395218 18 Left 1136395209 16:29988706-29988728 CCCAACCATGGCTGCAGGGGACC 0: 1
1: 0
2: 0
3: 20
4: 186
Right 1136395218 16:29988747-29988769 AGGCATTACCCTAGTGGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 76
1136395212_1136395218 -3 Left 1136395212 16:29988727-29988749 CCAAATTGCTCTCCTGCATCAGG 0: 1
1: 0
2: 0
3: 8
4: 164
Right 1136395218 16:29988747-29988769 AGGCATTACCCTAGTGGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 76
1136395205_1136395218 26 Left 1136395205 16:29988698-29988720 CCTTTTCTCCCAACCATGGCTGC 0: 1
1: 0
2: 2
3: 24
4: 278
Right 1136395218 16:29988747-29988769 AGGCATTACCCTAGTGGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136395218 Original CRISPR AGGCATTACCCTAGTGGGTT GGG Intronic
907381484 1:54094510-54094532 AGGCACTGCCCTCCTGGGTTGGG + Intronic
909870450 1:80731837-80731859 AGGCATTGCCTTGGTGGTTTTGG - Intergenic
913275327 1:117132152-117132174 AGGCTTTGCCCTAGTTGGTGGGG - Intergenic
914003962 1:143716867-143716889 AGACACAACCCTAGTGGCTTAGG + Intergenic
914516400 1:148378503-148378525 AGACACAACCCTAGTGGCTTAGG + Intergenic
920282448 1:204854290-204854312 AGGCATTCACCTATTGGGTTAGG - Intronic
1064222748 10:13455640-13455662 AGGCATCACCCTGGGGGGGTTGG + Intronic
1065205312 10:23351824-23351846 AGGCATGAACCTAATGTGTTGGG - Intergenic
1067838924 10:49660584-49660606 AGGAATTACCTTTGTGGGGTAGG + Intronic
1073431885 10:103492504-103492526 AGGCATTCCCCCAGTGGGTAAGG + Intergenic
1074785931 10:116839959-116839981 AGGCATGCCCCTAGTGAATTGGG + Intergenic
1079405635 11:20143014-20143036 AGGCATTACCCTGATGGTTGAGG + Intergenic
1079746680 11:24140840-24140862 AGTCACTACGCTAGAGGGTTTGG + Intergenic
1081033882 11:38117540-38117562 AGGCAGTGCCCTAGTGTGTCTGG - Intergenic
1081477643 11:43450361-43450383 AGGCATCACCTAGGTGGGTTTGG + Intronic
1087284225 11:96247410-96247432 AGGCTTTATGCTTGTGGGTTGGG - Intronic
1096513004 12:52142167-52142189 AGGCGTTACCCTGAAGGGTTGGG + Intergenic
1098477591 12:70922547-70922569 AGGCATTGCTCTAGGGAGTTGGG - Intergenic
1102661801 12:114535395-114535417 GGGCATTATCGTAGTGGTTTGGG - Intergenic
1103185325 12:118952037-118952059 AGGCATTGTCCTACTGGTTTGGG - Intergenic
1110045526 13:70824817-70824839 AAGGATTACCTCAGTGGGTTTGG - Intergenic
1110864765 13:80381590-80381612 AGGCATTAGCAAAGTGGGTTAGG - Intergenic
1111888708 13:94054741-94054763 ATGCATTTACCAAGTGGGTTAGG + Intronic
1123942048 15:25221430-25221452 AGGGATTACCCCAGTGGGATGGG - Intergenic
1130141055 15:81226769-81226791 AGCCATCAGCCCAGTGGGTTTGG + Intronic
1136395218 16:29988747-29988769 AGGCATTACCCTAGTGGGTTGGG + Intronic
1138271353 16:55698161-55698183 GGGCCTAACCCTAGTGGGTCAGG - Intronic
1140931706 16:79634054-79634076 AGACTTTAACCTAGTGGGTCTGG + Intergenic
1144455015 17:15411809-15411831 AGGCATTGCTCTTGAGGGTTGGG + Intergenic
1146984970 17:37207239-37207261 ATGCATTACCCTAGGGGGAGGGG - Intronic
1148327391 17:46791123-46791145 AGCCTTTTCCCTACTGGGTTGGG + Intronic
1151153132 17:72104970-72104992 AGGCTTCACCCTACTGGGGTTGG - Intergenic
1163005564 19:14394904-14394926 AGGAATTACCAGGGTGGGTTAGG - Intronic
1163125316 19:15241281-15241303 AGGCACTGCCCTAGTTGGGTGGG - Intronic
928430716 2:31216429-31216451 AGGCATTGCCCTAGATGGTAGGG + Intronic
937048376 2:118865522-118865544 AGCCATTTCCCCAGTGGTTTAGG - Intergenic
937486971 2:122325288-122325310 AGGCACTATTCTAGGGGGTTGGG - Intergenic
939683091 2:145162773-145162795 GAGCTATACCCTAGTGGGTTCGG - Intergenic
942155971 2:173127867-173127889 AGGTAACACCCCAGTGGGTTAGG + Intronic
946133730 2:217628430-217628452 AGGCATTACCCCATGGGGTAAGG + Intronic
1174551715 20:51367045-51367067 AGGTATGACCCTGGTGGGGTGGG + Intergenic
1177905803 21:26969616-26969638 AAACATTACACTAGTGGATTAGG + Intergenic
1182185200 22:28394309-28394331 AGGCACTATGCTAGTGGCTTTGG - Intronic
1183218070 22:36494012-36494034 AGGCTTTTCCCTTGTGGTTTCGG + Intronic
957591041 3:82198154-82198176 AGGCATTTGCCTAATGGATTTGG + Intergenic
961986866 3:131143999-131144021 ATGCATGACTCTAGTTGGTTAGG - Intronic
964174206 3:153805868-153805890 TGGCACTACCCAAGGGGGTTAGG - Intergenic
966126650 3:176585132-176585154 AGGCATTATCCTGGGTGGTTGGG + Intergenic
966201147 3:177360228-177360250 AGGCCTTTCCCTAGTGGGGAGGG + Intergenic
987203021 5:15596598-15596620 AGGCACTGCCCTTGTGGGTTTGG - Intronic
990287196 5:54311519-54311541 TCGCATTAAGCTAGTGGGTTTGG + Intergenic
994025643 5:95079036-95079058 AGTCATTTCACTAGTGGGATAGG - Intronic
994827640 5:104735504-104735526 AGGGATTACTCTGGTGGGTCTGG - Intergenic
998107088 5:139475601-139475623 AGGGAGTACTCTAGTGGGGTGGG + Intronic
999562507 5:152820076-152820098 AGACAGCACCCTGGTGGGTTGGG - Intergenic
1002317980 5:178356730-178356752 AGGCATCACTCTGCTGGGTTTGG - Intronic
1011463321 6:87628929-87628951 GGGCATTAGCCTAGTGTGTCAGG + Intronic
1011746686 6:90413486-90413508 AGGCATTGCCCTGCTGGGGTTGG - Intergenic
1013178620 6:107699346-107699368 AGGCATGAGCCCAGTGGCTTTGG + Intergenic
1016636896 6:146302952-146302974 AGTCTCTACCCTAGTGGATTTGG + Intronic
1020098197 7:5380060-5380082 AGCCATGACCCTAATGGGTGAGG + Intronic
1021062588 7:16131951-16131973 AGGCTTTGCCCTACTGGCTTCGG - Intronic
1024414091 7:49082096-49082118 AGCCATCACACTTGTGGGTTTGG - Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1028902857 7:96120568-96120590 AGGCATTTCCCTAGTAGTCTTGG + Exonic
1036813524 8:11884664-11884686 AGGCTTTACCATAGAGGCTTCGG + Intergenic
1040433237 8:47364519-47364541 AGTCATTCCACTAGTTGGTTCGG + Intronic
1041504219 8:58576775-58576797 AGCCATTACCTTATTGGATTCGG + Intronic
1046071761 8:109263699-109263721 ATGCAGAACCCTATTGGGTTGGG + Intronic
1051979267 9:22994366-22994388 AGGAATTAAACTAGTGGCTTAGG - Intergenic
1053431894 9:38047550-38047572 AGGCATTAGCCAAGAGGGGTAGG - Intronic
1059688323 9:116659377-116659399 AAGCATTACACTAGTGGGACAGG - Intronic
1061637276 9:131920470-131920492 AGGCATTCTTCTAGGGGGTTGGG + Intronic
1203759908 EBV:6961-6983 AGCCGTTGCCCTAGTGGTTTCGG + Intergenic
1190643438 X:52502913-52502935 AGCCATTACCCTAGAGTGTCCGG + Intergenic
1190955450 X:55188527-55188549 AGCCATTACCCTAGAGTGTCTGG - Intronic
1191853081 X:65600591-65600613 AGGAATTACCATAATGTGTTTGG + Intronic
1192430526 X:71108471-71108493 AGAGATTACCCAAGAGGGTTTGG - Intronic
1192890375 X:75384110-75384132 AGGCATTACCATTCTGGGGTAGG - Intronic
1194892424 X:99397393-99397415 AGGCACTACCTTAGTGGTCTTGG + Intergenic
1198798553 X:140425828-140425850 AGGTATTATCCTTGTGGGTGTGG + Intergenic
1201668420 Y:16487243-16487265 AGGCATGATCCTAGTTAGTTAGG - Intergenic