ID: 1136396060

View in Genome Browser
Species Human (GRCh38)
Location 16:29993187-29993209
Sequence TGAGCTCTGCCACCCCCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136396060_1136396064 28 Left 1136396060 16:29993187-29993209 CCTCCTGGGGGTGGCAGAGCTCA 0: 1
1: 0
2: 3
3: 34
4: 287
Right 1136396064 16:29993238-29993260 CCACGCATATGTGACCAGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 437
1136396060_1136396065 29 Left 1136396060 16:29993187-29993209 CCTCCTGGGGGTGGCAGAGCTCA 0: 1
1: 0
2: 3
3: 34
4: 287
Right 1136396065 16:29993239-29993261 CACGCATATGTGACCAGTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 475
1136396060_1136396066 30 Left 1136396060 16:29993187-29993209 CCTCCTGGGGGTGGCAGAGCTCA 0: 1
1: 0
2: 3
3: 34
4: 287
Right 1136396066 16:29993240-29993262 ACGCATATGTGACCAGTCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136396060 Original CRISPR TGAGCTCTGCCACCCCCAGG AGG (reversed) Exonic
900151153 1:1179870-1179892 CGAGCTCTGGCCCCACCAGGCGG - Intronic
900350922 1:2234203-2234225 TGACCTCTGCCCACCCCAGCTGG + Intronic
900783093 1:4630700-4630722 TCAGCTCTCCCACCCCAAGAAGG - Intergenic
901023954 1:6269382-6269404 TGAGCTTGGCCTCCCCCAGGCGG + Intronic
901225295 1:7609693-7609715 AGATCTCTTCCACCCACAGGTGG + Intronic
902142264 1:14366720-14366742 TGAGCTCTGCCATCCACGGATGG + Intergenic
902368601 1:15992292-15992314 GGGGACCTGCCACCCCCAGGTGG + Intergenic
902406687 1:16187915-16187937 TGGGCTCTGCCGCCCTCTGGTGG + Intergenic
902866555 1:19284020-19284042 TGACCTCGGCCACCCTCCGGTGG - Exonic
903405460 1:23091768-23091790 TGAGCTCTGCCAGCCCCACCTGG + Exonic
904249548 1:29213298-29213320 TGAGCTCCTTCACCGCCAGGTGG + Intronic
904474825 1:30757949-30757971 TGCCCTCTGCCATTCCCAGGAGG + Intergenic
907160253 1:52364413-52364435 AGGGCTCTGCCACCTCCAGGAGG + Intronic
913177537 1:116288594-116288616 TAAACTCTGCCACCACCAGTTGG - Intergenic
917671551 1:177278293-177278315 AGATCTCTGCCACCCTCAGAGGG - Intronic
918251700 1:182708734-182708756 TGAGCTCTGATTCCCCCATGCGG - Intergenic
919768592 1:201142897-201142919 TGAGCCCTGCACTCCCCAGGTGG - Intronic
919917639 1:202148586-202148608 TGACCCCTGCCACCCTCCGGTGG - Exonic
920449603 1:206049518-206049540 AGATCTCTGGAACCCCCAGGGGG + Intronic
920732883 1:208504502-208504524 TGAGCTGTGCCAGCAGCAGGGGG + Intergenic
920852492 1:209637880-209637902 TATCCACTGCCACCCCCAGGAGG + Intronic
921646098 1:217619984-217620006 TGATCTCTACAACCCTCAGGTGG + Exonic
923466145 1:234249127-234249149 CCAGCCCTGCCACTCCCAGGAGG - Intronic
924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG + Intergenic
924384076 1:243486994-243487016 TGAGCTCTGGAACCCTAAGGTGG - Intronic
1064599380 10:16977678-16977700 TTAGCTCTGCCATCCTCAGATGG - Intronic
1064600209 10:16985561-16985583 TTAGCTCTGCCATCCACAGAGGG - Intronic
1065175126 10:23068212-23068234 AGAGCACTGCCAGCCCCAGATGG - Intergenic
1065628293 10:27653435-27653457 GGACCACTGCCACCCCTAGGTGG + Intergenic
1066279421 10:33900749-33900771 TCAGCTCTGCCACTACCAGGAGG - Intergenic
1068626856 10:59258585-59258607 TGAGGTCTCCCACCCCAAGCAGG - Intronic
1068781298 10:60921702-60921724 AGTTCTCTGCCAGCCCCAGGTGG - Intronic
1070016894 10:72542642-72542664 TTAGCTCTGCCATCCACAGATGG + Intronic
1070543656 10:77435870-77435892 TGAGCTCTGTCACTGCCAGGTGG - Intronic
1070552022 10:77497413-77497435 TGAGCTCACCCACCCTCAAGGGG - Intronic
1072279244 10:93851101-93851123 TTAGCTTTGCCACCCACAGACGG - Intergenic
1072650593 10:97292303-97292325 TCAGCGCTGCCACCCCCAGCTGG + Intronic
1073044033 10:100625790-100625812 TGAGCTCCGAGACCACCAGGCGG - Intergenic
1074854384 10:117462506-117462528 TGGGCTCTGCCACACACAGTTGG - Intergenic
1076494104 10:130885557-130885579 TCAGCTCTGCCAACACCAGCTGG - Intergenic
1076685918 10:132198462-132198484 CGTGCTCAGCCACCCCGAGGAGG + Exonic
1076778481 10:132710990-132711012 GGGGCTCTGCCACCTCCATGGGG - Intronic
1076783909 10:132739578-132739600 TGATCTCAGCCACTCCCAGAGGG + Intronic
1078171527 11:8932378-8932400 TGAGCCCTGCCTCGCCCCGGTGG - Intronic
1079344620 11:19641141-19641163 TTACCTCTGCCCCTCCCAGGTGG - Intronic
1079451702 11:20604267-20604289 TGTGCTTTTCCGCCCCCAGGAGG + Exonic
1081312553 11:41591927-41591949 TTAGCTCTGCCATCCTCAGATGG + Intergenic
1081850583 11:46272635-46272657 CCAGCTCTGCCAGCCCTAGGTGG + Intergenic
1083330929 11:61898038-61898060 TGGGTTCTGCCACCACCAGGAGG - Exonic
1083485520 11:62981100-62981122 TGAGCTCTGCCGGTCCCAGCAGG - Exonic
1083682234 11:64356997-64357019 TGAGATCTGCTTCCCTCAGGAGG - Intronic
1083841521 11:65307584-65307606 CCAGCTCTGCCACCCTAAGGGGG - Intergenic
1084647594 11:70467673-70467695 TGTGCTGTGCCGCCCCCCGGTGG - Intergenic
1085289109 11:75384652-75384674 TGTGCTCTGCCGCCCCCTAGCGG + Intergenic
1085640950 11:78192337-78192359 TGCACTCTGCCTCCCTCAGGAGG - Intronic
1089334139 11:117711175-117711197 TGAGCTCAGCCTGCCCCATGAGG - Intronic
1089348201 11:117805280-117805302 TGAGCTCTGCCACCCTCACTGGG - Intronic
1090470738 11:126978740-126978762 TGAGCTCTGTTCCCCCAAGGTGG + Intronic
1092160999 12:6315565-6315587 GGAGCTCTGCCACCAACAGGAGG + Exonic
1095481504 12:42640977-42640999 AGAAATCTGCCATCCCCAGGAGG + Intergenic
1096537700 12:52286071-52286093 TGGGCTCTGCCACCCCACAGTGG - Exonic
1098270252 12:68762941-68762963 TGAGCTCTGCCACTCTCTGTGGG + Intronic
1100307195 12:93361671-93361693 TGAGCTCCACCACCTCCAGCAGG + Intergenic
1100673862 12:96845599-96845621 AGGGCTCTGCCAACCCCATGGGG - Intronic
1102145945 12:110655284-110655306 TGAGCTCAGCAAGCACCAGGAGG + Exonic
1104755466 12:131266649-131266671 TGACCCCTCCCTCCCCCAGGGGG - Intergenic
1105009718 12:132747496-132747518 ACAGCTCTGCCACTCCCGGGAGG + Intronic
1105422689 13:20266835-20266857 TGAGCTCTCCCGGCCCCTGGTGG + Intergenic
1106259943 13:28057665-28057687 GGAGCTCTCCCACCCTCAAGGGG - Intronic
1106658320 13:31771328-31771350 TGAGCTCTGCCTCCTCCTGTCGG + Intronic
1107869775 13:44735754-44735776 TGGTATCTGCCAACCCCAGGAGG - Intergenic
1109181746 13:59222283-59222305 TGATTTCTGCAACCCTCAGGTGG - Intergenic
1113850705 13:113416035-113416057 TCAGCTCTGCCGCCGCCTGGGGG - Intergenic
1113877820 13:113605755-113605777 TGACTTCTGTGACCCCCAGGAGG - Intronic
1114082158 14:19210747-19210769 TGCCCTGTACCACCCCCAGGAGG + Intergenic
1119025093 14:71146173-71146195 TGAAGTCTGCCAGCCCCAGAGGG - Intergenic
1121723502 14:96129196-96129218 GGGGCTCTGCCACCCCCAAGGGG - Intergenic
1122624002 14:103075086-103075108 TGAACTCTGCCAGCCCAGGGCGG + Intergenic
1123035669 14:105470939-105470961 TGCCCTCTGCCCTCCCCAGGGGG + Intergenic
1123129673 14:105974878-105974900 TGTGCTCAGACACCACCAGGGGG + Intergenic
1123155412 14:106219795-106219817 TGAGCTCTGCCACTTGCAGATGG - Intergenic
1123402071 15:19996924-19996946 TGAGCTCTGCCACTTGCAGATGG - Intergenic
1123511414 15:21003588-21003610 TGAGCTCTGCCACTTGCAGATGG - Intergenic
1125499731 15:40232145-40232167 TGAGCTCTGCCTCCTGCAAGGGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127842184 15:62841130-62841152 TGAGCACTGGCTCACCCAGGGGG + Exonic
1128770341 15:70277212-70277234 TGAGCACTGCCATCCCCTGCAGG + Intergenic
1129305377 15:74657183-74657205 TTAGCTCTGCCATCCACAGATGG - Intronic
1132575900 16:663900-663922 AGAGCTCTTACACCCACAGGAGG - Intronic
1134671114 16:16055814-16055836 TCAGCTCTCCCACCCTCAGGAGG + Intronic
1135546358 16:23369603-23369625 TGACCTCTGCAACCACCAAGAGG + Intronic
1136396060 16:29993187-29993209 TGAGCTCTGCCACCCCCAGGAGG - Exonic
1137396235 16:48117708-48117730 TCAGCCCTGTGACCCCCAGGAGG - Intronic
1138273412 16:55712454-55712476 TGAGCACTACGACCACCAGGTGG + Intergenic
1140087436 16:71809281-71809303 TTAGCTCCGCCCCCTCCAGGTGG - Intergenic
1140670187 16:77270000-77270022 TACCCTATGCCACCCCCAGGTGG + Intronic
1141594855 16:85091010-85091032 AGAGCTCTCCTACACCCAGGTGG - Exonic
1141685096 16:85565656-85565678 TGGGCACTGGCATCCCCAGGAGG - Intergenic
1141988906 16:87598850-87598872 TGAACTCTGGGACTCCCAGGAGG + Intergenic
1141989248 16:87601291-87601313 TGAACTCTGGGACTCCCAGGAGG + Intergenic
1142104457 16:88294993-88295015 TGAGCCCTGCCACGTCCTGGGGG - Intergenic
1142104472 16:88295042-88295064 TGAGCCCTGCCACATCCTGGGGG - Intergenic
1142104487 16:88295091-88295113 TGAGCCCTGCCACGTCCTGGGGG - Intergenic
1142104503 16:88295140-88295162 TGAGCCCTGCCACGTCCTGGGGG - Intergenic
1142104519 16:88295189-88295211 TGAGCCCTGCCACGTCCTGGGGG - Intergenic
1142104535 16:88295238-88295260 TGAGCCCTGCCACGTCCTGGGGG - Intergenic
1142104551 16:88295287-88295309 TGAGCCCTGCCACGTCCTGGGGG - Intergenic
1142104566 16:88295336-88295358 TGAGCCCTGCCACGTCCTGGGGG - Intergenic
1142104582 16:88295385-88295407 TGAGCCCTGCCACGTCCTGGGGG - Intergenic
1142104598 16:88295434-88295456 TGAGCCCTGCCACATCCTGGGGG - Intergenic
1142104614 16:88295483-88295505 TGAGCCCTGCCACATCCTGGGGG - Intergenic
1142134425 16:88445049-88445071 TGTGTTCTGCCAGCACCAGGAGG + Intergenic
1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG + Intronic
1142304558 16:89278254-89278276 TGGGCTCTGCCTCCCCCATGAGG + Intronic
1142501741 17:336881-336903 GGTGCTGGGCCACCCCCAGGTGG - Intronic
1143164762 17:4892319-4892341 GGGGCTTTCCCACCCCCAGGCGG - Intronic
1143205673 17:5138255-5138277 GGGGACCTGCCACCCCCAGGTGG + Exonic
1144495712 17:15743498-15743520 TGGGACCTGCCACCCCCAGGTGG + Exonic
1144632777 17:16882440-16882462 TGGGGCCTGCCACCCCGAGGTGG - Intergenic
1144638486 17:16925326-16925348 TGGGACCTGCCATCCCCAGGTGG - Intergenic
1144947686 17:18978177-18978199 TGAGAACGGCCTCCCCCAGGGGG - Exonic
1145208423 17:20996617-20996639 TGGGACCTGCCACCCCCAGGTGG + Intergenic
1145254813 17:21316712-21316734 CGAGCTCTACCGCCCCCTGGCGG - Intergenic
1145321787 17:21771253-21771275 CGAGCTCTACCGCCCCCTGGCGG + Intergenic
1145761560 17:27428738-27428760 GGGGACCTGCCACCCCCAGGTGG + Intergenic
1145798141 17:27667638-27667660 GGGGACCTGCCACCCCCAGGTGG - Intergenic
1146062153 17:29613191-29613213 TGGGCTCCGCCACGACCAGGTGG + Intronic
1146161615 17:30562899-30562921 GGGGACCTGCCACCCCCAGGTGG + Exonic
1146842946 17:36167540-36167562 GGGGACCTGCCACCCCCAGGTGG - Exonic
1146855251 17:36255481-36255503 GGGGACCTGCCACCCCCAGGTGG - Exonic
1146865369 17:36332894-36332916 GGGGACCTGCCACCCCCAGGTGG + Exonic
1146871157 17:36379392-36379414 GGGGACCTGCCACCCCCAGGTGG - Exonic
1146882465 17:36451620-36451642 GGGGACCTGCCACCCCCAGGTGG - Intergenic
1146910886 17:36647751-36647773 TCAGCAGTGCCACCTCCAGGAGG + Intergenic
1147068230 17:37933488-37933510 GGGGACCTGCCACCCCCAGGTGG + Exonic
1147079761 17:38013043-38013065 GGGGACCTGCCACCCCCAGGTGG + Intronic
1147085564 17:38059554-38059576 GGGGACCTGCCACCCCCAGGTGG - Exonic
1147095702 17:38136985-38137007 GGGGACCTGCCACCCCCAGGTGG + Intergenic
1147101511 17:38183520-38183542 GGGGACCTGCCACCCCCAGGTGG - Intergenic
1147316318 17:39622079-39622101 TGCCCTCTGGCGCCCCCAGGTGG - Intergenic
1147325030 17:39665992-39666014 TGATCTCAGCCACCTCCTGGCGG - Exonic
1147430888 17:40370162-40370184 TGACTTCTGCCACCCCAGGGTGG + Intergenic
1148573148 17:48686705-48686727 TGGGCTCAGCCTCCGCCAGGAGG - Intergenic
1149237311 17:54607420-54607442 TTAGCTCTGCCATCCACAGATGG - Intergenic
1149846110 17:60010026-60010048 GGGGACCTGCCACCCCCAGGTGG - Intergenic
1149850247 17:60029794-60029816 GGAGCTCTGCCAAACCAAGGTGG + Intergenic
1149859919 17:60116730-60116752 GGAGCTCTGCCAAACCAAGGTGG - Intergenic
1150084459 17:62266606-62266628 GGGGACCTGCCACCCCCAGGTGG - Intergenic
1150855174 17:68745472-68745494 TCAGCTTTGCCACCTGCAGGTGG - Intergenic
1151477416 17:74352043-74352065 TGCGCTCCGCCACCGCCACGAGG + Exonic
1151519694 17:74619124-74619146 TGGGATGTGCCACCTCCAGGAGG - Intronic
1151742242 17:75991559-75991581 GGAGCCCTTCCACGCCCAGGTGG + Exonic
1153525546 18:5991843-5991865 TGAGCCCAGCCAACCCCAGGAGG + Intronic
1153681423 18:7504657-7504679 TTAGCTCTGCCATCCACAGACGG + Intergenic
1155218957 18:23667302-23667324 TCTGCTCTGCCACCTTCAGGGGG - Intergenic
1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG + Intergenic
1160492985 18:79353432-79353454 GCAGCTCTTCCACCCCCTGGTGG - Intronic
1161137100 19:2626300-2626322 GGATCTCTGCCACCCACAGGAGG + Intronic
1161444485 19:4310705-4310727 AGAGCTCCACCTCCCCCAGGCGG - Intronic
1162013579 19:7831684-7831706 TGATTTATGCCACCCCCTGGCGG + Intronic
1162385454 19:10358063-10358085 TGCCCTCTGCCAACCCCAGCCGG + Exonic
1162500396 19:11050268-11050290 AGAGCTCTGGCCCCACCAGGCGG + Intronic
1163234761 19:16023850-16023872 TGAGTCCTGCTACCCCCAGGTGG + Intergenic
1163522625 19:17800464-17800486 TGTCCTCTGCCACTCCCAGGGGG - Intronic
1163862321 19:19748790-19748812 TGGGATCTGCCACCCCCTCGTGG + Intergenic
1167742365 19:51331444-51331466 TCTGCTCTGCCACCCTCAGTGGG - Intergenic
925332283 2:3067952-3067974 TGAGGACTGTCATCCCCAGGAGG + Intergenic
926076724 2:9948980-9949002 TGAGCTCAGCCTCCCCTTGGCGG - Intergenic
926163009 2:10501511-10501533 GGGGCTTTGACACCCCCAGGAGG + Intergenic
926592288 2:14752282-14752304 TGAGCCTTGCCACCCACAGCTGG + Intergenic
927519486 2:23690343-23690365 TGGGCTCTGCCACCCACAGGTGG - Intronic
928593559 2:32840246-32840268 TGTGACCTGGCACCCCCAGGTGG + Intergenic
928860006 2:35846198-35846220 TTAGCTCTGCCATCCACAGATGG + Intergenic
929897304 2:45973262-45973284 TCAGCACTGTCACCCACAGGTGG - Intronic
931694964 2:64864837-64864859 TTAACTCTGCCAATCCCAGGAGG + Intergenic
932505011 2:72220401-72220423 TCATCTCTGCTGCCCCCAGGGGG - Intronic
933420937 2:82044011-82044033 TGCTCTCTGCCAGCACCAGGTGG + Intergenic
934113756 2:88765380-88765402 TGAGCCCCGCCAGCCCCAGCCGG + Intergenic
936854208 2:116937073-116937095 TGAGCTCTCCCACTCCCAGGTGG - Intergenic
937290968 2:120781425-120781447 TGTGCTCCGCCAGTCCCAGGGGG - Intronic
938244154 2:129764528-129764550 CCAGCTCTGCCACCCACTGGTGG - Intergenic
938494424 2:131785853-131785875 TGCCCTGTACCACCCCCAGGAGG - Intergenic
938942442 2:136180938-136180960 TTAGCTCTGCCATCCACAGATGG + Intergenic
944001414 2:194842916-194842938 TCAGCTCTGCCATCCACAGATGG - Intergenic
946195697 2:218032149-218032171 TGGGCCCTGCCCCTCCCAGGTGG - Intergenic
948708942 2:239813402-239813424 GGAGCCCTGCCATTCCCAGGAGG + Intergenic
1170827419 20:19808762-19808784 CTAGCAATGCCACCCCCAGGGGG - Intergenic
1170904394 20:20499670-20499692 GTAGTACTGCCACCCCCAGGAGG + Intronic
1172623581 20:36334928-36334950 GGCGTTCTGCCACCCCCGGGGGG - Intronic
1172629238 20:36367106-36367128 GGGGCTCTGCCACCGCCCGGGGG - Exonic
1173150893 20:40565794-40565816 TGAGCTCTGACAGCCCCACAAGG - Intergenic
1173177587 20:40776285-40776307 TGTGCTCTGCCACACCTGGGTGG - Intergenic
1173722219 20:45269322-45269344 TGTTCTCTGCCTCCCACAGGAGG + Intergenic
1174173175 20:48629486-48629508 GGAGCTCTGCTACCGCCTGGGGG - Exonic
1174412850 20:50347043-50347065 CGAGCTCAGCCACCTCAAGGCGG - Intergenic
1174550095 20:51355987-51356009 TGAGCTCTGAGACCCCATGGGGG + Intergenic
1176142950 20:63553307-63553329 TGAGCTTGGGCAGCCCCAGGTGG + Intronic
1176522712 21:7836834-7836856 TGTGCTCAGGCACCCCCAGGTGG - Intergenic
1176711681 21:10155359-10155381 TGTCCTGTACCACCCCCAGGAGG - Intergenic
1178405404 21:32319193-32319215 TGAGTCCTGCCCCCGCCAGGGGG - Intronic
1178656732 21:34466846-34466868 TGTGCTCAGGCACCCCCAGGTGG - Intergenic
1178976819 21:37227570-37227592 TGAGCTCTGTGACCCACAGCAGG + Intronic
1179417200 21:41208366-41208388 TGCCCTCTCCCACCCCCAGAAGG - Intronic
1179536967 21:42059151-42059173 TCAGCCCTGCCACTCCCTGGAGG + Intergenic
1179657487 21:42854206-42854228 TCAGCACCGCCAACCCCAGGGGG + Intronic
1180498616 22:15911923-15911945 TGCCCTGTACCACCCCCAGGAGG - Intergenic
1180649829 22:17369152-17369174 GGAGCTCTCCCACCCCCACTTGG - Intronic
1180937755 22:19637299-19637321 TGTGCTCTGCCATCCTCAGCTGG + Intergenic
1181167283 22:20990632-20990654 TGAGCTCTGCAAACAGCAGGAGG + Intronic
1181573999 22:23782536-23782558 GGAGCCCAGCCACCACCAGGTGG - Intronic
1183037415 22:35150690-35150712 TGAGCTCTGGCTCCCCCTGGTGG + Intergenic
1183305622 22:37081606-37081628 TGAGCACTTCCACCCCCGTGTGG + Intronic
1183467495 22:37986982-37987004 GGACCCCTGCCACCCCCAGCAGG - Intronic
1183528265 22:38336852-38336874 TTATCTCTGCCACCACCAGCAGG - Intronic
1184111282 22:42397022-42397044 TGAGATCTGGCACCGCCAGGTGG - Intronic
1184242706 22:43219796-43219818 TGAGGTCTGCCCCCCACGGGAGG - Intronic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184984387 22:48119456-48119478 GGTGCTGTGGCACCCCCAGGTGG - Intergenic
1185046864 22:48532966-48532988 CAAGCTCTACCACCCACAGGCGG - Intronic
950508956 3:13414275-13414297 TGAGCTCTGTCAGCCCCACGAGG - Intronic
952968115 3:38633421-38633443 CCAGCACAGCCACCCCCAGGAGG - Intronic
953289779 3:41649569-41649591 TGAGCACGGACACCCCCAGCTGG - Intronic
954073224 3:48158289-48158311 GGTGCTCTGTCACCCCCAGGAGG - Exonic
954403262 3:50330561-50330583 TGACCTCTTGTACCCCCAGGTGG - Exonic
954444124 3:50537479-50537501 TGAGTTCTGCCTCCTCCAGGAGG - Intergenic
955798207 3:62659758-62659780 TGAGCTCTTCTTCACCCAGGTGG - Intronic
956111987 3:65878992-65879014 TGATCACTGCAACCCCCAGCAGG - Intronic
956364214 3:68482423-68482445 TCAGCACTGCCAACCCCATGTGG - Intronic
956740567 3:72272470-72272492 ACAGCTCTGCCACACCCAGCTGG - Intergenic
959445356 3:106432819-106432841 TGAGCCCTGCCACTGTCAGGAGG - Intergenic
959575001 3:107924997-107925019 TTAGCTCTGCCATCCACAGATGG + Intergenic
960227820 3:115187200-115187222 GGAGGTCTACCACCTCCAGGAGG - Intergenic
960970220 3:123134346-123134368 TGACCTGTGCCACCCCAGGGGGG + Intronic
963813863 3:149808405-149808427 TGAGCTCTGCCACCTAGTGGAGG + Intronic
966163644 3:176992805-176992827 CGCGCTCTGCCACCTCCCGGGGG + Intergenic
966770500 3:183499677-183499699 GGAGCTTGGCCACCTCCAGGCGG + Exonic
968595607 4:1480888-1480910 GGGGCTTTGCCACCCCCAGTGGG - Intergenic
969490927 4:7498873-7498895 AGAGCCCTGTCACCCCCAGCAGG + Intronic
969503956 4:7571879-7571901 TCAGCTCTGGCACCGCGAGGGGG - Intronic
974061270 4:57038179-57038201 TAAGCTCTGGCTCCCCCATGCGG - Intronic
982918434 4:161244450-161244472 TTAGCTCTGCCATCCGCAGATGG + Intergenic
983565803 4:169150615-169150637 TGACCTACGCTACCCCCAGGGGG + Intronic
985587804 5:749992-750014 TGAGCTTTGCCAGCTCCACGTGG - Intronic
985602469 5:842459-842481 TGAGCTTTGCCAGCTCCACGTGG - Intronic
987211018 5:15683412-15683434 TGCTCTCCGTCACCCCCAGGCGG + Intronic
988315614 5:29623031-29623053 TAAGCTCTAACACCCACAGGTGG - Intergenic
995534858 5:113124931-113124953 TGAGCGCTGCTCCACCCAGGAGG - Intronic
1001660091 5:173384706-173384728 TGATCTCTGCAACACCCAGCTGG - Intergenic
1001731799 5:173965699-173965721 TGAGCTCTGTCAAGCTCAGGTGG + Intergenic
1001741186 5:174054052-174054074 TGAGCTCTGGCACACGCATGTGG + Intronic
1001869214 5:175136004-175136026 TGTGCTCAGCCCCCCTCAGGCGG - Intergenic
1002337390 5:178489313-178489335 TGGACTCTGCAACCCCCTGGGGG + Intronic
1002494431 5:179602159-179602181 TGATCTCTGCTACCCACATGGGG + Intronic
1003412449 6:5877493-5877515 TGAACTCTGCCCCCTCTAGGTGG + Intergenic
1004491067 6:16116940-16116962 TGGGCTCTGTCACCCCAAGCTGG + Intergenic
1006334938 6:33415514-33415536 TGAGCTCTGCACTTCCCAGGGGG + Intronic
1006375448 6:33669239-33669261 TGAGCTCTGACAGCCTCAGGTGG + Intronic
1006435737 6:34025304-34025326 AGAGCTCCGTCACCCCCTGGGGG + Intronic
1006507119 6:34496415-34496437 TGATCTCTGCCAGCCTGAGGCGG + Intronic
1006509361 6:34513542-34513564 AGACTTCTGCCACCCCCAGGAGG - Intronic
1006841292 6:37029434-37029456 TGACCACTGCCACCCCCTGGTGG - Intergenic
1007512138 6:42381761-42381783 TGGGCTCTGCTTCTCCCAGGAGG - Intronic
1007584058 6:42978277-42978299 TGAGCTCTCCCATTTCCAGGGGG + Exonic
1008192442 6:48476041-48476063 TGAGCTCCCCCACACCCAGGTGG - Intergenic
1008215455 6:48782679-48782701 TCAGCTCTGCCATCCTCAGATGG + Intergenic
1011491798 6:87900588-87900610 TTAGCTCTGCCATCCACAGATGG + Intergenic
1013122391 6:107152159-107152181 AGAGCTCTGCCTCCCCCACAGGG - Intergenic
1016998629 6:149979212-149979234 AGAGCACAGGCACCCCCAGGAGG - Intergenic
1017747015 6:157456154-157456176 TGACCTCTGCCTCCCCGAGGAGG + Intronic
1018972073 6:168536712-168536734 TGGGCTGTGCCACCCCCTGGGGG + Intronic
1019314239 7:377208-377230 TGTCCTCTGCCACACTCAGGGGG - Intergenic
1019631759 7:2053294-2053316 TGTGCTCTGCCCCCGCCCGGAGG - Intronic
1019811094 7:3165576-3165598 GGGCTTCTGCCACCCCCAGGAGG - Intronic
1020153482 7:5702133-5702155 TGGGCTCTGCCACCTGCCGGGGG + Intronic
1020820306 7:12958678-12958700 TGATCTCTGCCAGCCTCAGTGGG + Intergenic
1022160556 7:27706361-27706383 TGACCTCCACCACCCCCAGAGGG + Intergenic
1025943899 7:66092132-66092154 TGAGCTCCCCCACCCTCTGGGGG - Intronic
1026831515 7:73613077-73613099 AGGGCTCTGCCACCCCCTGCAGG - Intronic
1027996184 7:85427662-85427684 TGAGTTCTCCCAGGCCCAGGTGG - Intergenic
1028250910 7:88539454-88539476 TGAGCTCAGACACCACCAGGTGG - Intergenic
1029112983 7:98222998-98223020 TGAGCTCCGACACGCCCAGGCGG + Exonic
1029427175 7:100503105-100503127 TGACCTCTGCCACCACCCTGGGG + Intergenic
1029467740 7:100736790-100736812 TGGGCTCTGCCTCCCCCAGAGGG + Exonic
1030117637 7:106074269-106074291 TTAGCTCTGCCATCCGCAGATGG - Intergenic
1031693478 7:124818891-124818913 TTAGCTCTGCCATCCGCAGATGG - Intergenic
1032197288 7:129796653-129796675 TCAGCTCTGCCACAGGCAGGTGG - Intergenic
1032946356 7:136857551-136857573 TGAGCTTTGCCAAACCCAGCTGG - Intergenic
1034498398 7:151435325-151435347 TCAGCTGTGCCACTCCCACGGGG + Intronic
1037404156 8:18523579-18523601 TGAGCTCTGTCACCCAGAGTGGG - Intergenic
1042184511 8:66123357-66123379 TGACCTGTGACAGCCCCAGGAGG - Intergenic
1048047498 8:130786669-130786691 TGAGCTCTACCAACCCAAGTAGG + Intronic
1049366100 8:142237585-142237607 TCATCTCTGCCATCCTCAGGAGG - Intronic
1049684976 8:143935702-143935724 TGAACTCCACCACCCCGAGGCGG + Intronic
1050182036 9:2933285-2933307 TGGGCCCAGCCACCCCCTGGAGG + Intergenic
1052823684 9:33159700-33159722 ACAGCTCTCCCACCTCCAGGTGG - Intronic
1053648672 9:40141050-40141072 TGTCCTGTACCACCCCCAGGAGG - Intergenic
1053757074 9:41322792-41322814 TGTCCTGTACCACCCCCAGGAGG + Intergenic
1054329654 9:63738991-63739013 TGTCCTGTACCACCCCCAGGAGG - Intergenic
1054535911 9:66235120-66235142 TGTCCTGTACCACCCCCAGGAGG + Intergenic
1054702472 9:68427148-68427170 TAAGCTCTTCCACTGCCAGGGGG - Intronic
1056804815 9:89720290-89720312 TGAGATCTGTCTCCCACAGGGGG - Intergenic
1058905124 9:109476674-109476696 TCTGCTCTGCCACTCCCAAGTGG + Intronic
1060415129 9:123424642-123424664 TGGGCTCTCCCCACCCCAGGTGG - Intronic
1060666769 9:125436483-125436505 TGGGCTCTGCCCTCCACAGGTGG - Intergenic
1061808101 9:133147671-133147693 TGGGCACTGCCTCCCCCTGGTGG + Intronic
1062070245 9:134551467-134551489 TGCCCTCTGCCCCCTCCAGGTGG - Intergenic
1062186660 9:135222022-135222044 TGTGCTCTCCCTCCCCCAGTTGG + Intergenic
1062398898 9:136363829-136363851 TGCGCTATGCCGCCCCCTGGCGG + Intronic
1062454235 9:136628280-136628302 TGAGCTCTGGCATCCCCTGCGGG - Intergenic
1062572148 9:137190639-137190661 TGTTCTCTGCCACACCCTGGTGG + Intergenic
1062711693 9:137978317-137978339 GGAGCACTTCCCCCCCCAGGAGG + Intronic
1202796436 9_KI270719v1_random:124348-124370 TGTCCTGTACCACCCCCAGGAGG - Intergenic
1185769758 X:2756907-2756929 TTAGCTCTGCCATCCGCACGTGG + Intronic
1186448726 X:9654472-9654494 GGAGCTGTGCCATCCCCGGGTGG + Intronic
1187324505 X:18274129-18274151 TTAGCTCTGCCATCCACAGATGG - Intronic
1190414439 X:50167245-50167267 TTAGCTCTCCCTCCCCCAGAAGG + Intergenic
1195475864 X:105284530-105284552 GGAGGTCTGCCACCAACAGGAGG + Intronic
1197167491 X:123393945-123393967 TGAGCTCTGCCAGCTCCATTGGG - Intronic
1197506921 X:127317326-127317348 TGAGCTCAGCCAATCACAGGTGG - Intergenic
1199847284 X:151700592-151700614 TCAGCAGTGCCACCCCCAGAAGG - Exonic
1200083447 X:153591125-153591147 TGAGCTCTGCAGCACCCGGGTGG + Intronic
1200157618 X:153985600-153985622 GGAGCTCGGCCTCGCCCAGGGGG + Intergenic
1200236723 X:154471329-154471351 TGCCCTCTGCCACCCACAGCAGG - Intronic
1201155276 Y:11127014-11127036 TTAGCTTTGCCATCCACAGGCGG + Intergenic
1201300760 Y:12502725-12502747 TTAGCTCTGCCATCCGCACGTGG - Intergenic