ID: 1136395833

View in Genome Browser
Species Human (GRCh38)
Location 16:29991943-29991965
Sequence CCCAGACCTGCTCTGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 445}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136395833_1136395841 13 Left 1136395833 16:29991943-29991965 CCACAGGGCAGAGCAGGTCTGGG 0: 1
1: 0
2: 6
3: 61
4: 445
Right 1136395841 16:29991979-29992001 AGAATGAGAGGCCACCTTACTGG 0: 1
1: 0
2: 0
3: 9
4: 99
1136395833_1136395838 -10 Left 1136395833 16:29991943-29991965 CCACAGGGCAGAGCAGGTCTGGG 0: 1
1: 0
2: 6
3: 61
4: 445
Right 1136395838 16:29991956-29991978 CAGGTCTGGGGCCTGAGGCAGGG 0: 1
1: 0
2: 6
3: 65
4: 672
1136395833_1136395842 17 Left 1136395833 16:29991943-29991965 CCACAGGGCAGAGCAGGTCTGGG 0: 1
1: 0
2: 6
3: 61
4: 445
Right 1136395842 16:29991983-29992005 TGAGAGGCCACCTTACTGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 112
1136395833_1136395843 21 Left 1136395833 16:29991943-29991965 CCACAGGGCAGAGCAGGTCTGGG 0: 1
1: 0
2: 6
3: 61
4: 445
Right 1136395843 16:29991987-29992009 AGGCCACCTTACTGGCAGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 133
1136395833_1136395846 27 Left 1136395833 16:29991943-29991965 CCACAGGGCAGAGCAGGTCTGGG 0: 1
1: 0
2: 6
3: 61
4: 445
Right 1136395846 16:29991993-29992015 CCTTACTGGCAGGAAGGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 134
1136395833_1136395840 1 Left 1136395833 16:29991943-29991965 CCACAGGGCAGAGCAGGTCTGGG 0: 1
1: 0
2: 6
3: 61
4: 445
Right 1136395840 16:29991967-29991989 CCTGAGGCAGGGAGAATGAGAGG 0: 1
1: 0
2: 1
3: 54
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136395833 Original CRISPR CCCAGACCTGCTCTGCCCTG TGG (reversed) Intronic
900193283 1:1360389-1360411 ACCAGGCCTGCTCTTCTCTGTGG - Intronic
900555724 1:3279442-3279464 CGCAGAGCTGCCCTGCCCGGCGG + Intronic
900598453 1:3493085-3493107 CTCAGGCCTGTTGTGCCCTGAGG - Intronic
901416536 1:9120459-9120481 CCCAGCCCTGCTCTGTCCTGAGG - Intronic
901462388 1:9399516-9399538 CCCTGCCCTGCTCTGCCCCAGGG + Intergenic
903140495 1:21335995-21336017 CCCAGAACTGCCAGGCCCTGGGG + Intronic
903178731 1:21595044-21595066 CGCAGACCTGCTCTCCTCCGTGG + Intergenic
903281988 1:22255319-22255341 CCCAGACCTGCCCTGGGCTCTGG + Intergenic
904130846 1:28274065-28274087 CCCAGACATGCTGTGCTTTGTGG + Exonic
905170150 1:36105090-36105112 CCCAGACCTAGCCTGGCCTGAGG - Intronic
905449747 1:38048356-38048378 CACAGACCTGATTTGCCCAGTGG - Intergenic
905629133 1:39509140-39509162 AGCAGCCCTGCTGTGCCCTGGGG + Intronic
905670769 1:39788862-39788884 CCCTGCCCTGCCCTGCCCAGCGG + Intergenic
906157950 1:43625184-43625206 CCCAGGCAGGCTCTGCGCTGAGG + Intergenic
906344041 1:45004218-45004240 CCCTGCCCTGCCCTGCCTTGGGG + Intronic
906416500 1:45624087-45624109 TCCTGACCTGCCCAGCCCTGTGG - Intergenic
907237253 1:53061319-53061341 CCCTTACCTGCTCTGGCCTGTGG - Intergenic
907297403 1:53464168-53464190 TCCAGCGCTGCTCTGCACTGGGG - Intronic
908077369 1:60535286-60535308 ACCAGACCTACTGTGACCTGGGG + Intergenic
908504907 1:64787407-64787429 GGCAGAACTTCTCTGCCCTGAGG - Intronic
908963097 1:69725795-69725817 TCCAGACCTGTGCTGCTCTGGGG + Intronic
914870926 1:151473319-151473341 CCCAGCCCTTCTCTGGCCTCGGG + Intergenic
914980496 1:152410629-152410651 CCCAGGCCTGTTCTGCCCTCTGG + Exonic
915600529 1:156920542-156920564 CCTCGCCTTGCTCTGCCCTGCGG + Intergenic
916265843 1:162889002-162889024 CCCAGAGCTCCCCTTCCCTGAGG - Intergenic
920213253 1:204344223-204344245 CCCTGACCTGTTCTCTCCTGAGG + Intronic
921390151 1:214607738-214607760 CCCAGCCCTGCGCTTGCCTGGGG - Intronic
921650721 1:217674740-217674762 CCTTGCCCTGCTCTGGCCTGTGG + Intronic
921936359 1:220800616-220800638 TTAAGACCTTCTCTGCCCTGAGG + Intronic
923141287 1:231162934-231162956 GCCAGCGCTGCTCTGCGCTGGGG - Intronic
923458180 1:234184601-234184623 CTCCCACCTGCTCTGGCCTGCGG - Intronic
923545570 1:234920779-234920801 CCCAGTGTTGCTCTGTCCTGAGG - Intergenic
923559064 1:235024730-235024752 CCCAGACCTTCTCAGCACTGGGG - Intergenic
1062911924 10:1217009-1217031 CCCAGGTCTGCACTGCGCTGGGG + Exonic
1063223083 10:3989288-3989310 CCCAGAGCTGCTTTGCCTGGAGG + Intergenic
1065944486 10:30594465-30594487 CCCAGATCTGCTCCGCCCACAGG + Intergenic
1065955317 10:30688719-30688741 TACAGACCTGCCCTGCTCTGTGG + Intergenic
1068462026 10:57341538-57341560 CCAAGGCCTGCTGTCCCCTGGGG + Intergenic
1068931226 10:62592538-62592560 CTGAGACCTCCTCAGCCCTGCGG + Intronic
1068955400 10:62815816-62815838 CCCGGACCTGCGCGGCCCGGAGG - Intronic
1069565493 10:69460863-69460885 TCCAGACCTGGTCTTCCCAGAGG - Intronic
1069593613 10:69656527-69656549 CCTAGCCCTGCTCTGCCCACTGG + Intergenic
1069662224 10:70131496-70131518 CCCAGAGCTGCCCTCCCCTGGGG - Intronic
1069854879 10:71434606-71434628 CTCAGACCAGCTCTGGGCTGAGG - Intronic
1070841843 10:79492806-79492828 CTCAGGCCTGCTCTTCTCTGAGG + Intergenic
1070862897 10:79686671-79686693 CCCAGACATGGACCGCCCTGGGG - Intergenic
1070923800 10:80205229-80205251 CCCAGCCCAGCGCGGCCCTGCGG - Intronic
1071097721 10:81997969-81997991 CCCAGACCTGCTCAGCTCAGAGG - Intronic
1071519654 10:86321566-86321588 CCCGGATATGCTTTGCCCTGTGG - Intronic
1072611154 10:97018477-97018499 CCCAGGCCTCCTGTGCCCTGTGG - Intronic
1072757067 10:98028698-98028720 CCAAGACCTTCTCTCCACTGGGG - Intronic
1074265978 10:111903726-111903748 CCCAGACTTGATCTGCCCCTGGG + Intergenic
1075521979 10:123148579-123148601 CCCAGACCAGCACGGCCCTAAGG + Exonic
1075580579 10:123614953-123614975 CCCACCCCTGCTCTGAACTGTGG - Intergenic
1075724332 10:124603829-124603851 CCCAGGCCAGCTCTGCCCACAGG - Intronic
1075736478 10:124667555-124667577 CCCGGTCCTCCTCAGCCCTGTGG - Intronic
1076176804 10:128374524-128374546 TCCAGACCTGCCCTGCCCAGTGG + Intergenic
1076461238 10:130648966-130648988 CCCACACCTGCTGGTCCCTGTGG + Intergenic
1076523031 10:131093047-131093069 CCGAGACCTGCACGGCCCAGCGG - Exonic
1076590535 10:131579464-131579486 GACAGCCCTGCTCAGCCCTGAGG - Intergenic
1076691732 10:132227127-132227149 CTCAGAGCTGCTCTGGGCTGGGG - Intronic
1076919898 10:133446071-133446093 CGCAGCCCAGCTCCGCCCTGCGG + Intergenic
1077122110 11:914355-914377 CCCAGGTCTGACCTGCCCTGAGG + Intronic
1077252285 11:1565994-1566016 CCCAGCTCTGATCTGTCCTGGGG - Intronic
1077269347 11:1667762-1667784 CCCAGGCCTGCTGGCCCCTGTGG + Intergenic
1077287372 11:1773540-1773562 CCCAGGCCTGTCCAGCCCTGGGG - Intergenic
1077375581 11:2203887-2203909 CCCAGGCCTGCTCTCCTCAGGGG - Intergenic
1077443145 11:2577982-2578004 CCCTGTCCTGCCCTGTCCTGAGG + Intronic
1077532143 11:3102328-3102350 CCCTCACCTGCTCTGCACAGCGG - Intronic
1077609145 11:3633623-3633645 CCCAGAGCTCGTCTGCCTTGGGG + Intergenic
1078337317 11:10474482-10474504 CCCAGCCCTCCTCCGCTCTGGGG - Intronic
1078340297 11:10493687-10493709 CCCAGACCTGTTATTCTCTGAGG - Intronic
1078889581 11:15542426-15542448 CCCAGAGCTGCTCTATCCTATGG - Intergenic
1079240852 11:18721297-18721319 CCCTGCTCTGCTCTGCCCCGGGG + Intronic
1081538984 11:44016479-44016501 CCCTGAGCTGCTCTGACCTGAGG + Intergenic
1081585280 11:44379972-44379994 CCCATGCCTGCTCTGTCCTCTGG + Intergenic
1081868784 11:46373977-46373999 CACAGCCCTGCTCTGCCTGGTGG - Intronic
1082035442 11:47642113-47642135 CCCGGCCCTGCCCTGCCCGGCGG - Intronic
1082786226 11:57318491-57318513 CCCTGCCCTGCCCTGCCCTCTGG - Intronic
1082825924 11:57578798-57578820 TCCAGCCAAGCTCTGCCCTGAGG - Intergenic
1083727009 11:64633937-64633959 CCCAGCTCTGCTCTGCCCACAGG + Intronic
1083764151 11:64834076-64834098 CCCAGCCCTGCCCCACCCTGTGG - Intronic
1083880119 11:65544217-65544239 CTCAGATCTGCTCCACCCTGGGG + Intronic
1084003420 11:66311229-66311251 CCCAGGCCTGATTTGCCCGGAGG + Intergenic
1084085675 11:66854037-66854059 CCCAGTCCTCCTGTGCCCAGTGG + Intronic
1084370041 11:68735282-68735304 CTCAGACCTGCCCTGAGCTGGGG + Intronic
1084523903 11:69684224-69684246 CCCAGCCCTGCCATGGCCTGAGG + Intergenic
1084660944 11:70545982-70546004 CCCCGAGCTTCTCTTCCCTGTGG - Intronic
1084860985 11:72018128-72018150 TCCAGACCACCTCAGCCCTGAGG + Intronic
1085217475 11:74845008-74845030 CCCTGACTTGCTCTGAGCTGTGG + Intronic
1085510331 11:77084915-77084937 ACCAGAACTACTCAGCCCTGAGG + Exonic
1086416134 11:86590581-86590603 CCCAAATCTCCTCTGCCTTGAGG - Intronic
1086764378 11:90676188-90676210 TCTAGAGCAGCTCTGCCCTGTGG - Intergenic
1087176793 11:95103888-95103910 CCCAGACCGTGTCTGCCTTGTGG + Intronic
1088805410 11:113347865-113347887 CCCTGCCCTTCTCTGCCCTGTGG + Intronic
1089608091 11:119653453-119653475 CCCAACCCAGCCCTGCCCTGAGG + Intronic
1089769506 11:120793312-120793334 CCCTGACCAGCTGTGCCCTCTGG - Intronic
1089868429 11:121651824-121651846 CCCAGGCCTGCTCTGACCCAGGG - Intergenic
1090168104 11:124572632-124572654 ACCAGATTTGCTATGCCCTGTGG - Intergenic
1090412282 11:126517557-126517579 CCAAGTCCTGTTCAGCCCTGGGG - Intronic
1091097124 11:132834542-132834564 CCCAGGCCTTCTTTGGCCTGCGG + Intronic
1091597395 12:1887159-1887181 TCCAAAGCTGTTCTGCCCTGGGG - Intronic
1092886159 12:12926333-12926355 TCCACATCTGCTCTGACCTGGGG - Intergenic
1093759704 12:22894525-22894547 CCCACTCCTGCTCTACTCTGAGG - Intergenic
1094082823 12:26556273-26556295 TCCAGAACTGCTGTTCCCTGAGG - Exonic
1094567351 12:31611708-31611730 CCCAGGCCTGCTCTTCCCAGGGG - Intergenic
1096050817 12:48606022-48606044 CCTTGAGCAGCTCTGCCCTGTGG + Intergenic
1098338889 12:69431593-69431615 CCCAGGCATTCTCTGGCCTGTGG - Intergenic
1098595671 12:72271869-72271891 TCCAGTCTTGCTCTGCCCTCCGG - Intronic
1100433157 12:94548249-94548271 TCCAGGCCTGCGCTGCCATGGGG - Intergenic
1100743515 12:97620723-97620745 GGCACACCTGCTGTGCCCTGGGG - Intergenic
1103223650 12:119267722-119267744 CCCTGGGCAGCTCTGCCCTGTGG - Intergenic
1103599709 12:122046742-122046764 ACCGGGCCTGCTCTTCCCTGGGG + Intronic
1104053491 12:125211865-125211887 CTGAGACCTGCTCTGCCCACAGG - Intronic
1104140534 12:125983149-125983171 CACAGACCTGCTCTGTCCCCTGG - Intergenic
1104789530 12:131473056-131473078 CCCACAGCTGCCCTGCCCAGGGG - Intergenic
1104805316 12:131586102-131586124 CCGAGCCCAGCTCTGCCTTGGGG - Intergenic
1104858731 12:131913919-131913941 CCCAGGCCTGCTGTGTCCAGAGG + Intronic
1104984015 12:132586743-132586765 CACAGGCCTGCTCTGCCCTGGGG + Intergenic
1105577878 13:21670144-21670166 CTCCTTCCTGCTCTGCCCTGCGG - Intergenic
1105717474 13:23081774-23081796 CCCCCACGTGCTCTGCTCTGTGG + Intergenic
1106031468 13:26009394-26009416 CCCAGCTCTGCCCTGCACTGAGG + Intronic
1106592668 13:31110767-31110789 GCCCGGCCAGCTCTGCCCTGTGG - Intergenic
1106692941 13:32138563-32138585 CCCAGGCCTGCTCCTCTCTGGGG - Intronic
1108323165 13:49305920-49305942 GCCAGATGTGTTCTGCCCTGGGG - Intergenic
1111852619 13:93596133-93596155 CCTAGCCCTGGTCTGCTCTGAGG - Intronic
1113527554 13:110992381-110992403 CCCATCCCTGCTCTGCTCTGAGG + Intergenic
1113547682 13:111166767-111166789 TCCAGACCTGATCTTCACTGAGG - Intronic
1113607919 13:111623509-111623531 CCTATACTGGCTCTGCCCTGTGG + Intronic
1113642247 13:111965964-111965986 CCCAGCCCCGCCCTGCTCTGTGG + Intergenic
1113762572 13:112859721-112859743 CCCAGCACTGCTGGGCCCTGAGG - Intronic
1116616500 14:47147456-47147478 CTCAAAGCTGCCCTGCCCTGAGG + Intronic
1117490348 14:56240773-56240795 CCCACAGCTACTCTGCCTTGGGG - Intronic
1118317942 14:64737139-64737161 CACAGACCTGCGCTGCTCTGTGG + Intronic
1119108371 14:71946384-71946406 CCCAGGCCAGCTGTGACCTGGGG - Intronic
1119189295 14:72669520-72669542 CCTAGACATGCAGTGCCCTGTGG + Intronic
1119719984 14:76883954-76883976 CCCAGGCCCGCTCTGACCTCTGG + Intergenic
1120877397 14:89387726-89387748 CCCAGACCAACTCTGTCCTAAGG - Intronic
1121319157 14:92981063-92981085 CCCAGCACTGTCCTGCCCTGTGG + Intronic
1121438535 14:93934399-93934421 CCCAGACCTTCTCTACCTTCAGG - Exonic
1122171966 14:99884124-99884146 CGCAGACCAGCTCTGCACTGAGG - Intronic
1122349261 14:101078123-101078145 GCCAGACCGGCTCAGGCCTGGGG + Intergenic
1122366792 14:101199198-101199220 CCACGGCCTGCTCTGACCTGTGG - Intergenic
1123215712 14:106807523-106807545 TCCGCACCTGCTCTTCCCTGGGG + Intergenic
1124362454 15:29047665-29047687 CCCTGCCCTGCACTTCCCTGAGG - Intronic
1124681315 15:31733540-31733562 CCCAGACCAGGTCAGCCCTCTGG + Intronic
1125111593 15:36040399-36040421 CCCAGCCCTGCACTGGCTTGGGG - Intergenic
1125489411 15:40136005-40136027 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489425 15:40136054-40136076 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489491 15:40136301-40136323 TCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489504 15:40136349-40136371 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489520 15:40136402-40136424 TCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489533 15:40136450-40136472 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489547 15:40136498-40136520 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489559 15:40136547-40136569 CCCTGCCCTGCTCTACCCTGTGG - Intergenic
1126697762 15:51340705-51340727 CCAATACCTGCTCTGCCTCGAGG - Intergenic
1127900253 15:63335882-63335904 CCCAAACCTCATCTGCCCAGGGG - Intronic
1128064931 15:64758687-64758709 CCCAGAGCTGCTCTTTTCTGAGG + Intronic
1128162628 15:65434293-65434315 CTGAGACCTGCTCTCTCCTGGGG + Intergenic
1128232204 15:66043286-66043308 CACAGAGCTGGTCAGCCCTGTGG - Intronic
1129303102 15:74637929-74637951 CCCAGATCTGCCCTGCTCTTTGG + Intronic
1129670316 15:77604312-77604334 CCCAGAGATGCCCTTCCCTGTGG - Intergenic
1129691328 15:77715269-77715291 CCACGCCCTGCTCAGCCCTGAGG - Intronic
1129757698 15:78108543-78108565 CCCCGCCCAGCTCTGCCCTCAGG - Intronic
1131121032 15:89823525-89823547 CCCTGCCCTGCCCTGCCCTGGGG - Intergenic
1131143971 15:90000186-90000208 CCAAGACCTGCTCTGTCCTCGGG - Intergenic
1131258968 15:90878758-90878780 CCCAGCCCCCCTCGGCCCTGTGG - Exonic
1131435826 15:92420818-92420840 TCCAGAGCTGCTGTGCCCAGCGG + Intronic
1132551303 16:554878-554900 CCCAGTCCTTCCCGGCCCTGGGG - Intergenic
1132677075 16:1125256-1125278 CCCAACCCTGCTCTGCACAGCGG + Intergenic
1132722512 16:1323740-1323762 AGCTGAGCTGCTCTGCCCTGGGG + Intronic
1132878970 16:2152914-2152936 CCCTCACCTGCCCTGCCCTGTGG - Intronic
1132949778 16:2554661-2554683 CCCGGGCCTCCTCTGCTCTGCGG + Intronic
1132964570 16:2645506-2645528 CCCGGGCCTCCTCTGCTCTGCGG - Intergenic
1133129950 16:3670869-3670891 CCCAGACCTGCTCCTGCCCGCGG + Intronic
1133281961 16:4671685-4671707 CCCATTCCTGGGCTGCCCTGGGG - Intronic
1134086462 16:11360756-11360778 CCCAGAGCTGCCCTGCCCATTGG + Intronic
1134414648 16:14032960-14032982 CACAGACATGCTCTTCTCTGTGG + Intergenic
1135530994 16:23254592-23254614 CCCAGCCTTGCTCTGAACTGTGG + Intergenic
1135718169 16:24790998-24791020 CCCAAACCTGCTCTGAGGTGGGG + Exonic
1136247916 16:28985778-28985800 CCCAGCCCTGCCCCGCCATGGGG - Intronic
1136318099 16:29465856-29465878 CACAGTCCTGCTGTGCCCTCGGG - Intronic
1136395833 16:29991943-29991965 CCCAGACCTGCTCTGCCCTGTGG - Intronic
1136432674 16:30205205-30205227 CACAGTCCTGCTGTGCCCTCGGG - Intronic
1137811007 16:51352495-51352517 CCGAGGCCTCCTCAGCCCTGCGG - Intergenic
1138144598 16:54597175-54597197 CACAGGCTTGCCCTGCCCTGGGG - Intergenic
1139465353 16:67151116-67151138 CCCAGACCAGCCCTTCCCAGAGG - Exonic
1139670002 16:68486061-68486083 TCCAGACCTGGGCTGCTCTGTGG - Intergenic
1140469919 16:75208129-75208151 CCCGCCCATGCTCTGCCCTGAGG - Intergenic
1141124222 16:81388629-81388651 CCCGGACGTGCTCGGCCCGGTGG + Exonic
1141216841 16:82033103-82033125 CCCAGACCTACTCTGTCCTGGGG - Intergenic
1141470723 16:84236729-84236751 CCTGGTCCTCCTCTGCCCTGAGG + Exonic
1141580651 16:84996298-84996320 CCCAGATTTGGTCTGCCCTAGGG - Intronic
1141703533 16:85653033-85653055 CCCAGGCCTACCCTGACCTGGGG - Intronic
1141935659 16:87236352-87236374 CTGAGACCTGCCTTGCCCTGTGG + Intronic
1142230857 16:88899671-88899693 CCCCCACCTGCTCTTCCCTGGGG - Intronic
1142238289 16:88933140-88933162 TCCAGACAGGCTTTGCCCTGTGG + Intronic
1142382224 16:89739445-89739467 CCCAGCCCTGACCAGCCCTGTGG + Intronic
1142488009 17:259328-259350 AACAGATCTGCTCTCCCCTGCGG - Intronic
1142885962 17:2912219-2912241 CCCAGCCCAGCTCTGCCCAGAGG - Intronic
1143563369 17:7708006-7708028 GCTAGACCTGCTCTGCCCCCGGG + Exonic
1144709267 17:17389777-17389799 CACAGACCTGCTCTGACCACTGG + Intergenic
1146275829 17:31515006-31515028 CCCTGCCCTGCCCTGCCCTCTGG + Intronic
1146303462 17:31709936-31709958 CCCCGGCCTGCTGGGCCCTGAGG - Intergenic
1147308361 17:39578989-39579011 CCCAGACCTGCTTTTCCAGGAGG - Intergenic
1147914537 17:43878661-43878683 CCCAGGCACGCTCTGACCTGGGG + Intronic
1148020043 17:44547663-44547685 CTCAGCCCTGCTCTGGCTTGGGG - Intergenic
1148080649 17:44966316-44966338 CCCACAGCAGCACTGCCCTGAGG - Intronic
1148203350 17:45764384-45764406 TCCAGCTCTGCTCTGCCTTGAGG + Intergenic
1148605951 17:48928883-48928905 GCCAGACATGCTCTGCCCTATGG - Exonic
1149469951 17:56908428-56908450 CCAAGGCCAGCCCTGCCCTGTGG - Intronic
1149609951 17:57952956-57952978 GCCAGGCCTCCTCTGGCCTGGGG + Intronic
1150133606 17:62682183-62682205 CCCTGCCCTGCTCTGCCCTGGGG + Intronic
1150657141 17:67046651-67046673 CCCTGCCCTGCCCTGCCCAGGGG - Intronic
1150743374 17:67797357-67797379 CCCTGCCCTGCCCTGCCCAGAGG - Intergenic
1151330102 17:73401608-73401630 CCCAGCCCTGTCCTGCCCTCTGG + Intronic
1151357041 17:73565347-73565369 TCCAAACTTGCTCTCCCCTGTGG - Intronic
1151478242 17:74355577-74355599 CCAAAACCTGCACAGCCCTGAGG + Exonic
1151853789 17:76707999-76708021 CCCTGGCCTGTGCTGCCCTGGGG + Intronic
1151942587 17:77301919-77301941 CCCATCCCTGCTCTGCCCAGGGG + Intronic
1151946518 17:77322845-77322867 CCCAAGCATGCTCTGGCCTGAGG + Intronic
1151952368 17:77362202-77362224 CCCTGCCCTGCCCTGCCCTTTGG + Intronic
1152008587 17:77697152-77697174 CCCAGACCCTCACTGCCCCGGGG - Intergenic
1152280244 17:79380892-79380914 CCAAGACCAGCTCTGTCCCGTGG + Intronic
1152616273 17:81339381-81339403 CCAGGACCCGCCCTGCCCTGTGG - Intergenic
1152636324 17:81431944-81431966 CACAGTCCTGCCCTGTCCTGCGG - Intronic
1152679033 17:81656250-81656272 CCCAGACCATCACTGGCCTGGGG + Intronic
1152821521 17:82440036-82440058 CCCACACCTGCTCGGCCAGGTGG - Intronic
1153050045 18:893574-893596 CCCAGACATTCCTTGCCCTGTGG + Intergenic
1153595084 18:6717039-6717061 CCCAGACCTGGCCTGGCCTATGG + Intergenic
1153661953 18:7333288-7333310 GGCAGCCCTGCTCTGCCCTCCGG - Intergenic
1153757065 18:8294892-8294914 CCCAGGTCTGTTCTGCCCTCAGG - Intronic
1154005261 18:10521954-10521976 CCCATACCTGCTCTCCCTTCAGG - Intergenic
1154277342 18:12973741-12973763 CCCAGAACTGCTCCACCCTCAGG - Intronic
1154327967 18:13405812-13405834 CCCTGTCCTGCTCTGAGCTGAGG + Intronic
1156556929 18:38078357-38078379 CACAGACCTTCCCTACCCTGAGG - Intergenic
1156563615 18:38158509-38158531 CCCAGACCTGCTCTTTCCAAAGG - Intergenic
1157586455 18:48804401-48804423 CTCAGTCCTGCTGAGCCCTGAGG - Intronic
1157606273 18:48927765-48927787 CCCAGAACTGTTCTACCATGGGG - Intronic
1160053143 18:75455594-75455616 CCCAGCCCCGCTGCGCCCTGCGG + Intergenic
1160360218 18:78268697-78268719 TCCTGACCTCCTTTGCCCTGGGG + Intergenic
1160385848 18:78495767-78495789 CCCAGTCCTGCTCTGAGCTCTGG - Intergenic
1160427772 18:78790183-78790205 CCCAGCCCTGCTCCCTCCTGAGG + Intergenic
1160438279 18:78867752-78867774 CACAGAGATGCTCTGCTCTGTGG - Intergenic
1160535547 18:79589628-79589650 CCTGGACGTGCTCTGCCCGGTGG + Intergenic
1160573128 18:79832041-79832063 CAGACACCTGCTCTGCCCGGGGG - Intergenic
1160622708 18:80181787-80181809 CCCACACATGCTCTGCACAGGGG - Intronic
1160719437 19:590809-590831 CCCCGACATCCTCCGCCCTGCGG + Intronic
1160855133 19:1213852-1213874 CCCAGTCCTGCTCTGAGCCGTGG + Intronic
1160874291 19:1290089-1290111 CCCAGGCCTGCTCTGCGAAGTGG + Intronic
1160941131 19:1620961-1620983 CACAGACCTGCCAGGCCCTGGGG + Exonic
1161492822 19:4571684-4571706 ACCAGACCTGGACGGCCCTGGGG - Intergenic
1161962004 19:7528272-7528294 CCCAGACCAGCACTGACCAGGGG + Intronic
1162398309 19:10430675-10430697 CCCAGACCCGCCCCGCCCTGGGG + Intronic
1163538402 19:17891873-17891895 CCCAGTCCTGCTCTGGGCTATGG + Intronic
1163844115 19:19628819-19628841 CCCTGCCCTGCCCTGCCCTGTGG + Exonic
1164394395 19:27850815-27850837 TCCAGATCTCCTCTGCACTGCGG + Intergenic
1165792121 19:38499017-38499039 CCCTGCCCTGCCCTGCCCTGCGG - Intronic
1166225715 19:41393945-41393967 CCCAGCCCAGCTCTTCCCTTAGG + Intronic
1167112551 19:47470846-47470868 CCCACCCCAGCTCTCCCCTGAGG - Intronic
1168116105 19:54222086-54222108 CTCAGCCCTGCCCAGCCCTGTGG - Exonic
1168119087 19:54241834-54241856 CTCAGCCCTGCCCAGCCCTGTGG - Exonic
1168185459 19:54697234-54697256 CTCAGCCCTGCCCAGCCCTGTGG + Intronic
924960513 2:30317-30339 CCTAGACCTGTTCTGACTTGGGG - Intergenic
926060546 2:9802049-9802071 CCAAGACCTGAGCTGCCTTGAGG - Intergenic
926971468 2:18471440-18471462 CTCAGCCCTGCTCTCCCCAGGGG + Intergenic
927257658 2:21054236-21054258 ACCAGAGCTGACCTGCCCTGAGG - Intergenic
927452408 2:23220418-23220440 TCCACACCTGCTCAGCCCTATGG + Intergenic
927497530 2:23560959-23560981 GCCAGTCCAGCTCAGCCCTGGGG - Intronic
928465146 2:31516458-31516480 TCCAGCCCCTCTCTGCCCTGTGG + Intergenic
928891652 2:36211277-36211299 CCCAGTTCTGCTCTGAGCTGGGG + Intergenic
929195485 2:39180375-39180397 CCCAGCCGGGCACTGCCCTGTGG + Intronic
929217969 2:39436574-39436596 CCCAGACCTTCTCTGCACTATGG + Intronic
932480513 2:72036369-72036391 CACTGAGCTGCCCTGCCCTGTGG + Intergenic
932493970 2:72137606-72137628 CCCTGCCCTGCCCTGCCCCGTGG + Intronic
932576151 2:72963490-72963512 CTCAGGCCTGCTCTGGGCTGGGG - Intronic
932590550 2:73064122-73064144 CCAAGGCCTGCTCTTCCCTGGGG - Intronic
934514953 2:94980823-94980845 CACAGACCTGCCCTGCCCAGGGG - Intergenic
934656925 2:96121241-96121263 CCCAGCCCTGCCTTGCCCCGAGG + Intergenic
934707803 2:96497059-96497081 CCCACAAGTGCTCTGACCTGGGG - Intergenic
934740063 2:96713914-96713936 CTCAGCTCAGCTCTGCCCTGTGG + Intronic
934778415 2:96953658-96953680 CATAGTCCTGCTCTGCCCTGAGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935218719 2:100994180-100994202 CCCAGCCCTTCCCTGTCCTGGGG + Intronic
935503141 2:103866929-103866951 CTCACACGTGCTCTGCCCTGTGG + Intergenic
936064282 2:109318785-109318807 CCCTGACGAGCTCTGGCCTGAGG + Intronic
937125626 2:119473487-119473509 CCCAGGCCTAATCTGGCCTGTGG - Exonic
937230823 2:120397163-120397185 CCCTGCCCTGCCCTGCCCTGGGG + Intergenic
937316287 2:120933872-120933894 CCCTGCCCTGCCCTGCCCTGGGG + Intronic
937912091 2:127080754-127080776 CCCCTCCCTGCCCTGCCCTGGGG - Intronic
938569597 2:132550315-132550337 TCCAGAACTGCTGAGCCCTGGGG - Intronic
939381303 2:141440391-141440413 CCACGCCCTGCCCTGCCCTGCGG + Intronic
940479887 2:154214727-154214749 CCAAGACCTCCTCAGCCCTGTGG + Intronic
940986413 2:160056388-160056410 CCCTGACCTCCTCTGCTGTGAGG + Intronic
942219001 2:173750782-173750804 CCAAGATCTGCACTGCACTGTGG - Intergenic
945022326 2:205585859-205585881 ACCAGACCTGCTGTGGCCGGAGG - Intronic
945285158 2:208074820-208074842 CCCTGCCCTGTTCTGCACTGTGG + Intergenic
946406460 2:219494602-219494624 GACTGAGCTGCTCTGCCCTGAGG + Intronic
947732212 2:232437528-232437550 CCTAGTCATGCTCTGCTCTGCGG - Intergenic
948046762 2:234951675-234951697 CCCAGACCTGCTCGGTACCGGGG + Intergenic
948216694 2:236237732-236237754 CCCCGACCTGCTCAGCGCCGAGG - Exonic
948332057 2:237177482-237177504 ACCAGACCTGCTCCCACCTGAGG - Intergenic
948677790 2:239609286-239609308 CACAGACGGGCCCTGCCCTGGGG - Intergenic
948691620 2:239707758-239707780 CCTTGCCCTGCCCTGCCCTGGGG + Intergenic
948694599 2:239726891-239726913 CCAAGGCCTGCCTTGCCCTGTGG + Intergenic
948753970 2:240148634-240148656 CCCAGGCCTCACCTGCCCTGCGG - Intergenic
948762950 2:240203981-240204003 GCCGGAGCTGCTCTGCTCTGTGG + Intergenic
1169026402 20:2375067-2375089 TCCAGAGCAGCTGTGCCCTGTGG - Intergenic
1169303837 20:4471102-4471124 CCCAGACCTGGTCTCCCCCTTGG - Intergenic
1169334091 20:4740817-4740839 CCCAGACCTGGCCTTCCCTGAGG + Intergenic
1169960547 20:11154651-11154673 CCCACAATGGCTCTGCCCTGGGG - Intergenic
1170667822 20:18402056-18402078 CCCAGATCTTCTTTGCCCTCTGG - Intronic
1171018219 20:21561005-21561027 CCCAGACCTACTGCACCCTGAGG - Intergenic
1171095944 20:22332357-22332379 CCCCCAACTGCTCTGCACTGGGG - Intergenic
1171150594 20:22823596-22823618 CTCAGACCTGGGCCGCCCTGGGG - Intergenic
1171420882 20:25016770-25016792 CACGGACCTGCTTTGCCGTGGGG - Intronic
1171458749 20:25286742-25286764 CCCAAACCTGCTGTTCCCCGGGG + Intronic
1171967892 20:31544158-31544180 CTGAGGCCTGCTCTGCCATGTGG - Intronic
1172530174 20:35625638-35625660 CCCAGCCCAGCTCTGCCCTGAGG + Intergenic
1172703255 20:36864994-36865016 CTCAATCCAGCTCTGCCCTGCGG - Intergenic
1173135265 20:40433604-40433626 CCCAGACCAGCCCTGGCCTGGGG + Intergenic
1173787694 20:45806612-45806634 GCCAGAACTGCACAGCCCTGTGG + Intronic
1173817273 20:45997829-45997851 CCCAGCCCTGCTCCTCCCTCTGG - Intergenic
1175108060 20:56628541-56628563 CCCGGCCCTGCCCTGCCCTGCGG - Intergenic
1175245211 20:57578072-57578094 CCCAGCACTGCACTGCGCTGGGG + Intergenic
1175321939 20:58094428-58094450 CCAGAAACTGCTCTGCCCTGGGG + Intergenic
1175518493 20:59584622-59584644 CACAGCCCTGCTCTGACCAGAGG + Intronic
1175766334 20:61595250-61595272 CCAAGCCCTGCTGTGACCTGTGG + Intronic
1175879222 20:62247099-62247121 CCTAGTTCTGCTCTGCACTGTGG + Intronic
1176023192 20:62972991-62973013 CCCTGCCCTGCTGGGCCCTGTGG - Intergenic
1176117418 20:63439164-63439186 CCCTGCCCTGCCCTGCCCTGGGG + Intronic
1176306429 21:5125872-5125894 CCCACACCTGCTCTCGCCTTCGG + Exonic
1176341332 21:5698531-5698553 TCCAGACCTGCTGTGCCCAAGGG - Intergenic
1176473586 21:7130684-7130706 TCCAGACCTGCTGTGCCCAAGGG - Intergenic
1176503495 21:7625925-7625947 TCCAGACCTGCTGTGCCCAAGGG + Intergenic
1178476050 21:32938275-32938297 CTCGGACCTGCTGTGACCTGTGG + Intergenic
1179441365 21:41396875-41396897 CTCTGTCCTGCTCTGCCCTGAGG + Intronic
1179613675 21:42568079-42568101 CACAGTCCTGCTCCTCCCTGAGG - Intronic
1179724349 21:43333503-43333525 CCCAGCCCCGGCCTGCCCTGAGG - Intergenic
1179850630 21:44136158-44136180 CCCACACCTGCTCTCGCCTTCGG - Exonic
1180694148 22:17741220-17741242 CCCAACCCTGCCCTGCTCTGAGG - Intronic
1181341166 22:22181416-22181438 CCCTTACCTGCCCTGCCCTCTGG + Intergenic
1181464328 22:23102606-23102628 CCCACACCTGCTCTGCCTGCAGG + Intronic
1181748175 22:24970353-24970375 CCATGACCTGCCCTGCCCTATGG - Intronic
1182298683 22:29326229-29326251 CACAGACTGGCTATGCCCTGAGG + Intergenic
1182351793 22:29703793-29703815 CCCATACCTTCCCTGCCCTGAGG - Intergenic
1182696658 22:32203218-32203240 CCCAAACCCGCTCTGTGCTGTGG + Exonic
1183931403 22:41237994-41238016 CTGGGACCTGCGCTGCCCTGGGG - Exonic
1183932922 22:41246357-41246379 CCCAGCCCTGCTCTGTTGTGGGG - Exonic
1184090147 22:42288866-42288888 CCCAGGCCTGCACTGCCCTTGGG - Intronic
1184473980 22:44710877-44710899 CCCTGCCCTGCCCTGCCCTGCGG - Intronic
1184477346 22:44728868-44728890 CCAGGACCGGCTCTGCCCAGGGG - Intronic
1184648292 22:45907969-45907991 CCCAGAGCTCCCCTCCCCTGCGG + Intergenic
1184883297 22:47325800-47325822 CACAGACCCGCTCTGTCCAGAGG - Intergenic
1185047735 22:48537417-48537439 CACAGACATGGCCTGCCCTGGGG - Intronic
1185241776 22:49750727-49750749 CCCAGCCATGTCCTGCCCTGCGG + Intergenic
1185376193 22:50483606-50483628 CCCAGCCCTGCCCTGCCCTGGGG - Exonic
949739446 3:7213715-7213737 TCCAGAGCTGCCCTGCCTTGAGG + Intronic
950107495 3:10397527-10397549 CCCTGACCACCACTGCCCTGTGG - Intronic
950345222 3:12287564-12287586 CCCAGACCGGCCCTGGCCGGGGG + Intronic
950476109 3:13215910-13215932 CCCGGGCCTGGTCTGCTCTGGGG - Intergenic
950531978 3:13557542-13557564 CCCAGGCAGGCTCTGCCGTGTGG + Intronic
950577034 3:13838136-13838158 CCCCCACCTGCTCTGCCCAGGGG - Intronic
952425935 3:33174447-33174469 CCCAGCTCTGGGCTGCCCTGAGG - Intronic
952467548 3:33605923-33605945 CTCTGAGCTGCTCTTCCCTGGGG + Intronic
952824917 3:37516724-37516746 CCCAGACTGCCTCTGCACTGGGG + Intronic
953413394 3:42702403-42702425 CCCAGACCAGGGCTGGCCTGTGG + Intronic
953907508 3:46875745-46875767 CCCAGACCTGCTGGGAGCTGTGG - Intronic
953979511 3:47406627-47406649 CCCCGCCCTGCCCCGCCCTGGGG - Intronic
954108317 3:48420806-48420828 CCCAGGCCTGGGCTTCCCTGTGG - Intronic
954636704 3:52074827-52074849 AACACACCTGCCCTGCCCTGGGG - Intergenic
954793134 3:53147508-53147530 CCCAGATCTTCTCAGCCCAGAGG - Intergenic
954847598 3:53573369-53573391 GCCAGGCTTGCTGTGCCCTGGGG + Intronic
955064286 3:55521273-55521295 CCCACACTTGCTCTGGCCTAAGG - Intronic
955952977 3:64260771-64260793 CCCAGACTTGCTCTTCTCTCTGG - Intronic
959578951 3:107964673-107964695 GTCAGAGCTGTTCTGCCCTGAGG + Intergenic
959620765 3:108396558-108396580 CCCAGACCTGTACTGGTCTGTGG + Intronic
959761468 3:109970561-109970583 CCCAGAGGAGCTCTGCCCAGAGG + Intergenic
961362281 3:126375722-126375744 CCCTACCCTGCCCTGCCCTGAGG + Intergenic
961637420 3:128342178-128342200 CCCAGACCTGCTCAGACCCATGG - Intronic
961754710 3:129121135-129121157 CCCAGGCCTGCTCCGACCCGAGG + Intronic
963289633 3:143474585-143474607 CCCAGACATGCTCTTCCCCTGGG - Intronic
966769890 3:183494374-183494396 CCCAGGCCAGCCCTACCCTGAGG + Intronic
968262936 3:197339798-197339820 CCCCAGACTGCTCTGCCCTGTGG + Intergenic
968512868 4:1003118-1003140 GCCGGAACTGCTCTGCCGTGGGG - Exonic
968632180 4:1657363-1657385 CCCAGCCCTGCTCAGGCCTCCGG + Intronic
968921149 4:3522803-3522825 CCCTGCCCTGCTCTGCTCTGGGG - Intronic
969347923 4:6580778-6580800 CGCTGAACTGCCCTGCCCTGAGG + Intronic
969366215 4:6695796-6695818 CCCAGCCCAGCCCTGCCCTCAGG - Intronic
969608906 4:8216334-8216356 CCCAGACATGCTCAGCACAGCGG - Intronic
969614432 4:8244159-8244181 TCCAGCCCTGCTCTGCCCGTCGG + Intergenic
973309064 4:48687474-48687496 CCCCGACCTCATTTGCCCTGAGG - Intronic
978406044 4:108379873-108379895 CCCAGACTTGCTCTCCTTTGTGG + Intergenic
978472741 4:109088288-109088310 CCCATACCTGCTCCTCACTGTGG - Intronic
980340609 4:131540462-131540484 CCCAGTGCTGTTCTGCACTGTGG - Intergenic
982091469 4:151883557-151883579 ACCAGGCCAGCTCAGCCCTGAGG - Intergenic
984241816 4:177227697-177227719 CCGAGCCCTTCCCTGCCCTGCGG + Intergenic
985093850 4:186392284-186392306 TCCAGGCCTGCCTTGCCCTGAGG + Intergenic
985552631 5:541283-541305 CCCAGGCCAGCGCAGCCCTGTGG - Intergenic
985643545 5:1074655-1074677 CCCACTCCTTCTCGGCCCTGTGG + Exonic
985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG + Exonic
987114715 5:14717052-14717074 GCCACATCTGCTCTGCCGTGGGG - Intronic
988480492 5:31626417-31626439 CCCAGACCTGCTCTAAATTGGGG + Intergenic
988716958 5:33837549-33837571 CAAAGACATGCCCTGCCCTGTGG - Intronic
988919795 5:35929767-35929789 CCCAGATTTGCTCTGCACTCCGG - Intronic
989136700 5:38162920-38162942 CTCAGACCTGCTCAGCCCATAGG + Intergenic
989165908 5:38433446-38433468 GCCAGGCCTGCTCTGCAGTGAGG - Intronic
992204021 5:74412336-74412358 CTCAGACAGGCTCTCCCCTGTGG - Intergenic
994210875 5:97085901-97085923 CTGAGACCTCCTCAGCCCTGCGG - Intergenic
995485239 5:112633591-112633613 CTCAGCCCTGTTCTGGCCTGTGG - Intergenic
997226120 5:132210700-132210722 CCCAGCCCTGCCCTGGACTGGGG + Intronic
997360042 5:133289153-133289175 CTCTGCCCTGCTTTGCCCTGAGG - Intronic
1000994620 5:167946251-167946273 TCCTGTCCTGCTCTGACCTGAGG - Intronic
1002045861 5:176541589-176541611 CCCAGGCCTCCTCTGCAGTGGGG + Intergenic
1002181225 5:177432118-177432140 CCCAGCCCTGCCCAGCCCCGCGG + Intronic
1002315289 5:178339410-178339432 TCCTGCCCTGCTCTGCTCTGAGG - Intronic
1002451400 5:179320902-179320924 CTCAGGCCTGCTCTTCTCTGAGG - Intronic
1002779248 6:353817-353839 CCCAGCACTGCCCAGCCCTGGGG - Intergenic
1003138729 6:3454727-3454749 GCCAGAAATGCTCTGTCCTGTGG - Intronic
1003998756 6:11572134-11572156 ACCAGAACTGCTCAGCCCTATGG - Intronic
1007396848 6:41582873-41582895 CCAAGACCTGCCCTGCGGTGGGG + Intronic
1007581187 6:42961048-42961070 CCCTGACGTGCCCGGCCCTGTGG - Intronic
1007825133 6:44594626-44594648 CCCAGACCACCTGAGCCCTGCGG - Intergenic
1009467477 6:63990228-63990250 CCCAGACCCTCTTTCCCCTGTGG + Intronic
1012864659 6:104603900-104603922 TCCAGACCTTCTTTGCCGTGAGG - Intergenic
1014057255 6:117030561-117030583 CCCAGGCCAGCCCAGCCCTGGGG + Intergenic
1014130298 6:117823384-117823406 CCCAGGCTGGCTCTGCCCTTGGG + Intergenic
1014158308 6:118137608-118137630 CCCAAACCTGCACTGTCCTTTGG + Intronic
1014268758 6:119312655-119312677 CTGTGACCTGCTCTGCCATGTGG - Intronic
1016860025 6:148708234-148708256 ACCAGAGCTGCTCTGCGCTGGGG + Intergenic
1017021892 6:150146686-150146708 CCCAGATCTGTTCTGGCCTAGGG - Intronic
1017780503 6:157711786-157711808 CCAAGTCCTGCTCTTCCCTGGGG - Intronic
1017811344 6:157985999-157986021 CTGAGTCCTGCTCTGCCCTGGGG - Intronic
1017971490 6:159315783-159315805 CCCAGCCCTTCTGCGCCCTGCGG - Intergenic
1018882592 6:167899912-167899934 CCCACACCTAGTCTGCCCTTCGG + Intronic
1018981098 6:168602527-168602549 CCCAGACCTGCCTTGGACTGGGG + Intronic
1019274059 7:166708-166730 ACAACACCTGCTCTTCCCTGGGG + Intergenic
1019383814 7:742036-742058 GCCAGACCTGCTGGGCTCTGCGG - Intronic
1019530200 7:1499411-1499433 CCCACCCCTCCCCTGCCCTGGGG + Intronic
1019566830 7:1687078-1687100 CCTTGCCCTGCCCTGCCCTGTGG + Intergenic
1019709837 7:2513151-2513173 CCCAGATCTGCTTGGCACTGGGG - Intronic
1019894514 7:3973142-3973164 CCCAGGGTTGCTCTGCCCTGAGG + Intronic
1020010946 7:4805533-4805555 CCCAGCCCTCTCCTGCCCTGGGG + Intronic
1022217819 7:28281630-28281652 CACAGAACTGCTCTGCCCAGTGG - Intergenic
1023119043 7:36890937-36890959 CCCAGACCTGCTCCAACCTCAGG + Intronic
1023810310 7:43906480-43906502 CCCGGAGCGGCTCTGGCCTGCGG - Intronic
1023847442 7:44130475-44130497 CCCAGATCTGGGCTGGCCTGTGG - Intergenic
1023999856 7:45183090-45183112 CTCACACCTGCCCTGACCTGAGG - Intronic
1024598000 7:50956053-50956075 CCCACTCCTTTTCTGCCCTGAGG - Intergenic
1024819905 7:53316192-53316214 ACCATTCCTGCTGTGCCCTGAGG + Intergenic
1025026619 7:55521726-55521748 CCCTGCCCTGCCCTGCCCTGTGG - Intronic
1025227529 7:57178068-57178090 CCCTGCTCTGCCCTGCCCTGGGG - Intergenic
1025928957 7:65980091-65980113 TCCTGCCCTGCCCTGCCCTGGGG - Intronic
1026965006 7:74433971-74433993 CCCAGACCTACCCTGTCCTGGGG + Intergenic
1026982767 7:74536309-74536331 GCCAGCCCTGCTCTGGGCTGAGG + Intronic
1027255158 7:76426293-76426315 CCCAGCCCTGCCCTGCCGTAAGG - Intronic
1028923109 7:96328348-96328370 CACAGCCCTGCTCTGCTCTCAGG - Intergenic
1028998781 7:97130555-97130577 CACTGCCCTGCTCTGGCCTGTGG + Intronic
1029135728 7:98369591-98369613 CCCAGATCTGTTCTTTCCTGCGG + Intronic
1029172962 7:98643771-98643793 CCCAGCCCTGCTGTGCCAGGTGG + Intergenic
1029666405 7:101997886-101997908 CCCAGTGCTGCTGGGCCCTGTGG + Intronic
1030080513 7:105773979-105774001 CCCAGAGCTGCCCTCCTCTGTGG - Intronic
1032080071 7:128854302-128854324 CTCAGACCTGCCCTGGCCTTCGG - Intronic
1032238763 7:130145233-130145255 CACAGCCCTGCCCTGCCATGTGG - Intergenic
1035359208 7:158299213-158299235 TGCAGACCTGGGCTGCCCTGGGG + Intronic
1035573717 8:690676-690698 CGCAGCCCTGCTCTGCGCCGGGG - Intronic
1035578624 8:725475-725497 CCTAGGCCTGCTGTGCACTGAGG + Intronic
1035655798 8:1303797-1303819 TCCAGCCCTGCGCTGCGCTGAGG + Intergenic
1035747000 8:1968313-1968335 CACAGACCTGCTCACCCCTCTGG + Intergenic
1035754915 8:2023829-2023851 CCCAGGCCCGCTCCGCCCTATGG - Intergenic
1036575380 8:10023044-10023066 CCAAAACCTTCTCTGCCCTGTGG - Intergenic
1037517338 8:19645831-19645853 CCCAGGCCAGCACTGCCCTGGGG - Intronic
1037822413 8:22141413-22141435 CTCAGACCTCCTCTACCCCGGGG - Intronic
1038410846 8:27358176-27358198 CACAGCCCTGTGCTGCCCTGGGG - Intronic
1039478284 8:37853090-37853112 CCTGGCCATGCTCTGCCCTGAGG - Intergenic
1040060938 8:43102344-43102366 CACGGCCCTGCTCTGTCCTGGGG + Intronic
1041474593 8:58249309-58249331 CCCACACCTACTCTGCCAAGGGG + Intergenic
1041721935 8:60983919-60983941 CCAACACCTGCCCTGCCCTGAGG + Intergenic
1042103395 8:65298037-65298059 CCCTCAGCTGCTGTGCCCTGTGG + Intergenic
1043672878 8:82910592-82910614 CTCATGCCTGCTCTGCTCTGTGG - Intergenic
1048988330 8:139747439-139747461 CCCACACCTGCTCTGACCCCTGG - Intronic
1049146843 8:141006613-141006635 CCTAGACCTGCTGAGCCTTGTGG - Intergenic
1049250939 8:141588697-141588719 CCCCACCCTGCCCTGCCCTGGGG + Intergenic
1049603765 8:143519853-143519875 CCCAGAGGTGCCCTGCCCTGTGG + Intronic
1049689753 8:143953336-143953358 CCCAGCCCTGCCCTGCCCCTTGG + Intronic
1049692283 8:143966707-143966729 CCGAGCCCTGCCCTGTCCTGTGG - Intronic
1049756800 8:144314368-144314390 CCAAGACCAGCCCTGCACTGGGG - Exonic
1049769843 8:144374701-144374723 GCCGGGCCTGCCCTGCCCTGAGG + Intronic
1049823097 8:144648097-144648119 CCCTGAGCTGCCCTACCCTGAGG + Intergenic
1053052059 9:34970262-34970284 ATCAGACCTGCTCTTCTCTGTGG - Intronic
1053142057 9:35688634-35688656 AGCAGCCCTGCTGTGCCCTGGGG - Intronic
1053438197 9:38091634-38091656 CTCAGACCTGCTGAGCTCTGAGG + Intergenic
1053505730 9:38641768-38641790 ACCACACCTGTTCTGTCCTGAGG - Intergenic
1057726741 9:97573270-97573292 CCCAGGCCTTGTCTGGCCTGGGG - Intronic
1057829488 9:98395830-98395852 CTCAAGCCTGCTCTTCCCTGGGG - Intronic
1060230595 9:121822585-121822607 CCCAGACATACCCTGTCCTGAGG - Exonic
1060407345 9:123379417-123379439 AACAGGCCTGCTCAGCCCTGCGG - Intronic
1060804061 9:126563922-126563944 CCCACACCTGCTGCTCCCTGAGG - Intergenic
1061118364 9:128628531-128628553 CCCAGCCCTGCTCCTCCCTGGGG - Intronic
1062333546 9:136055109-136055131 TCCAGGCCTGCCCTGCCCTGGGG + Intronic
1062375189 9:136258954-136258976 CCGAGACCTGCACTGAGCTGTGG + Intergenic
1062523525 9:136969326-136969348 CCCTGCCCTGTCCTGCCCTGAGG - Exonic
1187048762 X:15675557-15675579 TCCACACCTGCTCTGCGCTCTGG - Intergenic
1190066022 X:47242291-47242313 CCCACACCTGCTCTGGCTTGCGG - Exonic
1190314930 X:49144564-49144586 CCCAGACCTGCACTGTCAGGGGG + Intergenic
1190764562 X:53465311-53465333 CCCAGCCCAGCTCAGCCCTCAGG + Intergenic
1192361589 X:70444485-70444507 CCCAGGCTTGCTCTGAGCTGGGG - Intergenic
1195101908 X:101563020-101563042 CCCTGGTCTGCTCTGCCCTAAGG + Intergenic
1195676719 X:107512321-107512343 CCCCCACCAGCTCTGCCCTCAGG - Intergenic
1195687613 X:107600799-107600821 CAGAGACCTGCTCTTCACTGAGG - Exonic
1197567618 X:128107366-128107388 CCCAGACCAGCACAGCACTGGGG + Intergenic
1197608151 X:128608333-128608355 CCCTGTGCTGCTCTGCCCTAGGG - Intergenic
1200109500 X:153733197-153733219 GCCAGGCCTGCTCTGTCTTGGGG + Intronic