ID: 1136397532

View in Genome Browser
Species Human (GRCh38)
Location 16:30001329-30001351
Sequence AAATGCAAACAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 848
Summary {0: 1, 1: 0, 2: 8, 3: 66, 4: 773}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136397532_1136397535 -2 Left 1136397532 16:30001329-30001351 CCATCCTCCTTCTGTTTGCATTT 0: 1
1: 0
2: 8
3: 66
4: 773
Right 1136397535 16:30001350-30001372 TTCTTCCCCCACCCTCACCCCGG 0: 1
1: 0
2: 6
3: 50
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136397532 Original CRISPR AAATGCAAACAGAAGGAGGA TGG (reversed) Intronic
900027226 1:286259-286281 AAAAACACACATAAGGAGGAGGG + Intergenic
900471398 1:2856752-2856774 AAATGGAAAGAGAAGAAGGGAGG - Intergenic
900828095 1:4942553-4942575 AAATGCAAACATACGGCAGATGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902132239 1:14272320-14272342 AAATGCAAACAGAAGCAGCCAGG + Intergenic
902894145 1:19467341-19467363 TAAAGCAAACAGAAGGGAGAAGG + Intronic
903291409 1:22316495-22316517 AAATGCATACAGAAGGCTGGTGG - Intergenic
903530378 1:24025748-24025770 AGAGGCAAACAGAAGAAGGATGG - Intergenic
903877766 1:26487305-26487327 AAATGCCAACACACTGAGGATGG + Intergenic
904342040 1:29842268-29842290 AAAGGCAATCAGAAAAAGGATGG + Intergenic
904344411 1:29858540-29858562 AAAAGCAAGCAGGAGGAGAAAGG + Intergenic
904596610 1:31650292-31650314 AAATGAAGACAGAAGGATAATGG + Intergenic
904907673 1:33910255-33910277 AAATGAACACAGGAGGAGCATGG - Intronic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905131925 1:35767887-35767909 AAATAAAAACCTAAGGAGGAGGG + Intronic
905908376 1:41636239-41636261 AAATGGGTACAGAATGAGGAAGG + Intronic
906466836 1:46089263-46089285 GAATTCAAACAGGAGGATGAAGG + Intronic
906508797 1:46399201-46399223 AAAACAAAACAGATGGAGGAGGG + Intronic
906749347 1:48245201-48245223 AACTGCCAAGAGAAGGAGGAAGG + Intronic
906958606 1:50398923-50398945 AAAAGCAAGAAGAAGAAGGAAGG - Intergenic
907114004 1:51952728-51952750 AAATGAAAATAAAAGAAGGATGG + Intronic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
908100296 1:60784183-60784205 AATTGTAAACAGAAGGAACAAGG - Intergenic
908334740 1:63110335-63110357 AATTGCAAATAGAAATAGGAAGG - Intergenic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
908532822 1:65049794-65049816 CAATGCTAAGAGAAGGAGGCAGG - Intergenic
909219353 1:72935428-72935450 AAACTCCAACAGAAAGAGGAAGG - Intergenic
909559497 1:76993820-76993842 AATTGAAAACAGAAGGAATATGG - Intronic
909765537 1:79351490-79351512 AAATGCAAACATAAAGAAGCAGG + Intergenic
909813653 1:79962762-79962784 AAAGGAAAAGAGAAGGAGAAAGG + Intergenic
909899794 1:81118623-81118645 AAATGCAAACTGAACCATGAAGG - Intergenic
909942964 1:81632399-81632421 AATTTCAAACAGAGGGAAGAAGG + Intronic
910254793 1:85237222-85237244 TAATGAAAACAGAAGGGGAAAGG + Intergenic
910707635 1:90146679-90146701 AAAAGGAAAAAGAAGGAAGAGGG + Intergenic
911620390 1:100060651-100060673 AAATGCAAGCAGAGGTGGGATGG - Intronic
911632951 1:100202974-100202996 AAATGCCAACAGAAGAAAGCAGG + Intronic
911733737 1:101315330-101315352 ACATGGAAACAGTAGGAGGCAGG - Intergenic
912002335 1:104849932-104849954 AAATGCAAATATAAGTAGTAGGG - Intergenic
912132122 1:106616460-106616482 AAATGCATACAGTTTGAGGAGGG + Intergenic
912207444 1:107524090-107524112 AAAAGAAGACAGAAGGGGGAAGG - Intergenic
913380595 1:118206473-118206495 AAATGCAAAAAGAAGTCAGATGG + Intergenic
913426922 1:118742229-118742251 AAATGTTAACACAAGGAAGAAGG - Intergenic
913691525 1:121284299-121284321 AAATGCAAAAAGTAGGAGCATGG + Intronic
913939860 1:125091637-125091659 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
913979215 1:143493455-143493477 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914043606 1:144072789-144072811 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914073618 1:144319105-144319127 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914105537 1:144647255-144647277 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
914134481 1:144887702-144887724 AAAAGTAAAAAGGAGGAGGAGGG + Exonic
914146021 1:144995682-144995704 AAATGCAAAAAGTAGGAGCATGG - Intronic
914444140 1:147735450-147735472 AGATGGAAACAGAAGCAGAATGG + Intergenic
914774212 1:150721022-150721044 AAAGCCAGACAGAAGGGGGAAGG + Intergenic
914922652 1:151858055-151858077 AAATTCATACAGAAGGAGAAGGG - Intergenic
916189404 1:162164551-162164573 AAATTCATAGAGATGGAGGATGG - Intronic
916195194 1:162215875-162215897 AAATGCTAACAAAAGAAGCATGG - Intronic
916959935 1:169879148-169879170 AAATGCAAACAGATTATGGAGGG + Intronic
917600277 1:176566733-176566755 AAGTGCAAAAAGGAGGAGGCAGG - Intronic
917621114 1:176796904-176796926 AAAAGAAAATAGAGGGAGGAAGG - Intronic
918421024 1:184364291-184364313 AAAAGCTAACACAATGAGGATGG + Intergenic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
919107896 1:193176887-193176909 AAATGCAAACAGCAGGCAGGTGG - Intronic
919972894 1:202592150-202592172 GAATTCAAACAGTGGGAGGAAGG + Exonic
920206959 1:204299246-204299268 GAAAGCAAACAGGAGGAAGAAGG + Intronic
920478852 1:206302777-206302799 AAATGCAAAAAGTAGGAGCATGG + Intronic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
920887064 1:209938809-209938831 AACAGCAAACAGAAGGGGAACGG - Intronic
921260008 1:213377988-213378010 TAATGCAAATAGCAGGAGCAAGG + Intergenic
922026109 1:221750637-221750659 AATTGCAAACTGAAGCATGAAGG - Intergenic
922034759 1:221837561-221837583 TAATGCAACAAGAAGGATGAAGG - Intergenic
922151315 1:223007249-223007271 AAATGCTGTCAGAAGCAGGAAGG + Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
923676400 1:236084257-236084279 CAATGCAAACAGATAAAGGAAGG + Intergenic
924160010 1:241221145-241221167 AAAAGAAAACAAAAGAAGGAAGG + Intronic
924201381 1:241662871-241662893 CAATGCAAACAGAAGGGAAAAGG + Intronic
924431630 1:244002002-244002024 AAATGGACACACAAAGAGGATGG - Intergenic
924828736 1:247570321-247570343 AAATGCAAACAGAAGAAAGCGGG - Intronic
924876457 1:248110564-248110586 TTATGCCAACAGAAGGAGAAGGG + Intergenic
1062961694 10:1577270-1577292 TCATGCACACAGAAGGTGGATGG + Intronic
1062983993 10:1749636-1749658 AAATGCAGAGAGAAAGAGGAAGG + Intergenic
1063289984 10:4735195-4735217 AGCTGCAAACTGAAAGAGGAAGG - Intergenic
1063462281 10:6222314-6222336 AAATGTAAAAAGAAGCAGGAGGG - Intronic
1064336212 10:14445069-14445091 AAATGGAAATAAAAGGAAGAAGG + Intronic
1064858895 10:19803268-19803290 AAATCCAACCAGAAAGAGTATGG + Intergenic
1064982876 10:21181776-21181798 AGATGCCAAGAGAAGCAGGAGGG - Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066079174 10:31912588-31912610 AAAGGCAATGAGAAGTAGGAGGG + Intronic
1066780275 10:38938148-38938170 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1066956023 10:42173434-42173456 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1067130047 10:43555774-43555796 AAATGAATACATAAGGAGCAGGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067945117 10:50684357-50684379 ACCTGGAAACAGAAGGAAGAAGG - Intergenic
1068219464 10:54025854-54025876 AAATGGAAAAAGATGGAGGGAGG - Intronic
1068439838 10:57038241-57038263 AAATACAAACAGTTGGAAGAGGG + Intergenic
1069940150 10:71949677-71949699 AAATGCTAAAAGGAGGAAGAGGG + Intergenic
1070272116 10:74966209-74966231 AAATGGCAAAAGGAGGAGGAAGG - Intronic
1070473316 10:76806510-76806532 AAATGCAAACAAAAGAAAAAAGG - Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1070866622 10:79711229-79711251 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1070880411 10:79849350-79849372 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071633534 10:87233452-87233474 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071646981 10:87365668-87365690 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071948552 10:90676498-90676520 TAATGGAAACAGAAGGGAGAAGG - Intergenic
1072042609 10:91623316-91623338 AAATGCAAATGATAGGAGGATGG + Intergenic
1072096058 10:92181479-92181501 AATGGCAACCAGAAGGAAGACGG + Intronic
1072429724 10:95360139-95360161 AAATGCAACCAAAGGGAAGAGGG - Intronic
1072444573 10:95487519-95487541 AAAGGCAGTCAGACGGAGGAAGG + Intronic
1073325876 10:102643848-102643870 AAATAGAAACGGAAGGGGGAGGG - Intergenic
1073643864 10:105279431-105279453 AAATGAAGAAAGAAGGAGGGAGG - Intergenic
1074792145 10:116900490-116900512 AAAGGCAGACAAAAGGAGGAAGG + Intronic
1074934810 10:118167379-118167401 AAAGCCAAACAGGAGGAAGATGG - Intergenic
1074967465 10:118504045-118504067 AAAAGTAAACAGAGGAAGGAAGG + Intergenic
1075120029 10:119658210-119658232 AAATTCATACAGTGGGAGGATGG + Intronic
1075344495 10:121672193-121672215 AAATGGATAGAGAAGAAGGAAGG - Intergenic
1075345914 10:121681880-121681902 AAAGGCACACAGAGGCAGGATGG - Intergenic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1075866353 10:125723645-125723667 ACATGCAAACACACAGAGGACGG - Intronic
1076021408 10:127076817-127076839 AAATGCCACCAGGAGGAAGAAGG - Intronic
1076358534 10:129870188-129870210 AAATACAGGCAGAAGGAAGATGG - Intronic
1076642823 10:131930400-131930422 AAAAGCCAAGAGAAGGAAGATGG - Intronic
1079132560 11:17756030-17756052 AAGTGCAAGAAGAAGGAGGGAGG + Intronic
1079231193 11:18650152-18650174 AAAAGCATAAAGAAAGAGGAAGG + Intergenic
1079251780 11:18792200-18792222 ACAGGCAGACAGAAGGAGTAGGG + Intronic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079421922 11:20301457-20301479 AAATGCAAACCAAAGCAAGAAGG - Intergenic
1080524781 11:33104170-33104192 AAAGACAAACAGAAGTAGCAAGG + Intronic
1080566826 11:33517375-33517397 TAATGCAAACATAAAGATGAAGG + Intergenic
1080871282 11:36239384-36239406 AACAGCAAACAGAAAAAGGAGGG - Intergenic
1081385333 11:42465402-42465424 AAATGCAATCAGAAAAAGCAAGG - Intergenic
1081698095 11:45132619-45132641 GAATGGAAACAGAAGTAGAAAGG - Intronic
1081760975 11:45576328-45576350 ACAAGCAAAGAGAAGGAGGCTGG + Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1082733698 11:56831760-56831782 AAATACAAGAAGGAGGAGGAAGG + Intergenic
1083118547 11:60489368-60489390 AAAGGCCAACAGGAGAAGGAAGG + Intergenic
1083323427 11:61861504-61861526 ATATGGAAACAAAATGAGGATGG - Intronic
1083418533 11:62540671-62540693 AAATAAAAAAAGAAGGAGCAGGG + Intronic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1084061302 11:66677271-66677293 ACATGCAAACAGGAGGTCGAGGG + Exonic
1084467118 11:69330550-69330572 GAAAGAAAAAAGAAGGAGGAGGG - Intronic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085629043 11:78097686-78097708 AACTGCAAACAGAAGCTGCATGG + Intergenic
1085760770 11:79239320-79239342 AAATACAACCAGAAGGAAAAGGG + Intronic
1085791559 11:79501396-79501418 ATAAGCAAACAGAAGCAGGGCGG - Intergenic
1085816133 11:79739198-79739220 AGATGAAATGAGAAGGAGGAGGG - Intergenic
1086371315 11:86158166-86158188 AAGTCCAAACAGAAGGGTGATGG + Intergenic
1087183964 11:95166819-95166841 AAATGTGAAGAGAAAGAGGAAGG + Exonic
1087278592 11:96185018-96185040 AAATCTAAACAGTATGAGGAAGG - Intronic
1087403897 11:97704568-97704590 AAATGCACACTGAAGCATGAAGG + Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1087820791 11:102709737-102709759 ACAGGCAGAAAGAAGGAGGAAGG + Intergenic
1088080580 11:105906921-105906943 AAATGCTAACAGATGGACAAAGG + Intronic
1088332994 11:108672277-108672299 GAATGCCTACAGAAGGAGGCAGG - Intronic
1088401347 11:109424289-109424311 AAATGGAAAAGGAAGGAAGAAGG - Exonic
1088843184 11:113643776-113643798 AAATGCAGAGAGGAGGAAGAAGG - Intergenic
1088868418 11:113870879-113870901 AAAAGCAAACAAGAGGAGGAAGG + Intronic
1089431363 11:118427364-118427386 AGCTGCAAAAAGAAGGAGAAGGG - Intronic
1089636637 11:119818098-119818120 AAAAGGAAACAGCAGCAGGAAGG + Intergenic
1089853046 11:121516719-121516741 AGAACCAAACAGAAGGAGGTAGG - Intronic
1089960944 11:122616891-122616913 AAATGCTGGCAGGAGGAGGAAGG - Intergenic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1092212090 12:6652926-6652948 AAAGGCAAAAAGAGTGAGGAGGG - Exonic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1092828840 12:12424134-12424156 AAAGGAAAACAGAAAGAGAAAGG - Intronic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1094492348 12:30968949-30968971 AAATGGCAACACAAGGAGGCAGG - Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096366567 12:51033267-51033289 AAAAAAAAAAAGAAGGAGGAGGG - Intergenic
1096472055 12:51885225-51885247 AAATGCAAACAGAAGTCTGATGG - Intergenic
1096638350 12:52975475-52975497 GAATGCAGACAGAAGGATGGAGG - Intergenic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1097959706 12:65520531-65520553 AAATGCAGAAAGAAGGAGAGAGG - Intergenic
1098051737 12:66461505-66461527 CAATGCAAACAGCTGTAGGAAGG - Intronic
1098724817 12:73950104-73950126 AAATGATCACAGCAGGAGGATGG - Intergenic
1098805413 12:75015954-75015976 AAAGGGAAAAAAAAGGAGGAGGG + Intergenic
1098809446 12:75067782-75067804 TTATGAAAACAGAAGGAGGCAGG - Intronic
1099016148 12:77346558-77346580 AAATCCTAACAGAAGAAAGAAGG + Intergenic
1099349965 12:81554162-81554184 AAATGGCAACAGTAGGAAGAAGG + Intronic
1099505950 12:83476215-83476237 AAATGTAAACAGAAAGAGACAGG - Intergenic
1099732512 12:86523909-86523931 AAATGAAAACAGAAGAAAGCAGG - Intronic
1100293402 12:93237972-93237994 AAATGGAAACAAAGGAAGGAAGG + Intergenic
1100342228 12:93690297-93690319 CAATCCAAAAAGAAGAAGGATGG - Intronic
1100578227 12:95913089-95913111 AAATGCAAATAGAAATAGAAAGG + Intronic
1101260255 12:103021983-103022005 AAGTGCAGAGTGAAGGAGGATGG - Intergenic
1101543763 12:105690102-105690124 AAATGAAAAAAGAAAAAGGAAGG - Intergenic
1101843149 12:108342106-108342128 AGATGAAAAGAGGAGGAGGAAGG + Intergenic
1102059243 12:109920394-109920416 AAATGCTTACAGTAGGAGGCTGG + Intronic
1103152050 12:118649288-118649310 AAATTCAAACAAAAGGAAGAGGG - Intergenic
1104038737 12:125115811-125115833 GACTGCACACAGATGGAGGACGG + Intronic
1104998711 12:132674907-132674929 AAATGCCAACAGAAGGAGGCTGG - Intronic
1105391103 13:19979035-19979057 AAGTGCTAACAGAAAGAGGGGGG - Intronic
1105468631 13:20671380-20671402 AAGTGCCACGAGAAGGAGGATGG + Intronic
1106087352 13:26555507-26555529 AAATGCAAGCAGAAGGTGCTGGG + Intergenic
1106216483 13:27706448-27706470 AAATGAAAAAAGAGGGAGGCAGG - Intergenic
1107159385 13:37208531-37208553 ATATGCAACCTGAAGCAGGACGG - Intergenic
1107333094 13:39322747-39322769 AAAGGAAGAGAGAAGGAGGAAGG + Intergenic
1107392130 13:39976834-39976856 AAATGCAGACAGATGATGGAGGG - Intergenic
1107584565 13:41830891-41830913 AAAAGAAAAGAGGAGGAGGAAGG + Intronic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108995047 13:56720048-56720070 AAATGCAAACATAACTTGGATGG - Intergenic
1109299384 13:60575185-60575207 AATTAAAAACAGAAGAAGGAAGG + Intergenic
1109775654 13:67038022-67038044 AAATGAAAATAGAAAGATGAGGG + Intronic
1109809572 13:67494067-67494089 AAATGGAAAGATAAGGAGAAAGG + Intergenic
1110253271 13:73404406-73404428 AAATGAAAACATAAGGAAAAGGG + Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111958559 13:94784129-94784151 AGATGCACACAGAGGGAAGAAGG + Intergenic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1112572832 13:100609118-100609140 CAATGCAATCAGAAGGAAGGAGG - Intronic
1113352584 13:109543971-109543993 AAATGCTGACAGGAAGAGGAAGG - Intergenic
1114128583 14:19761190-19761212 AAAAGAAAACAAAAGAAGGAAGG - Intronic
1114150383 14:20031883-20031905 AAATGCAAGCAGGTGGGGGATGG + Intergenic
1114212245 14:20625321-20625343 AAATGCTGACAGAATGAAGAAGG + Intergenic
1114680199 14:24477927-24477949 AAATGCATACAAAAGTAGGAAGG + Intergenic
1115196375 14:30804858-30804880 TAATGCAACCAGAAGAAAGAAGG - Intergenic
1115400447 14:32953304-32953326 AAATGAAAACAGTTGCAGGAGGG - Intronic
1115679834 14:35725182-35725204 AAATGCAAACATATGCAAGAAGG - Intronic
1115863281 14:37713258-37713280 AAATGCAATTAGAAGGCAGAAGG - Intronic
1115977692 14:39014655-39014677 AAATGCAAACAGCAGAGGAATGG - Intergenic
1116116053 14:40652418-40652440 AAAGGAAAAAGGAAGGAGGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117911987 14:60645832-60645854 AAATGGAAAGAGAAAGAGAAAGG - Exonic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119168252 14:72513642-72513664 AAATGCACAAAGCAGGAAGAAGG - Intronic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1119467159 14:74867329-74867351 AAATGCAAAGACACGGAGGCTGG - Intronic
1120027303 14:79600867-79600889 AAATGCAGAAAGAAAAAGGAAGG + Intronic
1120316339 14:82898320-82898342 GGATGCATAGAGAAGGAGGAAGG - Intergenic
1120920696 14:89752801-89752823 AAATGCAGCAAGAAGGAGCAAGG - Intergenic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121678871 14:95776352-95776374 ACATGGAAACATAAGGAGTAGGG - Intergenic
1122939334 14:104974234-104974256 AACTGGACACACAAGGAGGACGG - Intronic
1123392900 15:19895243-19895265 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1123571523 15:21615434-21615456 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1123608142 15:22058025-22058047 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125145183 15:36458970-36458992 AAATACCACCAGAAGGATGAGGG - Intergenic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1125583060 15:40801009-40801031 AAATGTAAAATGAAGGAGTAGGG - Intronic
1126309306 15:47297876-47297898 AAATGAGAAAAGAAGGAGGTTGG + Intronic
1126376456 15:48001722-48001744 ACATGCAGAAAGAAGGAGGTGGG + Intergenic
1126435060 15:48628557-48628579 AAATTCACACAGAAGGAGCCTGG - Intronic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1126484871 15:49169111-49169133 ACATGTATACAGAAGGGGGAAGG + Intronic
1126499823 15:49333254-49333276 AAAGGCAATCAGAAAGAGGGAGG - Intronic
1126620466 15:50634381-50634403 ATAAACAAACAGAAGAAGGAGGG - Exonic
1126753265 15:51898880-51898902 AAGTGAAAAAAGAAAGAGGAGGG - Intronic
1126767923 15:52027416-52027438 AAATCCAAGCAGGAGGGGGAGGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127554899 15:60078258-60078280 AGATGCAGACAGCAGGGGGACGG - Intergenic
1127568276 15:60214914-60214936 AAAAGGAGAGAGAAGGAGGAAGG + Intergenic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1127781471 15:62320287-62320309 AAATGCAAAAACAGGAAGGAGGG - Intergenic
1127824167 15:62689499-62689521 AAATGATAACAGAAGAAGGCTGG - Intronic
1128922048 15:71619777-71619799 AAATGCATACACATGGAGGGAGG + Intronic
1129640522 15:77372466-77372488 AGATTCAAACAGATTGAGGATGG - Intronic
1130240921 15:82189956-82189978 AAATACAAACATTAGGCGGAGGG + Intronic
1130824577 15:87531036-87531058 AAATGAAAACAGAAAAAGAAGGG - Intergenic
1131086186 15:89577364-89577386 AAGTGCAATGAGAAGGATGAAGG - Intronic
1131531581 15:93197608-93197630 AAAAGGAAAAAGAAGGAAGATGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132447313 15:101936187-101936209 AAAAGGAAAGAAAAGGAGGAAGG + Intergenic
1202980377 15_KI270727v1_random:349823-349845 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1133356475 16:5140633-5140655 AAAAGCAAAAACCAGGAGGAAGG - Intergenic
1133420599 16:5643170-5643192 AAATGACATCAGAAGCAGGAGGG + Intergenic
1133477907 16:6141140-6141162 AAATGCAAAAAGACAAAGGAGGG - Intronic
1133562040 16:6959514-6959536 AAATGCACACAGAATGAGAGAGG - Intronic
1134825556 16:17281533-17281555 AAATTCAAACAAAAGGAAAAAGG + Intronic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1136060889 16:27725706-27725728 AAAGGCAAACAGATGGACCATGG - Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1136513820 16:30756052-30756074 GAAGGCAGACAGAAGGAAGATGG + Intronic
1136574397 16:31114912-31114934 AAAAGAAAAAAGAGGGAGGAAGG - Intergenic
1136799203 16:33055254-33055276 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1136956881 16:34798203-34798225 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1137341808 16:47614845-47614867 AAATGATAACAGAAGAAGGCTGG - Intronic
1137413031 16:48245180-48245202 AAAGGGAAACAGAAGGATTAGGG - Intronic
1137820392 16:51439129-51439151 AAAAGAAAAAAGAGGGAGGAAGG + Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139159782 16:64490497-64490519 AAATGCCATCAGAAGAAAGAGGG + Intergenic
1139770829 16:69274971-69274993 AAAAGGAAAGGGAAGGAGGAAGG - Intronic
1139797966 16:69498331-69498353 AAATGCTAACATAAGGATGGGGG + Intergenic
1139918823 16:70445949-70445971 AAAAAAAAAAAGAAGGAGGAAGG - Intergenic
1140465479 16:75178047-75178069 AAATGGAAACCGAAAGAGTAGGG + Intergenic
1140540093 16:75749102-75749124 AAAAGGAAAGGGAAGGAGGAAGG + Intronic
1140697409 16:77548654-77548676 AAATACAAAAAAAAGGAGGAAGG + Intergenic
1140838192 16:78814947-78814969 AAATCCAACCAGAAGAAGAAAGG - Intronic
1141023623 16:80522272-80522294 AAATGCTAACACCAGGAGAAAGG + Intergenic
1141239945 16:82256511-82256533 AAATGCAGACTGAAGGAGGGGGG + Intergenic
1141497566 16:84420406-84420428 AACTACGAAGAGAAGGAGGAAGG - Intronic
1142559558 17:802088-802110 AAATCCAAAGACAAGGAGAAAGG + Intronic
1143294838 17:5863208-5863230 AAAGGAAAAAGGAAGGAGGAAGG - Intronic
1143443525 17:6994159-6994181 AAAGGGAAACAAAAGCAGGAGGG + Intronic
1143448793 17:7023590-7023612 AAAGGCAAACAGAGGAGGGAAGG + Intronic
1144175917 17:12707407-12707429 AAAAGCACACAGAAGCAGGCTGG + Intronic
1144473614 17:15565354-15565376 ATAAGAAAACAGAAGGAGGTTGG - Intergenic
1144577038 17:16435856-16435878 AGATGCAAAGAGAAGGTGAAGGG - Intronic
1144922907 17:18779457-18779479 ATAAGAAAACAGAAGGAGGTTGG + Intergenic
1145421250 17:22833438-22833460 GAATGCAAACATCAGGAAGAAGG - Intergenic
1145523870 17:24306974-24306996 GAATGCAAACATCAGGAAGAGGG - Intergenic
1145530911 17:24409599-24409621 GAATGCAAACATCAGGAAGAGGG - Intergenic
1145553144 17:24733060-24733082 GAATGCAAACACCAGGAAGAGGG - Intergenic
1145589826 17:25265890-25265912 GAATGCAAACATCAGGAAGAGGG - Intergenic
1145621298 17:25725273-25725295 GAATGCAAACATCAGGAAGAGGG - Intergenic
1145623642 17:25759309-25759331 GAATGCAAACATCACGAGGACGG - Intergenic
1146336067 17:31971728-31971750 AAATGAAAACAGTTGCAGGAGGG - Intronic
1146633582 17:34487973-34487995 AAATGCAAACTGCAGAAGAAGGG + Intergenic
1147035024 17:37673465-37673487 AAAAGCAAACAGATGGATTATGG - Intergenic
1149560540 17:57605061-57605083 AAATGGCAACAGAAGCAGAATGG - Intronic
1150192331 17:63256284-63256306 AAATGGAAACAGAACTAGTATGG - Intronic
1151043372 17:70890737-70890759 AAATGCCAACAGAATGGAGAGGG + Intergenic
1151362884 17:73599187-73599209 ACATTCGTACAGAAGGAGGAAGG + Intronic
1151596765 17:75082697-75082719 AAATGGACACAGAAGGAGACAGG - Intergenic
1151909417 17:77072038-77072060 AAAAGAAAAAAGAAGGAGAAGGG - Intergenic
1152261586 17:79270119-79270141 AATGGCAAAGGGAAGGAGGACGG - Intronic
1153062515 18:1008507-1008529 AAATACAAGCAAAATGAGGAGGG - Intergenic
1155139008 18:23026247-23026269 AAACAGAAACAGAAGGATGAAGG + Exonic
1155467918 18:26159543-26159565 AAATGCAAACAGAAGATGGCAGG - Intronic
1155548554 18:26940503-26940525 AAAAGCAAACTGCAGGAGAATGG + Intronic
1155887783 18:31228871-31228893 AAAAAAAAAAAGAAGGAGGAAGG + Intergenic
1155920434 18:31598006-31598028 AAATGCAAAGAATAGGAGGGTGG + Intronic
1156783322 18:40878703-40878725 AAATGCAAACAGATGTAGGAGGG - Intergenic
1157023929 18:43820069-43820091 ACATCAAAACAAAAGGAGGATGG + Intergenic
1157208823 18:45723496-45723518 AAATTTAAAAAGAAGGGGGAAGG + Intergenic
1157546955 18:48553397-48553419 AAAGGCAAACGGAAACAGGATGG - Intronic
1157690481 18:49677962-49677984 GAATGAAAACAGAAGCAGGAAGG - Intergenic
1157791255 18:50533162-50533184 AAATGCAAACAGATAGAATATGG + Intergenic
1158226424 18:55206008-55206030 AAATGAAATCAGAAGGAAGTGGG + Intergenic
1158530886 18:58259701-58259723 TAATGTAAACGGAGGGAGGAGGG + Intronic
1158619286 18:59017524-59017546 ATATAAAAACAGAAGGAGGGTGG - Intergenic
1158754900 18:60310770-60310792 AAATGAAAACAAAAGGTTGAGGG + Intergenic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159253431 18:65912181-65912203 AAATGCAAGCAGAGAGAGGCTGG + Intergenic
1159277764 18:66243268-66243290 AGATGCAAACAGAAAGTAGAAGG - Intergenic
1159617082 18:70593641-70593663 AAATACAAATATAAAGAGGATGG - Intergenic
1160591200 18:79945566-79945588 AGAGGCAAACAGAAGAAGGGAGG + Intronic
1160637963 19:96346-96368 AAAAGGAAAGAAAAGGAGGAAGG - Intergenic
1161678200 19:5665089-5665111 AAATGCTGGCAGGAGGAGGAAGG - Intronic
1163923333 19:20313882-20313904 AAATGCACACAGAACGATGAGGG + Intergenic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1164506927 19:28868700-28868722 AGATTAAAACAGCAGGAGGAAGG + Intergenic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1165163736 19:33834979-33835001 AGATGGTAACAGAAGGAGGTTGG + Intergenic
1165281204 19:34799158-34799180 AAATACAAAAATTAGGAGGATGG - Intergenic
1165966060 19:39581896-39581918 AAATGCACAGATAAGGATGATGG - Intergenic
1165967357 19:39593966-39593988 AAATGCAAGCATAATGATGAGGG - Intergenic
1165971715 19:39637359-39637381 AAATGCACAGATAAGGATGATGG - Intergenic
1165973649 19:39655669-39655691 AAATGCATAGATAAGGATGATGG - Intergenic
1165977717 19:39691846-39691868 AAATGCACAGACAAGGATGATGG - Intergenic
1165979030 19:39704235-39704257 AAATGCATAGATAAGGATGATGG - Intergenic
1166212740 19:41317746-41317768 GGATGAAAACAGAAGGAAGATGG + Intronic
1166936983 19:46339854-46339876 AAATCCTGAGAGAAGGAGGAGGG - Exonic
1167029987 19:46951915-46951937 AAATCCCAACTGAAGGGGGATGG + Intronic
1167429123 19:49444154-49444176 AAAAGAAAAAGGAAGGAGGAAGG - Intergenic
1202682532 1_KI270712v1_random:20548-20570 ACCTGCAAGGAGAAGGAGGACGG - Intergenic
925496539 2:4456417-4456439 ATATGCAGACAGAAAGAGAAAGG + Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
926438841 2:12865690-12865712 AAATACAAAAAGAAGAAGGAAGG - Intergenic
926835434 2:17014076-17014098 AAATCCAAACAGCAGCAGGAGGG + Intergenic
926861520 2:17315249-17315271 AAATACCAGCAGCAGGAGGAGGG - Intergenic
927517847 2:23682464-23682486 AAATCCACACAGAGGCAGGATGG - Intronic
928360768 2:30660534-30660556 ATATGCAAACAGCAGGAAGGTGG + Intergenic
929147706 2:38721250-38721272 GAATGCAAATAGAAAGAGGAAGG + Intronic
929411596 2:41702894-41702916 TCATTCAAACAGAAGAAGGATGG - Intergenic
929774379 2:44919253-44919275 AAATGCAGACAGGAAAAGGATGG - Intergenic
929846071 2:45529298-45529320 AAATGTAGTCAGAAGGAAGATGG + Intronic
930052526 2:47227815-47227837 AAATGGCTGCAGAAGGAGGAGGG - Intergenic
930162676 2:48174380-48174402 AAATGCAAACAAACATAGGAAGG + Intergenic
930198453 2:48530651-48530673 AACAGCAGTCAGAAGGAGGAGGG - Intronic
930696552 2:54417217-54417239 GAAAGGAAACAGAAGTAGGAGGG + Intergenic
930798928 2:55421959-55421981 AAATACAGACAGAAGGAGAGTGG + Intergenic
930917807 2:56715180-56715202 AAATGCACACAGAAGGCTGTTGG - Intergenic
931363345 2:61597327-61597349 AAATGCAAACAGAAGTTTCAAGG + Intergenic
931692558 2:64847725-64847747 TAGTGCAATCAGAGGGAGGAGGG + Intergenic
931928346 2:67099720-67099742 AAATGCAAGGAGAAAGAGAAAGG + Intergenic
932452756 2:71825414-71825436 AAGTGCAAACAGGAGAAAGAAGG + Intergenic
932531537 2:72539196-72539218 AAAGGAAAAAAGAAGGGGGAGGG + Intronic
932556348 2:72828207-72828229 AATTCCAAACAGATGTAGGAGGG + Intergenic
932668608 2:73718106-73718128 AAAAGGGAACAGAGGGAGGAGGG - Intergenic
932822585 2:74914220-74914242 AAAAGGAAAAAAAAGGAGGAAGG + Intergenic
933200663 2:79444550-79444572 AAAGGCAGACAGAAGCAGCAAGG - Intronic
933256143 2:80083066-80083088 ACATGAGAACAGAAGGAGGGAGG - Intronic
933294272 2:80471828-80471850 AAATGCATAAAGAAGGTGGCCGG + Intronic
933994588 2:87658840-87658862 AAATGCAAATGGAAGTGGGAGGG + Intergenic
934189312 2:89771658-89771680 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934303943 2:91805369-91805391 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
934329311 2:92047381-92047403 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934467530 2:94277302-94277324 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
935205043 2:100890078-100890100 GTATGCACACAGAAGCAGGAGGG - Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935411387 2:102767972-102767994 AAATGAACAGAGGAGGAGGAAGG - Intronic
936299270 2:111292073-111292095 AAATGCAAATGGAAGTGGGAGGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
938056918 2:128222705-128222727 AAATGCAAACAGGCTGAGCACGG - Intergenic
938313282 2:130308786-130308808 AGAAGGAAAGAGAAGGAGGAGGG + Intergenic
938518670 2:132042410-132042432 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
938659789 2:133473884-133473906 AAATGCATAAAGCAGGAGGAAGG + Intronic
939587334 2:144020984-144021006 AAAAACAAAAATAAGGAGGATGG + Intronic
939650545 2:144757117-144757139 AAATGCAAACAGGTGGGGGGAGG - Intergenic
939761729 2:146190890-146190912 AAAAGCAAAAACAAAGAGGAGGG + Intergenic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940328683 2:152452331-152452353 AAATGCTAGCAGAGGCAGGAAGG - Intronic
940642888 2:156365694-156365716 AAATGCAAATAGAAGCAGATTGG + Intergenic
940733879 2:157427131-157427153 ATAGACACACAGAAGGAGGAAGG + Intronic
941088985 2:161152338-161152360 AAATGAAAGCAGAAGGAGCTTGG - Intronic
941427328 2:165365043-165365065 AAATGCATACAGAAGATGGGGGG + Intronic
941440116 2:165524207-165524229 CAATTCAAATAGCAGGAGGAGGG + Intronic
941957279 2:171217533-171217555 AAAAGCAGACAGCAGGAGGGAGG + Intronic
941995601 2:171599304-171599326 AAATGCAAACAAAACCACGATGG - Intergenic
942032585 2:171977761-171977783 AAAGGAATACAGAAGGAAGAAGG - Intronic
942395961 2:175549901-175549923 AAAAGTAAACAGGAAGAGGAAGG - Intergenic
943465394 2:188222901-188222923 AAAGACACACAGAAGGAAGATGG - Intergenic
943802344 2:192076971-192076993 AAATGCTAACAGTAGGAAAAGGG - Intronic
943921541 2:193713275-193713297 TAATGCAAGAAGAAGGAGAAGGG - Intergenic
944268188 2:197751174-197751196 AAATGCCCACAGAAGAAAGAGGG + Intronic
944332255 2:198484260-198484282 AAATACAAACAATAGAAGGAAGG - Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
944982386 2:205136231-205136253 GAATGGAAAGAAAAGGAGGAAGG - Intronic
945180547 2:207087014-207087036 AGATGGAAATAGAAGGAAGATGG + Intronic
945328603 2:208513722-208513744 AAATGCTAACAGGAGGAGAAAGG + Intronic
946388887 2:219403824-219403846 AAATGGAGGCACAAGGAGGAAGG + Intergenic
946483760 2:220081166-220081188 AAATACAAAAAGGAAGAGGAAGG - Intergenic
946573354 2:221048550-221048572 AAATGGAAAATGAAGCAGGATGG - Intergenic
946756713 2:222954383-222954405 GGACCCAAACAGAAGGAGGAGGG - Intergenic
946974520 2:225133418-225133440 AAATGCAAAAAGAAGGGCTAAGG + Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947147019 2:227077700-227077722 AAAAAAAAAAAGAAGGAGGAGGG + Intronic
947467544 2:230366439-230366461 AAATGCAAACCAAAGAAGGAAGG - Intronic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947931727 2:233970311-233970333 GTAGGCAAACAGCAGGAGGAAGG - Exonic
947963961 2:234263236-234263258 AAATGCAAACAATTGGAGCAAGG + Intergenic
948312405 2:236998426-236998448 AAATAAACAAAGAAGGAGGAAGG + Intergenic
948433709 2:237937620-237937642 AAATAAAACCAGAAAGAGGAGGG + Intergenic
948768683 2:240236365-240236387 AGGTGCAAACAGGAGGACGATGG - Intergenic
948834084 2:240616185-240616207 AGAGGCAAACAGAAGGAAAAAGG - Intronic
948923286 2:241077214-241077236 ACATGCAAAAAGAATGAGGCCGG + Intronic
948989402 2:241544984-241545006 AAATGAAAACGGAAGCAAGAGGG - Intergenic
1168842224 20:916854-916876 ACATGGAACCAGAGGGAGGAAGG - Intergenic
1169512973 20:6284856-6284878 AAAGTCAAACAGAGTGAGGAAGG + Intergenic
1169567349 20:6869481-6869503 AAATGGAAACAGAGGTGGGAAGG - Intergenic
1169780726 20:9307082-9307104 AGTTCCACACAGAAGGAGGAGGG + Intronic
1170103050 20:12723102-12723124 AAATACACACAGAAGGCAGAAGG - Intergenic
1170487404 20:16832767-16832789 AGATGCAAGCTGAAGGAGGAGGG - Intergenic
1170558430 20:17534614-17534636 TAATAAAAACAGAAGGGGGATGG + Intronic
1170689146 20:18596445-18596467 AAATGTGAACAGAAGAAGGGAGG - Intronic
1172139604 20:32713026-32713048 AAATTAAAAAAGAAAGAGGACGG - Intronic
1172387168 20:34542177-34542199 AAATTCAAGCAGAAGGACGGAGG - Intergenic
1172655570 20:36535108-36535130 AAATGCAAAAAAAAGGAAGCTGG + Intergenic
1173094662 20:40013781-40013803 AAATGCAAAGAAAAAGGGGATGG + Intergenic
1173206255 20:40996513-40996535 AAAAGAAAAAAGAAAGAGGAGGG + Intergenic
1173363475 20:42365045-42365067 AAAGGCAAAGAGAAGCAGGTGGG + Intronic
1173605909 20:44331313-44331335 AAATCCAAGCAGGAGGAGGGAGG - Intergenic
1175665192 20:60852758-60852780 AAATGCCAACAGAAGGACACAGG + Intergenic
1175680013 20:60979340-60979362 AGCTGCAATCAGAAGGAGGCAGG - Intergenic
1176674031 21:9760511-9760533 ACATGCAGAAAGTAGGAGGAAGG - Intergenic
1176743045 21:10623740-10623762 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1176956525 21:15110533-15110555 AAATACTAACAGATGCAGGAAGG - Intergenic
1177213859 21:18104339-18104361 AAATGCCAAGCGAAGGGGGAAGG - Intronic
1178158848 21:29887706-29887728 AAATGCCAACACACTGAGGAAGG - Intronic
1178726220 21:35053879-35053901 AAATGCCACCAGAAGCAGAAGGG - Intronic
1179311865 21:40203265-40203287 ATCTGCAAACATAAGGTGGAAGG - Intronic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1180212556 21:46303395-46303417 AAAGGCAACCACAAGAAGGATGG + Intronic
1180534277 22:16383083-16383105 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1180690093 22:17706736-17706758 AAATGAAAAGAGAATGAGGAGGG - Intronic
1181373039 22:22432800-22432822 AAATGGAAAAAGTAGGATGATGG - Intergenic
1181442928 22:22946928-22946950 AAATAAAAACAGAAGAAAGAAGG - Intergenic
1181868249 22:25876378-25876400 AGATGCAAACAGGAGGAGCAGGG - Intronic
1181907342 22:26209822-26209844 AAAGGAAAAAAGTAGGAGGAAGG + Intronic
1182031518 22:27162903-27162925 AAATGCAAACAGGCAGAGGTGGG + Intergenic
1182488372 22:30653363-30653385 AAAAAAAAAAAGAAGGAGGAAGG - Intronic
1183153212 22:36053884-36053906 AAATGAAAATAAAAGGTGGAGGG - Intergenic
1183622392 22:38982129-38982151 AATTGCAAAGAGAAAGAGAAAGG - Intronic
1184016102 22:41786776-41786798 AACTGCTACCAGAAGAAGGAGGG + Intronic
1185002494 22:48254413-48254435 ATATGCACAAAGAAGGAAGAGGG + Intergenic
1203238073 22_KI270732v1_random:26673-26695 AAAAGTAAAAAGATGGAGGAGGG - Intergenic
1203289589 22_KI270735v1_random:21714-21736 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203315366 22_KI270737v1_random:2713-2735 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
949336993 3:2985801-2985823 AAATACAAACAGAAGGCAGAAGG + Intronic
950233287 3:11295301-11295323 AAAAGCAAACAGAAGGAATGAGG - Intronic
950354115 3:12389527-12389549 AAATGGAAGCAGAAGGATAATGG + Intronic
950837605 3:15935774-15935796 AAAAGGAAACAGAGGGAGCAAGG - Intergenic
951252238 3:20407416-20407438 AAATGGAAAAATGAGGAGGAAGG - Intergenic
951471802 3:23064349-23064371 AAAAGCTGACAGAAGGAGGTGGG + Intergenic
951847304 3:27098071-27098093 AAATGAAAGCAGAAAGAGGCAGG + Intergenic
952064277 3:29549046-29549068 AAAAAAAAACAGAAGTAGGAGGG - Intronic
952484376 3:33795273-33795295 AAATGCAAGTGGAAGTAGGAGGG + Intergenic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
952637104 3:35545702-35545724 AAAGGCAAACAGACTGAAGATGG + Intergenic
954365194 3:50142077-50142099 AAAAGAAAAAAGAAAGAGGAAGG - Intergenic
954528027 3:51290716-51290738 AAATGGAAACAAAAAGAGCAGGG + Intronic
955281721 3:57600438-57600460 AAAAGGGAACAGAAGGGGGAAGG - Intergenic
955311168 3:57888091-57888113 ATAAGAAAACAGAAAGAGGAAGG + Intronic
955399422 3:58581066-58581088 AAAGCCACACAGAAGGAGGCAGG - Intronic
956151509 3:66248231-66248253 AATTGCAAACATAAGGTAGAAGG - Intronic
956540446 3:70332405-70332427 ACTTGCAACCAGAATGAGGATGG - Intergenic
956593323 3:70939693-70939715 AAAGACAAAGAGAAGAAGGAAGG - Intergenic
957337245 3:78847201-78847223 AAATGAAATCATATGGAGGATGG + Intronic
957593760 3:82233830-82233852 AAAAGAAAAGAGATGGAGGAAGG + Intergenic
957700894 3:83710139-83710161 AAATGAAAACAGAGATAGGAAGG + Intergenic
957906202 3:86559413-86559435 AAAATCAAATAGAAAGAGGATGG - Intergenic
958446147 3:94217501-94217523 AATTGAAAACAGAAGAAGCAGGG + Intergenic
958506243 3:94981318-94981340 AAATGCAAACAATAGTAGAATGG + Intergenic
959040053 3:101410965-101410987 AAATGCAAAGAGAAGCAGTATGG + Intronic
959118295 3:102204249-102204271 AAATGCAATCAGAAGGAAAAAGG - Intronic
959189056 3:103086346-103086368 AAAGCCAAATAGAAGGAAGAAGG + Intergenic
959534415 3:107469231-107469253 AAAAGCAAAGAGATGGAGAAGGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960182306 3:114595045-114595067 AAATGAAAAAAGAAGCATGAAGG - Intronic
961076594 3:123988393-123988415 TAATGAAATCAGAAGTAGGAAGG - Intronic
961564116 3:127751234-127751256 AGGTGCAAATGGAAGGAGGAGGG - Intronic
962641226 3:137388836-137388858 AAAAGAAGACAGAAAGAGGAAGG - Intergenic
962722744 3:138191259-138191281 AAATGCAAACCAAAGAGGGATGG - Intronic
962979865 3:140478763-140478785 AACTGAAAAAAGAGGGAGGAAGG + Intronic
963157631 3:142116397-142116419 AGATGCAGACAGAGGGAAGAAGG + Intronic
963222763 3:142829038-142829060 AAATCCAAACCCAGGGAGGAGGG - Intronic
963688497 3:148469079-148469101 ATATGAAAACAGAAACAGGAAGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
964605163 3:158553122-158553144 AAATGCAACCAGAAGCCAGAGGG - Intergenic
964705167 3:159610547-159610569 TAATGAAAACAGAGGGAGGTAGG - Intronic
964825731 3:160825910-160825932 AAAAGCAACCAGAATGAGAAGGG - Intronic
964892405 3:161552746-161552768 AAATGCAATCACAAGGAAAATGG + Intergenic
965337111 3:167439894-167439916 AAATTAAAATAGAAGGTGGAGGG + Intergenic
965476542 3:169162448-169162470 AGATTCAAACAGAAGGGAGATGG + Intronic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
967094581 3:186166658-186166680 AAAGACAGAGAGAAGGAGGAGGG + Intronic
968051249 3:195656483-195656505 ACATGCAGACTGAAGGAGGAAGG + Intergenic
968104575 3:195991856-195991878 ACATGCAGACTGAAGGAGGAAGG - Intergenic
968257306 3:197287622-197287644 AAAAGGAAAAAGGAGGAGGAAGG + Intronic
968302866 3:197629439-197629461 ACATGCAGACTGAAGGAGGAAGG - Intergenic
968664320 4:1812641-1812663 AAATGCACACAGAACGATGAGGG + Exonic
968705656 4:2076212-2076234 AAGTGCAAGCACAAGGCGGACGG + Intronic
968811488 4:2801425-2801447 AGAGGCAAAAAGAAGGAAGAAGG - Intronic
969262257 4:6041442-6041464 AAATGGGAGGAGAAGGAGGAAGG - Intronic
969462554 4:7336413-7336435 CAATGCGAACAGATGGATGAAGG + Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971131522 4:23816181-23816203 AAATGCAAACACAAAGTGAATGG + Intronic
971138901 4:23901681-23901703 AAATACACACAGAGGGAAGAAGG + Intronic
971580826 4:28337437-28337459 GAAGGCAAACAGAAGGTAGAAGG + Intergenic
971866597 4:32180106-32180128 CAATTCAAACAGAGGGAGGCAGG + Intergenic
971870743 4:32235348-32235370 ACATGCAAACAGAAGTTAGAAGG + Intergenic
971923669 4:32977557-32977579 AAATACCAACAAAACGAGGAAGG + Intergenic
972301047 4:37786016-37786038 AAAAGCCAACAGAACAAGGATGG + Intergenic
973013281 4:45104360-45104382 AAAAGCAATGACAAGGAGGATGG + Intergenic
973161889 4:47030013-47030035 AAATTCAAATAGAAGAATGAGGG - Intronic
973783788 4:54316331-54316353 AAAAGCAGACAGAAGGAAAATGG - Intergenic
974393749 4:61308255-61308277 AGAAGCAAACACCAGGAGGAGGG + Intronic
974662656 4:64913708-64913730 AAATTTAAACAGAAGGAATAGGG + Intergenic
974927570 4:68319278-68319300 AAATGTAAACTTAAGGGGGAGGG + Intronic
975021531 4:69496669-69496691 AAATGCAGAAAGAAGGGGTAGGG - Intronic
975336142 4:73177543-73177565 AAATGCAAAAAGAGGGAGGAAGG + Intronic
975940962 4:79645111-79645133 GACTGCAAAGAAAAGGAGGATGG + Intergenic
976709255 4:88051578-88051600 AAATAAAAACAGCAGGATGAAGG + Intronic
976885540 4:89979463-89979485 AAAAGAAAAAAGAAGGAAGAAGG - Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977073554 4:92423723-92423745 AAATGCAAACAGAGGGTAGTTGG + Intronic
977775367 4:100913398-100913420 AAAAGCAGCCAGAAGGAAGAGGG - Intergenic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
979199874 4:117964523-117964545 AAATGGAAGCTGAAGGATGAGGG - Intergenic
979281762 4:118876608-118876630 AAAAGAGAAAAGAAGGAGGAGGG - Intronic
980006273 4:127545626-127545648 AAATAAAAACTGATGGAGGAAGG + Intergenic
980276854 4:130664176-130664198 AAATGAAAAAACAAGGAGGGGGG - Intergenic
980903216 4:138924626-138924648 AAAAGAAAAAAGAAGGAGGTGGG + Intergenic
981367116 4:143916294-143916316 AAATGCAACCAGAAGCAAGCAGG + Intergenic
981376910 4:144026529-144026551 AAATGCAACCAGAAGCAAGCAGG + Intergenic
981387412 4:144147879-144147901 AAATGCAACCAGAAGCAAGCAGG + Intergenic
981713096 4:147728157-147728179 AAATCCAGACAGAAGGTGGTTGG - Intergenic
981818617 4:148860437-148860459 AAATGGAAACACCAGGAGAAGGG + Intergenic
981923232 4:150109879-150109901 AAATTAAAACAAAAGGTGGAGGG + Intronic
982096317 4:151926673-151926695 CAATGCAGACAGAAAGAGCAGGG - Intergenic
982312383 4:153999670-153999692 AAATACAAACAGGTGGAGGAAGG - Intergenic
983082223 4:163400473-163400495 AAATGCTAACAGACTAAGGAGGG - Intergenic
983135247 4:164070896-164070918 TCATGCAAACAGTAGGAGAAGGG - Intronic
983519990 4:168698163-168698185 AAATCGAAACAGTAGAAGGATGG + Intronic
983967244 4:173827909-173827931 AAAAACAAACAGAAGGGGGCAGG - Intergenic
983983826 4:174033486-174033508 AAATGAAGACAAAAAGAGGAAGG - Intergenic
983989602 4:174101577-174101599 AAATGAAAAGAGAGGGAGTAAGG + Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984920002 4:184755136-184755158 AAATGGTAACAGAAGGAATAGGG + Intergenic
985507935 5:295122-295144 ACACGCAGACTGAAGGAGGAAGG + Intronic
987062580 5:14256747-14256769 ACCTCCAAACAGGAGGAGGACGG - Intronic
987070353 5:14331241-14331263 AAATGCAAACAGAACAAGTAAGG - Intronic
987070556 5:14333473-14333495 AAATGTAATCAGAAGAATGATGG - Intronic
987182174 5:15379643-15379665 AAAGGCAGAAAGAAGAAGGAAGG + Intergenic
987332535 5:16869891-16869913 TAATAAAAACAGAAGGAGAAAGG + Intronic
987367793 5:17164833-17164855 ACATTGAAACAGAAGGATGATGG + Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988427828 5:31084297-31084319 GCATACAAACAGAAGGAAGAAGG + Intergenic
988719121 5:33858855-33858877 GAAGGCAAGCAGAAGCAGGATGG + Intronic
988790118 5:34600101-34600123 AAAAGCATAGAGAAGGAAGAAGG + Intergenic
989756219 5:44958781-44958803 AGAAGGAAAAAGAAGGAGGAAGG - Intergenic
990353572 5:54942266-54942288 AATTGCAAGCAGCAGGAGGTGGG - Intergenic
991592615 5:68269390-68269412 AAATGTAAACTGTTGGAGGATGG + Intronic
991621295 5:68547954-68547976 AAATTGAAACAGAAGGAAGCAGG - Intergenic
993148603 5:84130088-84130110 ATACTCAAACAGAAAGAGGAGGG - Intronic
993357018 5:86926667-86926689 TAATTCAAATAGAAGGAGAATGG - Intergenic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
993652415 5:90537800-90537822 ACATGCAAAAAGAAGGAGGTAGG + Intronic
993802031 5:92353730-92353752 ATATGCTAATAGGAGGAGGATGG + Intergenic
993863430 5:93163550-93163572 AAATGAACACAAAAGAAGGAGGG + Intergenic
994164854 5:96597925-96597947 AAATGGAAAAAGAAGGGGGGAGG + Intronic
994229115 5:97293426-97293448 AAAGTCAAAAAGCAGGAGGATGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995442432 5:112206623-112206645 AAAAGCAAAGAGAAGGGAGAAGG + Intronic
995818917 5:116204423-116204445 AAAAGAAAAAAAAAGGAGGATGG - Intronic
995853124 5:116567594-116567616 AAATGAAAACTGAAGGAGAAAGG + Intronic
996112566 5:119582914-119582936 AAATAAAAACACAAGTAGGAGGG - Intronic
996486692 5:124043357-124043379 GAATGCAAACACCAGGAGGTGGG - Intergenic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
996702559 5:126465005-126465027 AAATGCAAACAAAAGGGGTGGGG + Intronic
997037089 5:130205833-130205855 AGATGGAATGAGAAGGAGGAGGG - Intergenic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997664592 5:135619997-135620019 AAATGGCAACAGAAGTAGGTTGG + Intergenic
999505207 5:152187492-152187514 AAAAGCCAACAGACTGAGGATGG - Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
999749928 5:154620255-154620277 AAAACAAGACAGAAGGAGGAAGG - Intergenic
999995452 5:157088064-157088086 AAATGGAAACATTAGGTGGAAGG - Intronic
1000187592 5:158875211-158875233 AAATCCAAACAGAGGAATGAAGG + Intronic
1000245556 5:159446022-159446044 AAATGCAAAGACAAGGAGACTGG + Intergenic
1000660105 5:163927854-163927876 AAATGAAGAGAGAAGGGGGAAGG + Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001699688 5:173697837-173697859 AAATGAAAACTGAATGAGGAAGG - Intergenic
1002354935 5:178619543-178619565 AAATGCAAAGGGAAGTAGGGTGG - Intronic
1002367138 5:178722500-178722522 AAAAGCAAACAAAAGGGAGATGG - Intronic
1002444632 5:179281866-179281888 AAATGCAAGCCGAAGCATGATGG - Intronic
1002629235 5:180558603-180558625 AAAAGCAAACACAAGAAGGAAGG - Intronic
1002811633 6:636756-636778 AGATGCATTCAGAATGAGGAAGG - Intronic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003504144 6:6725796-6725818 AAATGCAATGAGAAGGGGGATGG - Intergenic
1003593044 6:7451873-7451895 AAATACAAACAAAATGAGTAGGG - Intergenic
1003959651 6:11197234-11197256 AAAAGCAAACAGAGGGGGAAAGG - Intronic
1004054040 6:12116487-12116509 AGATGCAAACAGAAGGACGATGG - Intronic
1004639791 6:17504094-17504116 ATATGCAAACACAAGGAGAGTGG - Intronic
1004667946 6:17766170-17766192 AAATGCAAACTTAATGAGTAAGG - Intronic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005286487 6:24333084-24333106 AAAGGCAAAAAGAAGAATGAGGG + Intronic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1005717427 6:28563961-28563983 AAAGGCCAACAGATGGAGGAAGG + Intergenic
1005757688 6:28940021-28940043 GAATACAAACAGAAGGGGGCAGG - Intergenic
1005764640 6:28998908-28998930 ATATACAAACAGAAGGATCAGGG - Intronic
1006411370 6:33875790-33875812 AAATGAAAACAGACAGAGGCCGG + Intergenic
1006935971 6:37718228-37718250 AAATGCAAAGAGAAGAAGATAGG + Intergenic
1007013344 6:38438816-38438838 AAAACAAAACAGAAGGAAGATGG + Intronic
1007439014 6:41841676-41841698 AAATGCAAATAAAAATAGGATGG - Intronic
1007470547 6:42087465-42087487 AAATGGAATGAGAAGGAAGAAGG - Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007961748 6:45966644-45966666 AAAAGGAAACAAAAAGAGGAGGG - Intronic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1008025403 6:46630256-46630278 AATGGCACACAGAAGGAGAATGG + Intronic
1008041652 6:46807720-46807742 AGAGGAAAACAGAAGAAGGAGGG + Intronic
1008319200 6:50086559-50086581 AAATGTGATCAGAAGGAGTACGG - Intergenic
1008424141 6:51337351-51337373 AGATGAAGACAGAAGGAGGCTGG - Intergenic
1008748080 6:54697710-54697732 CAATGAAAACAGAATGATGAGGG + Intergenic
1009708915 6:67292376-67292398 AAGTGCAAACACAATGAAGATGG + Intergenic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010289879 6:74123070-74123092 AAAAGCACAAAGAAGGAGGTGGG - Intergenic
1010363589 6:75023802-75023824 ACATGCAAAAAGAAGGACTAGGG + Intergenic
1011010727 6:82701231-82701253 AAAAGAAAAAAGAAGCAGGAAGG - Intergenic
1011418802 6:87151603-87151625 AGATGCAAAGAGAAAGAGCATGG - Intergenic
1011597016 6:89025814-89025836 AAAGGAAAACTGAAGGAGAAGGG - Intergenic
1011679967 6:89773570-89773592 AAATACACACACAAGGAAGAAGG + Intronic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1012056924 6:94424934-94424956 AAAGGAAAATGGAAGGAGGAAGG - Intergenic
1012317997 6:97804269-97804291 AAAAGCAAACTCAAGGATGATGG - Intergenic
1012555477 6:100506112-100506134 AAATGTAACAAGAAAGAGGAAGG + Intergenic
1012681109 6:102181778-102181800 AAATGAAAATAAAAAGAGGAAGG + Intergenic
1012857489 6:104519488-104519510 AAAGGCAAATTGAAGGAGTAAGG - Intergenic
1013276106 6:108586300-108586322 AAATGAAAACAGAAGTAGCGTGG + Intronic
1013533376 6:111040726-111040748 AAATGAAAAAAGAAGGAGGAAGG + Intergenic
1013584530 6:111566505-111566527 AAATACAAACAGGACGTGGAAGG - Exonic
1013874461 6:114806321-114806343 AAATAAAAAAAGAAGAAGGAAGG - Intergenic
1013973060 6:116043614-116043636 AAATGCCCACAGAAGGAAGCGGG + Intronic
1014082803 6:117307104-117307126 AAATGCAACTAGAAGGAGGAAGG - Intronic
1014504939 6:122243190-122243212 AAAGGCACACTGAAGAAGGAAGG + Intergenic
1015619986 6:135121248-135121270 AAAAGGAAACAGACAGAGGAAGG + Intergenic
1015987819 6:138902597-138902619 AAATGCAATCAAAAGCAGTATGG + Exonic
1016689511 6:146920432-146920454 AAATGAAGACAAAAGGAAGATGG + Intergenic
1017283965 6:152653222-152653244 AAATGACAACAGAAATAGGAGGG - Intergenic
1017586939 6:155936875-155936897 AAATAGAGAGAGAAGGAGGAGGG + Intergenic
1017711163 6:157169480-157169502 AAATGCCAAGGGAAGGAGGATGG + Intronic
1017829187 6:158109870-158109892 ACATGCTAATAGAAGGAAGAAGG + Exonic
1017910696 6:158790281-158790303 AAATGGAAATAGTATGAGGATGG + Intronic
1018164702 6:161082287-161082309 AAATGCAAACAGAAGGAATTAGG - Intronic
1018387312 6:163316708-163316730 AAATGCTTACAGAAACAGGACGG - Intergenic
1018528628 6:164740377-164740399 AAATGGAGAGAGAAGCAGGACGG + Intergenic
1019842475 7:3462025-3462047 AAATGCAAAGAGAAGAGGTAGGG - Intronic
1020141885 7:5616216-5616238 AAATTCAAAGAGAAGGCAGATGG + Intergenic
1020167124 7:5816383-5816405 AAATGCCAACAGAGAGAGGGAGG - Intergenic
1020676665 7:11192058-11192080 AATTCCACACAGAAAGAGGAGGG - Intergenic
1021187221 7:17577999-17578021 AAATGGAAACAGAAAAAGCAGGG + Intergenic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1021402797 7:20228899-20228921 TAATTCAAACTGAAGGAGAATGG - Intergenic
1022155035 7:27652320-27652342 AAATGCAACCATAATGTGGAAGG + Intronic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1023080963 7:36525929-36525951 AAAAGCACAAAGAAAGAGGAGGG + Intronic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023306986 7:38841018-38841040 AAATGAGAACAAAAGGGGGAAGG - Intronic
1023713785 7:43022305-43022327 ACAGGCAAACAGAAGGATGGGGG + Intergenic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1024682027 7:51700668-51700690 AAATATAAAGAGAAGGAGAAAGG + Intergenic
1024818503 7:53299322-53299344 ACATTCAAACATAAGGAAGAAGG + Intergenic
1024945589 7:54804700-54804722 AAGTGCATACACAAGGATGACGG - Intergenic
1025207036 7:56999923-56999945 ACCAGCAAACAGAAGGAGGGGGG - Intergenic
1025280086 7:57620551-57620573 AAAGGAAAAGTGAAGGAGGATGG - Intergenic
1025304647 7:57844950-57844972 AAAGGAAAAGTGAAGGAGGATGG + Intergenic
1025307290 7:57873029-57873051 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1025481073 7:60983555-60983577 AACTGCAAGGAGAAAGAGGATGG - Intergenic
1025664903 7:63576979-63577001 ACCAGCAAACAGAAGGAGGGGGG + Intergenic
1025747773 7:64259460-64259482 AAATGCTAACATAAACAGGATGG + Intronic
1026404820 7:70054335-70054357 AAAAGCAAAGAGAAAAAGGAAGG - Intronic
1026657125 7:72266547-72266569 AAATCCACACACAGGGAGGAAGG - Intronic
1027131122 7:75592158-75592180 AAAGACAAAGGGAAGGAGGATGG + Intronic
1027357407 7:77371413-77371435 AAAAGAAAAAAGATGGAGGACGG - Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027726895 7:81817033-81817055 AAATGCAAACTGCTGGAAGAAGG + Intergenic
1027899201 7:84087844-84087866 AAATGCAAAAACATAGAGGAAGG - Intronic
1029353466 7:100032415-100032437 AAATGACAACAGAGGGAGCATGG - Intronic
1029635170 7:101778715-101778737 AAATGAGAAAAGAAAGAGGAAGG - Intergenic
1029741421 7:102493696-102493718 AAATGCCAACAGCAGGCGGTGGG + Intronic
1029759413 7:102592865-102592887 AAATGCCAACAGCAGGCGGTGGG + Intronic
1029776780 7:102688775-102688797 AAATGCCAACAGCAGGCGGTGGG + Intergenic
1030190535 7:106806112-106806134 AAATGGAAGGAGAAAGAGGAGGG + Intergenic
1030581373 7:111359834-111359856 AAATGCAAGAAGTAGGTGGAGGG + Intronic
1030597360 7:111555997-111556019 ACATGCACACAGAAGAGGGATGG - Intronic
1030799727 7:113834990-113835012 AAATGTATACAGAAAGAGTAAGG - Intergenic
1031369661 7:120949443-120949465 AAAAGCAGCCAGAAGAAGGAAGG + Intergenic
1031807377 7:126324738-126324760 AAATGCAAACTGAAAGTTGATGG - Intergenic
1032104695 7:129017456-129017478 AAATGCAAAGAGAAGGGAAATGG - Intronic
1032370951 7:131351282-131351304 AAAAGAAAACAGCAAGAGGATGG - Intronic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032572843 7:133019253-133019275 AAAAGCAGAAAAAAGGAGGAGGG - Intronic
1033867146 7:145704707-145704729 GAAGGCAAATAGAAAGAGGATGG - Intergenic
1033897650 7:146094450-146094472 AAATGCAAGCAGATGGAGCAGGG + Intergenic
1034572009 7:151963881-151963903 AAATGCAAATAGAACCAGAAAGG - Intronic
1035816984 8:2551716-2551738 AAATGCAAACAGAGCGGGCATGG + Intergenic
1036044095 8:5120310-5120332 AATTCCAAACAGAAAGTGGAGGG + Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036134555 8:6148192-6148214 AAATGCAATCAGAATGGAGAAGG + Intergenic
1037077402 8:14737665-14737687 ATATGAAAACAGACAGAGGATGG - Intronic
1037251460 8:16900159-16900181 CAATGCAAACAAAGGGAAGAAGG + Intergenic
1037286688 8:17308985-17309007 ACATGCAAATGGCAGGAGGAAGG + Intronic
1038050674 8:23807576-23807598 GAAAGCAAAGAGAAGCAGGAAGG + Intergenic
1039212568 8:35234531-35234553 AAAGGCAAAAAAAAGGGGGATGG - Intergenic
1039306804 8:36272182-36272204 AAAAGAAAGCAGATGGAGGAGGG - Intergenic
1039456797 8:37712596-37712618 ACAGGGAAACAGAAGGAGGTGGG - Intergenic
1039516685 8:38139756-38139778 AAATGTAAGCAGCACGAGGAAGG + Exonic
1040690960 8:49937872-49937894 AAAGGAACTCAGAAGGAGGAGGG - Intronic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1040821863 8:51568790-51568812 AAATACAAAGAGAAAAAGGATGG - Intronic
1040951488 8:52941669-52941691 AAAGGCAAAGAAAAGGAGTAGGG - Intergenic
1041131424 8:54706261-54706283 AAAAGTAAACAAAAGGAGGTTGG - Intergenic
1041777092 8:61535259-61535281 AAAAGCAAACAGCAGATGGAAGG + Intronic
1042115688 8:65428657-65428679 AAATGGAAACAGAAAAAGGCAGG + Intergenic
1042166374 8:65949922-65949944 GAATGCAAACAGTTGAAGGAAGG + Intergenic
1042483751 8:69330112-69330134 ACATGCAGACTGAAGGAGGAAGG + Intergenic
1042509924 8:69600455-69600477 AAATGCAAACAGAAGATAGTTGG + Intronic
1042685206 8:71431167-71431189 AAGTGCAAAGAGAAAGAGAAAGG + Intronic
1042830297 8:73019533-73019555 AAATACAAAGGGCAGGAGGAAGG - Intronic
1043033903 8:75172948-75172970 AAATACAAACACATGTAGGAGGG + Intergenic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1043834513 8:85031725-85031747 AAATGAAAATAAAAGTAGGATGG - Intergenic
1043872057 8:85444216-85444238 AAATGCATATGAAAGGAGGAAGG - Intronic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044550023 8:93501562-93501584 GCAAGAAAACAGAAGGAGGAAGG - Intergenic
1045047080 8:98289496-98289518 AAAAGCAAGAAGAAGGAAGAGGG - Intronic
1045682732 8:104679944-104679966 AAAGAAAAAAAGAAGGAGGAAGG - Intronic
1045827385 8:106414814-106414836 AAATGCCAAGATAAGGAGTATGG + Intronic
1045975604 8:108127846-108127868 AAAACAAAAAAGAAGGAGGAAGG + Intergenic
1046104646 8:109650907-109650929 AACTGCTAACAGAAGGAATAGGG - Intronic
1047101802 8:121684892-121684914 AAACCCCAAAAGAAGGAGGAAGG - Intergenic
1047874362 8:129119287-129119309 AAATGCAAACAAGAAGAGAATGG - Intergenic
1048072515 8:131037651-131037673 AGAAGGAAAAAGAAGGAGGAAGG + Intronic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048556299 8:135480430-135480452 AAATGCAAAGGGGAGGGGGAAGG - Intronic
1049400647 8:142425456-142425478 ACATGCAAGCAGATGGTGGATGG - Intergenic
1049782294 8:144434559-144434581 AAAGTCAAACCCAAGGAGGAGGG - Intronic
1050460427 9:5872971-5872993 AAAAGCAAAGAGAAAAAGGATGG + Intergenic
1050701915 9:8349311-8349333 AAATTCAAACAAAAGTAGGCTGG - Intronic
1050737321 9:8779041-8779063 AAAGGGAAAAAGAAGGTGGAGGG + Intronic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051569705 9:18541791-18541813 AATTGGAAACAAATGGAGGATGG + Intronic
1053943951 9:43285582-43285604 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1055055066 9:72015788-72015810 AAATGCAAGAAGAAAGAGAAAGG + Intergenic
1055116608 9:72612010-72612032 AAATCCAAACAGAAGCAGGAGGG - Intronic
1055358314 9:75460968-75460990 AAATGCTGACAGAAGCAAGATGG - Intergenic
1055372355 9:75613621-75613643 AAAAGAAAACAGAAGGAAAATGG - Intergenic
1055942020 9:81659523-81659545 AAATGTAAGCAGCAGGATGAAGG + Intronic
1056121735 9:83495049-83495071 AATTGGAAACAGTAGGAGAATGG - Intronic
1056227764 9:84512992-84513014 AGATGCCAACAGAAGAAAGAGGG + Intergenic
1057016378 9:91656355-91656377 AAATCAAAAAAGAGGGAGGACGG + Intronic
1057049606 9:91913768-91913790 AAATGCATACAGAAAGTAGAGGG + Intronic
1057353825 9:94319728-94319750 ACCTGGAAACAGAAGGAAGAAGG + Exonic
1057646074 9:96876488-96876510 AAAGGCAAACTGATGGAGGGAGG - Intergenic
1057653926 9:96937864-96937886 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1057716076 9:97497429-97497451 AAATGAGAACAGAAAGAGGAAGG + Intergenic
1059311427 9:113391198-113391220 CAATACAAACAGAAAAAGGAAGG - Intronic
1059443482 9:114323993-114324015 AAAGCCAAACAGAAGGCGGAAGG - Intronic
1059836269 9:118157419-118157441 AAGTGCAATCTGAAGGAAGAAGG + Intergenic
1061052990 9:128206977-128206999 AGCTGCAACCAGAAGGAGAATGG + Intronic
1203587086 Un_KI270747v1:14159-14181 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1185686720 X:1934884-1934906 AAAAGAAAAGAAAAGGAGGAGGG + Intergenic
1185844617 X:3426192-3426214 AAATGGAAAGAAATGGAGGATGG + Intergenic
1185966470 X:4610683-4610705 GAAAGGAAAAAGAAGGAGGAAGG + Intergenic
1186042215 X:5492959-5492981 AAATGCAAAGATAAAGGGGATGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1186791982 X:13008509-13008531 AAATGTAAACAGCAAGAGAAGGG - Intergenic
1187400708 X:18957438-18957460 AAATGCAGACCACAGGAGGATGG + Intronic
1188066267 X:25663765-25663787 AAATGCAAAGACAAGGGGAATGG - Intergenic
1189906416 X:45764836-45764858 AAATGAAAACAGTAGGAAGTAGG + Intergenic
1190101606 X:47526422-47526444 AAATGAAGACAGAAGAAGGAAGG - Intergenic
1190507379 X:51139466-51139488 AAATGACAACAGAAGGTGTAGGG - Intergenic
1191779516 X:64850444-64850466 AAAAGCTAACAGAAGAAAGATGG - Intergenic
1191915007 X:66192044-66192066 AAACACTAACAGAAGGAGGAAGG + Intronic
1192131474 X:68555602-68555624 AAAAGTAAACAGTAGCAGGAGGG - Intergenic
1192227157 X:69237223-69237245 AAATGAGAACACAAGGAGGAAGG - Intergenic
1194143022 X:90228621-90228643 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1196089456 X:111724466-111724488 ACATGCTAAATGAAGGAGGAAGG - Intronic
1197057504 X:122138595-122138617 TAATGCAAGCAGGAGGAGCATGG + Intergenic
1197127100 X:122959545-122959567 AGATGCACACAGAAGGAAGATGG + Intergenic
1197493902 X:127153831-127153853 AAATGCCACCAGATGGAGGAAGG + Intergenic
1197795905 X:130298639-130298661 AAATTGAAAGAGAAGGAGGGAGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1197867233 X:131032273-131032295 AAATAAAAACAAAAGGTGGAGGG - Intergenic
1198183549 X:134233147-134233169 AGACACACACAGAAGGAGGATGG + Intergenic
1198383379 X:136105077-136105099 AAAGGCAAGGAAAAGGAGGAAGG + Intergenic
1198896335 X:141459744-141459766 AGATGAAAAAAGAAGAAGGAAGG + Intergenic
1199165431 X:144667917-144667939 AAATGCAAAATTAAGGTGGATGG + Intergenic
1199596094 X:149507154-149507176 AAATGAGAACAGAAGAGGGAAGG + Intronic
1200037410 X:153341070-153341092 AAAAGTAAACAGATGGAGAATGG - Intronic
1200488775 Y:3797940-3797962 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1201195071 Y:11485296-11485318 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1201537751 Y:15069237-15069259 AAGTGCAAGCAGAAGCAGGTGGG + Intergenic
1202064938 Y:20929061-20929083 AAATGCACAAAGAAGTAGAACGG + Intergenic