ID: 1136398488

View in Genome Browser
Species Human (GRCh38)
Location 16:30005476-30005498
Sequence GCTGGCACGGGGAGGGCGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136398488_1136398497 3 Left 1136398488 16:30005476-30005498 CCCGGCGCCCTCCCCGTGCCAGC 0: 1
1: 0
2: 0
3: 28
4: 350
Right 1136398497 16:30005502-30005524 CACGAGTCCAGCTTCCTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 54
1136398488_1136398496 0 Left 1136398488 16:30005476-30005498 CCCGGCGCCCTCCCCGTGCCAGC 0: 1
1: 0
2: 0
3: 28
4: 350
Right 1136398496 16:30005499-30005521 ACACACGAGTCCAGCTTCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136398488 Original CRISPR GCTGGCACGGGGAGGGCGCC GGG (reversed) Exonic
900120425 1:1046486-1046508 GGAGCCAGGGGGAGGGCGCCGGG - Exonic
900342637 1:2195956-2195978 CCGGGCAGGGGGAGGGGGCCTGG + Intronic
900355080 1:2257338-2257360 GCTGCAAGGGGGAGGGCACCTGG + Intronic
900395376 1:2451214-2451236 GCTGGGAGGGGGAGGGCCCTGGG - Intronic
900991910 1:6102004-6102026 GCTGGCAAAGGGAGGGCCCTGGG - Exonic
901447262 1:9316152-9316174 GCTGGCAGGGGGTGGGGACCTGG + Intronic
901634327 1:10663613-10663635 GCTTGCACAGGGAGGGGACCAGG + Intronic
902951037 1:19882838-19882860 GCTGGCTCGCGGGAGGCGCCCGG - Intronic
903361359 1:22779307-22779329 GCTGGCACAGGGAGGGGGTGTGG - Intronic
903573162 1:24321386-24321408 ACTGGTAAGGGGAGGGCACCCGG + Intronic
903891235 1:26571917-26571939 GCTGGCAGGGTGAGTGCCCCTGG + Exonic
904050214 1:27634301-27634323 GCGGGCGCGGAGGGGGCGCCCGG + Intronic
904599851 1:31667370-31667392 GCTGCCAAGGGGAGGGTGCCAGG - Intronic
904613871 1:31739434-31739456 CCTGGCAGGGGGAGGGGCCCAGG - Exonic
905458127 1:38102610-38102632 TCTGGAACGGGGAGAGCTCCTGG + Intergenic
905625985 1:39491143-39491165 GGGGCCACGGGGAAGGCGCCAGG + Intergenic
906306948 1:44725451-44725473 CCTGGCAAGAGGAAGGCGCCTGG + Exonic
906471058 1:46131956-46131978 GCTGTCAGGGGCAGGTCGCCAGG + Exonic
906522253 1:46474562-46474584 GTTGGCACTGGGCGGGCGCGAGG - Intergenic
908829015 1:68161798-68161820 GCTGGTTGGGAGAGGGCGCCTGG + Intronic
908977718 1:69919496-69919518 TCTGGCAGGGGGAGCCCGCCAGG + Intronic
909651373 1:77979516-77979538 GCTGCCGCCCGGAGGGCGCCAGG + Intronic
910481104 1:87659347-87659369 GCTGACACGGGGATGGCAGCTGG - Intergenic
914137817 1:144917406-144917428 GCTGGCAGGGGGAGATGGCCCGG - Intronic
915163861 1:153937537-153937559 CCTGGCACAGGCAGGGCCCCAGG + Exonic
915167852 1:153958516-153958538 GCTGGTACTGGGAGGGTGGCAGG - Exonic
916651728 1:166839774-166839796 GCTGGGGCCGGGAGGGGGCCAGG + Intronic
917788807 1:178486770-178486792 GCTGGGACGCCGAGGGCGCAGGG + Intergenic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
919748698 1:201023738-201023760 GCTGGCTCGGGGCGGGCTCGGGG - Intergenic
919753372 1:201052144-201052166 GCTGCCACAGGTAGGGCGCAGGG - Intronic
919809407 1:201399356-201399378 GCTGGAAGGGGAGGGGCGCCAGG - Exonic
920182131 1:204138482-204138504 GCTGGCACTGGCAGGGCCCTGGG - Intronic
920192054 1:204199876-204199898 GCTGGCATGGGAAGGGATCCCGG + Intronic
920260458 1:204685012-204685034 GCGGCCAGGGAGAGGGCGCCTGG - Intronic
920487137 1:206381339-206381361 GCTGGCAGGGGGAGATGGCCCGG + Intronic
922418211 1:225441322-225441344 GCTGGGACGGAGAGGAGGCCAGG - Intergenic
922597552 1:226825625-226825647 ACAGGCAGGGGCAGGGCGCCGGG - Intergenic
924560657 1:245154761-245154783 GCCGGCGCGGCGAGGGCGGCAGG + Intergenic
924813690 1:247424796-247424818 GCAGCCCCGGGGAGGGAGCCAGG + Exonic
1062789057 10:289848-289870 TCTGGCACGTGGAGGACGTCAGG - Intronic
1062824507 10:557873-557895 GCAGGCAGGGGGAGGGGGCAGGG + Intronic
1064981918 10:21173984-21174006 GAGTGCACGGGGAGGGCGACGGG + Intronic
1067091388 10:43267203-43267225 ACTGGGACAGGGCGGGCGCCGGG + Intergenic
1067175309 10:43941827-43941849 GATGGCATGGGAAGGGAGCCAGG + Intergenic
1067294190 10:44965355-44965377 TCTGGAAAGGGGAGGGGGCCTGG + Intronic
1067346862 10:45443654-45443676 CCGGGCACGGGGTGGGCGCCGGG + Intronic
1067375864 10:45727312-45727334 GCTGGGATGGTGAGGGCGGCGGG + Exonic
1067883570 10:50068000-50068022 GCTAGGATGGTGAGGGCGCCGGG + Exonic
1069807430 10:71134716-71134738 GCTGGCACTGGGTGGGGCCCAGG - Intergenic
1069828536 10:71268907-71268929 GCTGGCACGGGGAGTGAGGCTGG - Intronic
1069942362 10:71964409-71964431 GCCTGAGCGGGGAGGGCGCCAGG + Exonic
1069959145 10:72069360-72069382 GCTGGCTTGGGGTGGGTGCCAGG - Intronic
1075092009 10:119449043-119449065 GCTGGCAGGGGGACTGGGCCGGG + Intronic
1075741321 10:124698186-124698208 GCAGGCACGGGCTGGGGGCCGGG - Intronic
1075903617 10:126062858-126062880 GCTGGGACGGGGACGGCACTAGG + Intronic
1076061354 10:127416615-127416637 GGTGGCACGAGGAGGGCATCAGG - Intronic
1076313454 10:129524157-129524179 TCTGGCACGGGGACGGCTCCAGG + Intronic
1076889131 10:133275451-133275473 GCTGGCCTGGGGAGGGTCCCTGG - Intronic
1076983997 11:222543-222565 GCTGGCACTGGCTGGGGGCCAGG - Intronic
1077008395 11:369597-369619 GCGGGCCCGGGGTGGGCGGCGGG - Intergenic
1077060149 11:614326-614348 GCTGGGGCAGGGAGGGGGCCTGG + Exonic
1077080042 11:721118-721140 GCTGGAAGGGGATGGGCGCCGGG - Exonic
1077182525 11:1223094-1223116 GCTGGCACGGGTGGGGGGACGGG - Exonic
1078511087 11:11984770-11984792 GCTGGGTGGGGGACGGCGCCTGG + Intronic
1081289505 11:41307396-41307418 GATGGCAGGGGGAGGGTCCCTGG - Intronic
1081727680 11:45342582-45342604 GCAGGCACAGGCAGGGCTCCCGG + Intergenic
1083172948 11:60933788-60933810 ACTGGGACGGAGAGGGCGCAGGG + Intronic
1083609478 11:63998234-63998256 GCAGGCACAGGCAGGGGGCCTGG - Exonic
1083922335 11:65787565-65787587 GCAGGCGCGGTGTGGGCGCCGGG + Intronic
1084385511 11:68841092-68841114 GCGGGCATGGGGAGGGGGACCGG + Intronic
1084433460 11:69124030-69124052 GGAGGCCCTGGGAGGGCGCCTGG - Intergenic
1084474341 11:69380476-69380498 CCTGGCACAGGGAAGGCGACGGG - Intergenic
1086996639 11:93365126-93365148 GCTGGCAAGGGGAGGGATGCTGG - Intronic
1087820422 11:102705413-102705435 GCTGGCACAGGGAGGGGGAAAGG - Intronic
1088986631 11:114914867-114914889 GCTGGCAAAGAGAGGGCACCAGG - Intergenic
1089432948 11:118437474-118437496 CCTGGCCCGGGGATGGCGCGAGG - Intronic
1089520057 11:119057292-119057314 GCTGGCAAAGGGAGGGGGCGGGG - Intergenic
1090028942 11:123191464-123191486 GCCAGCACGGGGAAGGAGCCTGG - Intronic
1091143361 11:133255165-133255187 GCAGGCACTGGGAGGGCTTCAGG - Intronic
1091218287 11:133916823-133916845 GCTGGGACAGGGAGGGAGCTGGG + Intronic
1096183942 12:49566283-49566305 GCTGGCAGGGGAAGGGGGCTGGG - Intronic
1096241678 12:49963109-49963131 GCTGGCACTGGCATGGGGCCAGG + Intronic
1096651638 12:53064798-53064820 ACTGTTACGGGGAGGGGGCCAGG + Exonic
1096786869 12:54021895-54021917 GCTGGAAAGGGGAGGGAGTCCGG - Intronic
1097863885 12:64543427-64543449 GCGGGCACGGGGGGGGCGGGCGG - Intergenic
1100260443 12:92928599-92928621 GGGGGCACGGGGAGTGCGGCGGG + Intronic
1103261938 12:119595180-119595202 GCTGGCCCGGGGGTGGCGGCGGG + Intronic
1103719571 12:122966129-122966151 GCGGGCTCCGGGAGGGCTCCAGG + Intronic
1104529258 12:129553530-129553552 GCTGGCAGGGAGAGGGAGCGTGG + Intronic
1104855884 12:131902333-131902355 GCTGGCAGAGGGTGGGAGCCTGG + Intronic
1105578879 13:21675460-21675482 GCTCGCGCGGGGAGGGCGGAGGG + Intronic
1105701303 13:22937565-22937587 GCTGGTTCGGGGAGGGGTCCAGG - Intergenic
1105854143 13:24360627-24360649 GCTGGTTCGGGGAGGGGTCCGGG - Intergenic
1106568437 13:30906410-30906432 GCTGACGCAGGCAGGGCGCCCGG + Exonic
1107835946 13:44412702-44412724 GCAGGCAAGGGGAGCGCGCGAGG + Intergenic
1108484451 13:50910096-50910118 GCGGGGACGGGGTTGGCGCCCGG + Exonic
1112343993 13:98576250-98576272 GCGGGGACGGGGAGCGCGCCTGG - Intronic
1112469237 13:99672894-99672916 GATGGCAGGGGAAGGGCGCATGG + Intronic
1114547417 14:23513073-23513095 GCTGGCAGGCGGAGGGAGCTGGG - Intergenic
1114659315 14:24334678-24334700 GCTGGCTAGGGCCGGGCGCCGGG + Exonic
1115566583 14:34630042-34630064 GCGGGCGCGGGGCGGGCGCGGGG - Intronic
1116657985 14:47675021-47675043 GCGGGCGCGGGCAGGGGGCCGGG + Intergenic
1117478147 14:56118229-56118251 GCGGGCCGGGGGCGGGCGCCTGG + Intronic
1118404829 14:65412847-65412869 GGTGGGATGGGGAGGGGGCCTGG - Intronic
1119265207 14:73260238-73260260 CCTGGCACAGAGAGGGCGCCGGG + Intronic
1119265408 14:73261071-73261093 GCTGCCACGGGGAGGATGGCAGG - Intronic
1119468947 14:74881820-74881842 ACTGGCAGGGGGTGGGCGCACGG - Intergenic
1121183515 14:91947373-91947395 GAGGACACGGGGAGAGCGCCGGG + Exonic
1122235970 14:100330772-100330794 GCTGCCCGTGGGAGGGCGCCAGG + Intergenic
1122543216 14:102509216-102509238 GCCGGCACGCGTGGGGCGCCGGG + Intronic
1122905685 14:104800572-104800594 GCGGGGACGGCGAGGGCGCCGGG - Intergenic
1122938136 14:104969330-104969352 GCAGGCACGGAGAGGCTGCCAGG - Intronic
1123032390 14:105458164-105458186 GCTGGGACGGGGAGGGGGAAGGG - Intronic
1124500775 15:30225209-30225231 GCTGGCGGGGGGCGGGGGCCCGG - Intergenic
1124742795 15:32313458-32313480 GCTGGCGGGGGGCGGGGGCCCGG + Intergenic
1127753521 15:62068285-62068307 GCGGGCTCGTGGAGGGGGCCCGG - Exonic
1127763537 15:62164306-62164328 GCGGGCTCGAGGAGGGGGCCCGG + Exonic
1127893787 15:63277473-63277495 GCAGGCACGGGGACGGGGGCGGG - Intronic
1128374436 15:67065463-67065485 CCTGCTCCGGGGAGGGCGCCCGG - Intronic
1129205063 15:74032656-74032678 ACTGGCACGGGGTGTGCCCCGGG - Exonic
1129740674 15:77988107-77988129 GCAGGGAAGGGGAGGGCTCCAGG + Intronic
1129845071 15:78764450-78764472 GCAGGGAAGGGGAGGGCCCCAGG - Intronic
1130256767 15:82329411-82329433 GCAGGGAAGGGGAGGGCTCCAGG + Intergenic
1130598182 15:85260577-85260599 GCAGGGAAGGGGAGGGCTCCAGG - Intergenic
1131021038 15:89099035-89099057 CCTGGCACAGGGAGGGTCCCTGG + Intronic
1131455057 15:92577026-92577048 GGTGGAAGGGGGAGGGCCCCAGG - Intergenic
1132496381 16:265364-265386 GCTGGCAAGGAGAGGGCACCGGG - Exonic
1132619078 16:855891-855913 GCTGGCAGGGTGAGGGCCTCTGG + Intronic
1132639542 16:971315-971337 CCTGGCTGGGGGAGGGCACCTGG - Intronic
1132815911 16:1826529-1826551 GCTGGCGCGGAGCGGGCGCGGGG - Intronic
1132829389 16:1919956-1919978 GCTGGCTCGGGGTGGGGGCTGGG + Intergenic
1132934431 16:2473676-2473698 GGAGGCACGGGGAGGACACCAGG - Intronic
1135826225 16:25731011-25731033 GTTGGCTGGGGGAGGGCACCTGG - Intronic
1136229776 16:28879470-28879492 GGAGGCAAGGGGAGGGCCCCGGG - Intronic
1136398488 16:30005476-30005498 GCTGGCACGGGGAGGGCGCCGGG - Exonic
1137531507 16:49281513-49281535 ACTGGGACGGGGGGGGCGGCTGG - Exonic
1137803974 16:51286481-51286503 GCTGTCACAGGGACGGCACCTGG + Intergenic
1138327953 16:56191298-56191320 CCCGGGACGGGGAGGGCGCGGGG - Intergenic
1139459455 16:67110135-67110157 GCTGCCGCAGGGAGGCCGCCCGG + Exonic
1139468111 16:67164845-67164867 GCAGGCACGGGGCTGGGGCCTGG - Exonic
1139516007 16:67452775-67452797 GACTGCACGGGGAGGGCACCTGG - Intronic
1139516014 16:67452797-67452819 GCAGGCTCGGGGAGGGCACCTGG - Intronic
1140406441 16:74714323-74714345 GCTGGCTTGGGAAGGGTGCCAGG + Intronic
1140423682 16:74842627-74842649 GCTGGCACAGGCAGGGCTCCAGG - Intergenic
1140431719 16:74909848-74909870 GCTGGCGCAGGCAGGGCTCCAGG + Exonic
1141068476 16:80932575-80932597 CTCGGCACGAGGAGGGCGCCCGG - Intergenic
1141385751 16:83621032-83621054 GCTGGCAGGAGGAGGGCTCGAGG - Intronic
1141790032 16:86228079-86228101 GGTGGCAGGAGGAGGGCGCGGGG - Intergenic
1142112384 16:88339514-88339536 GGTGGCAGGGGGATGGCGACAGG + Intergenic
1142163313 16:88570571-88570593 GCTGGGGCCGGGAGGGCGGCGGG + Intronic
1142859972 17:2755595-2755617 GAGGGCGCGGGGAGGGCGCGGGG - Intergenic
1142859977 17:2755606-2755628 GAGGGCGCGGGGAGGGCGCGGGG - Intergenic
1142876249 17:2853528-2853550 CCGGGGCCGGGGAGGGCGCCTGG + Intronic
1143151222 17:4808408-4808430 TCTGGCTCGGTGAGGGCGACCGG + Exonic
1144764136 17:17723770-17723792 GCTGGCGCGGGGCGCGCGCGGGG - Intronic
1144959353 17:19036129-19036151 CCTGGCACGGGGTGGGAGGCTGG - Intronic
1144975806 17:19138395-19138417 CCTGGCACGGGGTGGGAGGCTGG + Intronic
1145785149 17:27588682-27588704 CCTGGCAAGGTGAGGGCTCCAGG - Intronic
1148206791 17:45784441-45784463 GGCGGCACGGGGTGGGCGGCCGG - Intronic
1148674688 17:49438565-49438587 GCTGGATGGGGGAGGGGGCCGGG + Intronic
1148733608 17:49852079-49852101 GCTGCCACGGGCAGGGGGCCTGG + Intergenic
1149664768 17:58357908-58357930 GCTGGCTCAGGGAGGGCCCTGGG + Exonic
1150864731 17:68837716-68837738 CCTGGCACACGGAGGGCTCCTGG - Intergenic
1151954506 17:77373679-77373701 GCTCTCAGCGGGAGGGCGCCTGG - Intronic
1151972548 17:77466332-77466354 GCTGGGAGGGGGAAGGGGCCTGG - Intronic
1151977439 17:77490602-77490624 GCTGGCAAGGACAGGGCCCCGGG - Intronic
1152104844 17:78322987-78323009 GCTGGGAGTGGGAGGGTGCCGGG - Intergenic
1152378931 17:79932223-79932245 GCTGCCACGGGGCGGGCTCTGGG - Intergenic
1152676788 17:81645324-81645346 GCTGGCACTGGGAGGGCTGGTGG + Exonic
1152724802 17:81939913-81939935 TGTGGCACTGGGAGGGAGCCCGG - Exonic
1157563407 18:48664012-48664034 GGAGGCATGGGGAGGGCCCCCGG + Intronic
1158453343 18:57586347-57586369 GAGGCCGCGGGGAGGGCGCCCGG - Intronic
1159232018 18:65620381-65620403 GGTGGCATGGGGAGGACGGCAGG + Intergenic
1159596030 18:70383675-70383697 GGTGGCACGGTGGGGGCTCCTGG + Intergenic
1160164151 18:76495395-76495417 CGCGGCACGGGGAGGGGGCCGGG + Intergenic
1160508389 18:79439968-79439990 ACTGGCACGGGGAAGGCGTGTGG + Intronic
1160674627 19:383314-383336 GCGGGCCTGGGGAGGGAGCCAGG - Intergenic
1160725426 19:616119-616141 GCTGGCGGGGGGCGGGGGCCCGG - Exonic
1161062028 19:2219996-2220018 GCTGGCTGGGGGAGGCCGCCGGG - Intronic
1161166776 19:2791928-2791950 CCTGGCTGGGGGAGGGTGCCAGG - Intronic
1161265033 19:3359998-3360020 TCTGGCCCGGGGAGGGGGCGGGG - Intronic
1161366305 19:3881687-3881709 GCTGGCAGGGGGTGGGGGTCGGG + Intronic
1161510812 19:4670102-4670124 GCAGGCCCGGGGAGGGGGCGCGG - Intronic
1161705426 19:5818729-5818751 GAGGGCACGGGGAGGGGGCTGGG - Intergenic
1161963292 19:7534586-7534608 GCGGGCCTGGGGAGGGCGTCCGG - Intronic
1162935284 19:13978822-13978844 GCTGGCTCGGGCCGGGAGCCGGG + Intronic
1163102571 19:15107321-15107343 GCTGGCGCGGGGCGGGGGGCGGG + Intergenic
1163281131 19:16318503-16318525 CTTGGCACTGGGAGGGGGCCTGG - Intergenic
1163831530 19:19549457-19549479 GCTGGCGGGGAGAGGGCGCTGGG - Intergenic
1165157287 19:33796283-33796305 GCTGGGCCGCGGAGGGCGCTGGG + Intronic
1165243103 19:34482458-34482480 GCGGGCGCGGGGCAGGCGCCGGG - Exonic
1165310385 19:35026207-35026229 GCTGGCACGGTGTGAGCGCCAGG + Exonic
1165774237 19:38395530-38395552 CCTGGCAGGGGCAGGGGGCCTGG + Exonic
1165803183 19:38565370-38565392 GCTGGCGCGGGGGCGGCGGCGGG + Exonic
1166663384 19:44661912-44661934 TCTGGCACAGGGAGGGAGGCTGG - Exonic
1167096039 19:47375578-47375600 GCCAGCACGAGGAGGGCGCGGGG + Exonic
1167268961 19:48497698-48497720 GTGGGCACGGGGACGGCCCCCGG - Exonic
1167661178 19:50796889-50796911 TCTGGCCCTGGGAGGGAGCCTGG + Intergenic
1167709067 19:51099053-51099075 GCTGGCCCGGGGCGGGGGCCTGG - Exonic
1167781374 19:51601265-51601287 GCTGGCCCGGGGCGGGGGCCTGG + Intergenic
1168701322 19:58441166-58441188 CCTGGCACACCGAGGGCGCCTGG + Intergenic
927591295 2:24360303-24360325 GGAGGCGCGGCGAGGGCGCCAGG - Exonic
929427177 2:41855200-41855222 GCTGCCCAGGGGAGGGGGCCTGG - Intergenic
929580150 2:43076898-43076920 CCTGGAACGGGGAGGGCACTGGG + Intergenic
931501605 2:62875057-62875079 GCTGGCAGGGGCAGGGTGGCAGG - Intronic
931728226 2:65130599-65130621 GCGGGGGCGGGGAGGGGGCCGGG + Intergenic
932245170 2:70190752-70190774 GCTCGCGCGGGGAGGATGCCGGG - Intronic
932492724 2:72132125-72132147 GCCGGAACGGGGAGGGCGAGTGG - Exonic
932773596 2:74514671-74514693 GCTGGCCAAGGCAGGGCGCCGGG - Exonic
934117852 2:88813030-88813052 GCTGGCTCATGGAGGGCCCCAGG + Intergenic
934539088 2:95159683-95159705 GCTGGCGCGGGGCGGACGCGGGG - Intronic
934539097 2:95159706-95159728 GCTGGCGCGGGGCGGACGCGGGG - Intronic
934539106 2:95159729-95159751 GCTGGCGCGGGGCGGACGCGGGG - Intronic
936349760 2:111703779-111703801 CCTGGCACAGGGAAGGTGCCGGG - Intergenic
937043063 2:118835901-118835923 CCTGGCGCGGGGAGGCGGCCGGG + Intergenic
937181254 2:119997765-119997787 GCTGGCTGGGGGAGGGGGGCGGG - Intergenic
937252613 2:120534102-120534124 GCTGGGACTGGGAGGCCCCCTGG - Intergenic
938111963 2:128573840-128573862 GCTGCCCTGGGGAGGGTGCCTGG - Intergenic
938291822 2:130154641-130154663 GCTGACATGGGGAGGGCGGATGG + Intronic
938464726 2:131518323-131518345 GCTGACATGGGGAGGGCGGATGG - Intergenic
941819288 2:169828142-169828164 GCTGTCAAGGGGAGGGTGCGGGG + Intronic
941978994 2:171434430-171434452 GCTGACACGGGGAGGCGGGCAGG - Exonic
945996941 2:216445521-216445543 GCTGGCCTGGGGATGGAGCCAGG - Intronic
946335172 2:219031137-219031159 GCTGGTACGGGGCGGGCAGCCGG - Exonic
947697447 2:232203738-232203760 GCAGGCATGGGTAGGGCGCATGG + Intronic
948432867 2:237931148-237931170 GCTGGCACTGGCAGGGCCCTGGG + Intergenic
948896735 2:240931150-240931172 GCTTGCACAGGGAGGGCCCGGGG + Intronic
948991674 2:241558859-241558881 GCGTGGACGGGGCGGGCGCCGGG + Exonic
949014353 2:241701464-241701486 GTTGGCGGGGGAAGGGCGCCAGG + Intergenic
1169143407 20:3238389-3238411 GCAGGCGCGGGGCGGGAGCCGGG + Intronic
1171154223 20:22857455-22857477 GGTGGCACAAGGAGGGAGCCTGG + Intergenic
1174250966 20:49219311-49219333 GGTCGAACGGGGAGGGCGGCAGG + Exonic
1175723210 20:61300130-61300152 GGTGGCATGGGGAGGGCGGGTGG + Intronic
1175962318 20:62643220-62643242 GCCTGCACCTGGAGGGCGCCCGG - Exonic
1175985612 20:62762904-62762926 GCTGGCGGGTGGGGGGCGCCGGG + Intergenic
1176229294 20:64023634-64023656 GTGGGCATGGGGAGGGGGCCAGG - Intronic
1176234835 20:64049380-64049402 GCGGGCGCGGCGAGGGCGGCGGG + Exonic
1178436931 21:32567825-32567847 GCTGCCACAGGCATGGCGCCAGG - Intergenic
1178843733 21:36157294-36157316 GCCGGCCCCGGGAGGGCGCGCGG - Intronic
1180062238 21:45391391-45391413 GGTGGCACGGGCAGGGTGCGTGG + Intergenic
1180064294 21:45405058-45405080 GCGGGCAGGGGGCGGGCGCGGGG - Intergenic
1180833574 22:18918808-18918830 GGTGGCATGGGGAGGGGTCCAGG - Intronic
1180836947 22:18934707-18934729 GCTGGGATGGGGAGGGGGCTAGG - Intronic
1184043434 22:41957924-41957946 GCGGGCTGGGGGAGGGCGCCCGG - Intergenic
1184067155 22:42127419-42127441 GCTGGGGTGAGGAGGGCGCCAGG + Intronic
1184069880 22:42141124-42141146 GCTGGGGTGAGGAGGGCGCCAGG + Intergenic
1184265550 22:43343999-43344021 TCTGGAACCGGGCGGGCGCCCGG + Intergenic
1184691051 22:46117413-46117435 GCTGGCACAGGGATGCCCCCAGG - Intergenic
1184693980 22:46129781-46129803 GCTGGCACTGGGAGGGTCCCAGG - Intergenic
1184853880 22:47136167-47136189 GCTGGCACTGGGAGGCCTCAGGG - Intronic
1185397553 22:50600660-50600682 GGCGGCGCGGGGAGGGCGGCGGG - Intronic
1203283659 22_KI270734v1_random:144106-144128 GGTGGCATGGGGAGGGGTCCAGG - Intergenic
1203287040 22_KI270734v1_random:160006-160028 GCTGGGATGGGGAGGGGGCTAGG - Intergenic
950043127 3:9933026-9933048 GCTGGCACAGGGCCGACGCCAGG - Exonic
950530388 3:13549441-13549463 GCCGGCGCGGGGTGGGGGCCAGG + Intronic
950940278 3:16884671-16884693 GTTGCCCCGGGGTGGGCGCCCGG + Intronic
952254336 3:31682439-31682461 CCTGGCACGGGGATGGAGACAGG - Intronic
952334299 3:32391796-32391818 GCTGGCGAGGGCGGGGCGCCCGG - Exonic
953518726 3:43621765-43621787 GCTGGCACCGGGAGGCGGCCCGG + Intronic
953866138 3:46584986-46585008 GCTGCCCCCGGGAGGGCGCATGG + Intronic
954130658 3:48559087-48559109 GCTGGCCTGGGCAGGGGGCCAGG + Intronic
955993861 3:64657795-64657817 GCTGCCACTGGGAAGGGGCCTGG + Intronic
957555664 3:81761803-81761825 GCTGGCACCTGGAGGCCGCAGGG + Exonic
960038363 3:113124359-113124381 GCTGGGAGAGGGAGGGAGCCAGG + Intergenic
961380911 3:126496047-126496069 GCTGGATCCGGGAGGCCGCCAGG - Exonic
961475347 3:127142544-127142566 GCTGACAGGTGGAGGGCCCCAGG + Intergenic
961695151 3:128698924-128698946 GCTGGAGAGGGGAGGGCGCCGGG - Intergenic
961771453 3:129253053-129253075 GCTGCCACGGGGTGGGCAGCTGG - Intronic
961780537 3:129317781-129317803 GCTGGCAGGGGCATGGAGCCAGG + Intergenic
962918940 3:139934705-139934727 ACTGGTCTGGGGAGGGCGCCAGG - Intergenic
963733102 3:148991563-148991585 GCCGGCACCGGGAGGGAGCGCGG - Exonic
965615264 3:170586088-170586110 GCAGGCACGGGGAGGGGTTCGGG - Intronic
966866457 3:184261287-184261309 GCGGGCGCGGGGTGGGCGCGGGG + Exonic
967858248 3:194134261-194134283 GGTGCCACGTGGCGGGCGCCGGG - Intergenic
968093012 3:195909685-195909707 GCCGGCGCGGGGCGGGCGCCCGG - Intronic
968478879 4:825390-825412 GCGGGGACTGGGAGGGCGGCGGG + Intronic
968509443 4:988935-988957 GCTTCCTCGGGGAGGGCCCCGGG - Exonic
968514261 4:1009798-1009820 GCGGGGACGGGGAGGGGGCGGGG - Intergenic
968660026 4:1795009-1795031 GGCGGGCCGGGGAGGGCGCCTGG + Intronic
968674501 4:1870643-1870665 GCTCGCGAGGGGAGGACGCCTGG - Intergenic
968762681 4:2450717-2450739 GCTGGAACAGGGAGGGTGCAGGG - Intronic
969347860 4:6580495-6580517 GCTGGCACGGGGCAGGAGGCAGG - Intronic
969570205 4:8003931-8003953 GGTGGGACGGGCAGGGCACCTGG - Intronic
971452601 4:26813927-26813949 GCTGGCATGAGGAGGGAGACAGG - Intergenic
972726748 4:41751688-41751710 GCTTGGCCGGGGAGGGTGCCCGG + Intergenic
973619469 4:52712558-52712580 TCTCCCGCGGGGAGGGCGCCCGG + Intergenic
975657481 4:76656079-76656101 TCAGGCATGGTGAGGGCGCCAGG + Intronic
975701901 4:77075373-77075395 GCTGCCACGGGGGCGGCGCGGGG + Intronic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
985016398 4:185639304-185639326 GCGGGGAAGGGGAGGGAGCCTGG + Intronic
985318386 4:188682017-188682039 CCTGGAACCGGGAGGGCGCTGGG + Intergenic
985516431 5:347731-347753 GCTGGCACGTGCAGGGGTCCTGG + Intronic
985520988 5:373829-373851 GCCCGCCCGGGCAGGGCGCCAGG - Intronic
985525624 5:400034-400056 GCGGGCACCGGGCGGGCGTCGGG - Intronic
985995936 5:3596704-3596726 CCTGGCTCGGCCAGGGCGCCCGG + Intronic
986709054 5:10474433-10474455 GCTGTCACTGCGAGGGCACCAGG + Intergenic
986866994 5:12000972-12000994 GCTGGGACAGGGAGGACGTCAGG + Intergenic
987311517 5:16685674-16685696 GCAGGGACGGGGAGGGCGTCAGG - Intronic
990699395 5:58459668-58459690 GGTGACAAGCGGAGGGCGCCGGG - Exonic
990947261 5:61262231-61262253 GCTGGCATGGGCAGGGCTCTGGG - Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
997597946 5:135119599-135119621 GCTGGCAAGAGCAGGGCTCCGGG + Intronic
999747615 5:154604259-154604281 GCTGGCACAGAGAGGGCTGCTGG + Intergenic
1001147188 5:169195183-169195205 GGTGGCAGGGGAAGGGGGCCAGG - Intronic
1001617755 5:173056595-173056617 GCCGGCGCGGGGCGGGGGCCGGG + Intronic
1001639523 5:173234942-173234964 GCATGCAGGAGGAGGGCGCCAGG + Exonic
1002211888 5:177604331-177604353 GCAGGCACGGGGAGGGCCCGAGG - Exonic
1004218469 6:13724246-13724268 ACTAGCACGGGGAGGAAGCCAGG + Intergenic
1006369217 6:33633819-33633841 GCGGGCGCGGGGCGGGCGCGGGG + Intronic
1006635357 6:35457695-35457717 GCTGGCTGGGGGAGGGGGACTGG + Intronic
1007110999 6:39313568-39313590 GCTGGGACGGCAGGGGCGCCGGG - Intronic
1007383211 6:41503859-41503881 GCGCGCGCGGGAAGGGCGCCCGG + Intergenic
1007600368 6:43077198-43077220 CCTGGCACGGAGTGGGCGCAGGG - Intronic
1008920989 6:56843866-56843888 GCGGGCCTGGGGAGGGGGCCTGG - Intronic
1011603344 6:89080368-89080390 GGGGGCAGGGGGAGGGCGGCAGG - Intergenic
1013459041 6:110358080-110358102 GCTGGCCCGGCGCGGGCGGCAGG + Exonic
1014297770 6:119641442-119641464 GCAGGCAAGGGGAGGGTCCCAGG + Intergenic
1017913919 6:158818309-158818331 GCGGGCATGGGGAGGGGGCACGG + Intronic
1018150277 6:160931168-160931190 GCAGGCACGGGGCTGGGGCCCGG + Intergenic
1019421659 7:953859-953881 GCTGCTCCGGGGCGGGCGCCAGG - Intronic
1019747634 7:2709495-2709517 TGGGGCAGGGGGAGGGCGCCTGG + Intronic
1021909958 7:25375580-25375602 CCTTGCACAGGGAGGGAGCCGGG + Intergenic
1022230737 7:28410030-28410052 GCGGGCGCGGCGAGGACGCCGGG + Intronic
1024241567 7:47440079-47440101 GGGGGCACCGGGAGGGGGCCAGG + Intronic
1025040106 7:55634501-55634523 CCTGTCACGGGGTGGGGGCCAGG + Intergenic
1025258506 7:57400834-57400856 GCAGGCACTGGGAGGGAGGCCGG + Intergenic
1026759441 7:73115415-73115437 GCTGACACCTGGAGGGTGCCAGG + Intergenic
1026875947 7:73879279-73879301 GCTGGGACGGGGAGCGAGCTTGG - Intergenic
1027087969 7:75278058-75278080 GCTGACACCTGGAGGGTGCCAGG - Intergenic
1029394080 7:100295191-100295213 GCTGACACCTGGAGGGTGCCAGG - Intergenic
1029655259 7:101919821-101919843 GCTGTGACGGGGAGGTGGCCAGG + Intronic
1030041345 7:105453120-105453142 GCTTGCAGGGGGAAGGAGCCTGG + Intronic
1032220056 7:129987853-129987875 GTTGTCATGGGGAGGGCGCTAGG - Intergenic
1032279076 7:130486554-130486576 GCTGGCGAGGGGAGGGCTCCCGG + Intronic
1032500630 7:132397020-132397042 GCTGGCACAGGGATGGGGGCTGG + Intronic
1034286548 7:149887476-149887498 GCTGGCACCTGGAAGGCGCCTGG - Intergenic
1034494117 7:151410001-151410023 GCTCGGCCGGGGAGGGCGCGGGG - Intronic
1034817970 7:154190255-154190277 GCTGCCCCGGGGAGGTCTCCAGG + Intronic
1034951236 7:155298119-155298141 GCTGGCCCCGGGCGGGCGCACGG + Intronic
1035583602 8:755699-755721 GCTGGCATGGCTAGGGGGCCTGG + Intergenic
1035709968 8:1705547-1705569 GCTGGTTCGGGGAGGGCCCCTGG + Exonic
1040536972 8:48319103-48319125 GCTGGGCCGGGAAGGGCGCACGG + Intergenic
1040876625 8:52159027-52159049 GCTGGCACGGCCAGGGCTCTGGG + Exonic
1041107999 8:54459652-54459674 GCTCGCCCGGGGCGGGCGGCGGG + Exonic
1041327244 8:56681573-56681595 GAAAGCACGGAGAGGGCGCCAGG + Intergenic
1044988536 8:97775773-97775795 GCGGGGACGGGGAGGGGGCGGGG - Exonic
1045277467 8:100721289-100721311 GCGGGCCCGGGGAGGGGGGCGGG - Intronic
1049065604 8:140311278-140311300 GGTGGCAGGGTGAGGCCGCCAGG + Exonic
1049192679 8:141297262-141297284 GCGGGCACCCGGTGGGCGCCGGG + Intronic
1049838515 8:144755332-144755354 GAGGGCGCGGGGAGGGCGCGGGG - Intronic
1051215782 9:14795877-14795899 GCTGGCAGGGTGAGGGCCCCGGG - Intronic
1053163490 9:35829323-35829345 GCGGGCCCGGGGCGGGGGCCGGG - Intronic
1053174628 9:35912985-35913007 GCGGGCATGGGGAGGGAGCCTGG + Intergenic
1056578038 9:87870721-87870743 GCGGGCAGGGTGAGGCCGCCAGG + Intergenic
1058175996 9:101737626-101737648 GTAAGCCCGGGGAGGGCGCCAGG - Exonic
1060558460 9:124522676-124522698 GTTGGCCTGAGGAGGGCGCCTGG + Exonic
1060999974 9:127897489-127897511 GCTCCCACGGGGAGGGGGCGGGG - Intronic
1061003640 9:127916469-127916491 GCTGGGAAGGGGTGGGAGCCGGG + Exonic
1062130400 9:134889658-134889680 GCTGGTACTGGGTGGGCACCTGG + Intergenic
1062275544 9:135728655-135728677 GCTGGGAAGGGGAGAGGGCCGGG + Intronic
1062332796 9:136051846-136051868 CCTGGGGCGGGGAGGGCGCAGGG + Intronic
1062349894 9:136133429-136133451 GCTGGGTCGGGGAGACCGCCCGG + Intergenic
1062458695 9:136653789-136653811 GCTGGCAGGGAGTGGGTGCCCGG + Intergenic
1062492841 9:136815673-136815695 GCTGGCACTGTGAGAGGGCCTGG + Intronic
1062526629 9:136980489-136980511 CCTGGCACAGAGTGGGCGCCTGG - Intronic
1062546586 9:137066310-137066332 TCGGGCACGGGGAGCCCGCCGGG + Exonic
1062630809 9:137462364-137462386 GCTGGGACGGGGTAGGGGCCGGG - Intronic
1185494699 X:545475-545497 GCAGGCACGTGGAGGGTGGCGGG + Intergenic
1185836196 X:3347204-3347226 TCTGGCAAGGGGAGGGAGGCGGG - Intergenic
1189001935 X:36957499-36957521 CCTGGCCCGCGGAGGGAGCCCGG - Intergenic
1190105927 X:47561293-47561315 CCGGGCACGGGCAGGGAGCCCGG + Intronic
1190897612 X:54636514-54636536 GGTGGGAGGGGGAGGGGGCCAGG - Intergenic
1192168521 X:68840719-68840741 GCTGGCAAGGGGAGGGGGTGTGG - Exonic
1199662175 X:150063041-150063063 GCTGGAACGTTGAGGTCGCCTGG - Intergenic
1200101582 X:153691246-153691268 GGTGGCAGGGGGAGGTGGCCAGG + Intronic
1200306106 X:155027188-155027210 GCGGGGACGGGGAGGGCGCTCGG + Intronic
1200829112 Y:7673376-7673398 GGTGGCAGGGGGAGGGCAGCGGG - Intergenic
1200829150 Y:7673446-7673468 TCTGGCAGGGGGAGGGCGGAGGG - Intergenic