ID: 1136399653

View in Genome Browser
Species Human (GRCh38)
Location 16:30010566-30010588
Sequence TGTCCCCCAAGGGGCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 194}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136399637_1136399653 25 Left 1136399637 16:30010518-30010540 CCAGCTCCTTCCTCTCCTCCGGG 0: 1
1: 0
2: 6
3: 72
4: 741
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399643_1136399653 7 Left 1136399643 16:30010536-30010558 CCGGGGCTCCCCTCTGCTCCTGA 0: 1
1: 0
2: 5
3: 54
4: 612
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399642_1136399653 10 Left 1136399642 16:30010533-30010555 CCTCCGGGGCTCCCCTCTGCTCC 0: 1
1: 0
2: 4
3: 44
4: 514
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399641_1136399653 15 Left 1136399641 16:30010528-30010550 CCTCTCCTCCGGGGCTCCCCTCT 0: 1
1: 0
2: 5
3: 58
4: 502
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399640_1136399653 19 Left 1136399640 16:30010524-30010546 CCTTCCTCTCCTCCGGGGCTCCC 0: 1
1: 1
2: 3
3: 85
4: 665
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399644_1136399653 -1 Left 1136399644 16:30010544-30010566 CCCCTCTGCTCCTGAGCCTGCCT 0: 1
1: 3
2: 5
3: 79
4: 592
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399645_1136399653 -2 Left 1136399645 16:30010545-30010567 CCCTCTGCTCCTGAGCCTGCCTG 0: 1
1: 0
2: 17
3: 65
4: 598
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399646_1136399653 -3 Left 1136399646 16:30010546-30010568 CCTCTGCTCCTGAGCCTGCCTGT 0: 1
1: 1
2: 18
3: 73
4: 674
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136399653 Original CRISPR TGTCCCCCAAGGGGCCCTGC AGG Intronic
900120242 1:1045743-1045765 TGATCCCCAAGGCGCCGTGCGGG + Exonic
900288066 1:1911244-1911266 TGTCCCCACCAGGGCCCTGCCGG + Intergenic
900540376 1:3199743-3199765 CGAGCCCCAAGGGGCCCTCCGGG + Intronic
900647249 1:3714540-3714562 TGTCCCACGAGGGGCCCAGCAGG - Intronic
900971778 1:5995939-5995961 AGTCTCCCAAGAGGCCCTGGAGG + Intronic
901739875 1:11334986-11335008 TGGGCCACTAGGGGCCCTGCTGG - Intergenic
902256388 1:15191505-15191527 TGGCCCCCAGAGGCCCCTGCTGG + Intronic
902715471 1:18269780-18269802 TCTTTCTCAAGGGGCCCTGCGGG - Intronic
903345127 1:22679648-22679670 TGTCCACCAAGGAGCCACGCAGG + Intergenic
904082303 1:27879890-27879912 TATCCCAGAAGGGGCCCTTCTGG + Exonic
904988691 1:34573886-34573908 TCTTCTCCAAGAGGCCCTGCTGG - Intergenic
905295669 1:36952993-36953015 TGTCCTCCGAAGGGCTCTGCAGG + Intronic
909434922 1:75630151-75630173 TGCCACCCAGAGGGCCCTGCGGG - Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
915962430 1:160278505-160278527 TCTGCCCCATGGGGCCTTGCAGG + Exonic
918235958 1:182581060-182581082 TATCCCCCTAGGCTCCCTGCCGG - Intronic
919738335 1:200967717-200967739 TGTCCCCCACTGCACCCTGCAGG + Intergenic
919917937 1:202150580-202150602 AGTCCCCTTGGGGGCCCTGCTGG + Intronic
920499963 1:206479892-206479914 CGTCCCCAAAGTGGACCTGCAGG + Exonic
1066305326 10:34134782-34134804 TGTTCCCCAAGGGGGCTTGACGG - Intronic
1066351111 10:34637660-34637682 TGCCCCCCAGTGGGCACTGCCGG + Intronic
1067441093 10:46309589-46309611 GGGCCCCCATGAGGCCCTGCTGG + Intronic
1067577740 10:47418852-47418874 GGTCACCCATGAGGCCCTGCTGG + Intergenic
1067836627 10:49645556-49645578 TGGCCCCCAACAGGTCCTGCCGG + Intronic
1069594950 10:69664428-69664450 TGTACCCCATGGGGCCCTGTGGG - Intergenic
1070287692 10:75095563-75095585 TGTTCCCCAAGGTGCACTTCTGG - Exonic
1072899010 10:99391114-99391136 TGGCCCCCAAGGGGCGCAGGAGG + Intronic
1073789445 10:106925274-106925296 TGGCCCACAAAGGGCCCTGGAGG - Intronic
1076618051 10:131770033-131770055 TGTCCCCCAAGGGGCTATTATGG - Intergenic
1076887546 10:133269566-133269588 TGGACCCCAAGGGGCCGTGGGGG + Intronic
1079116787 11:17645309-17645331 AGTCCTCAAGGGGGCCCTGCTGG + Intronic
1080648341 11:34203516-34203538 TGTCCCCTGAGGGGCCCCACAGG - Intronic
1080897062 11:36455771-36455793 GGCCTCCCAAGGGGCCCAGCAGG + Intronic
1081875987 11:46408682-46408704 TGTCCTCCATGTGGCTCTGCTGG + Exonic
1081968509 11:47183629-47183651 TGTTCCCCACGGAGCCTTGCGGG - Intronic
1083535235 11:63461020-63461042 TGTCACCCAAGGGTCCCTTCTGG + Intergenic
1084183202 11:67456639-67456661 TGAGCCCCAAGGGGCTCTCCTGG - Intronic
1084212942 11:67632193-67632215 TGTCCACACAGGGGCCCTGTGGG + Intronic
1084556012 11:69876239-69876261 TGTCCCCCAAGGAAGCCTGTTGG + Intergenic
1084575683 11:69986459-69986481 TGTCTCCCCAGGGGCCGCGCAGG - Intergenic
1088367339 11:109053362-109053384 TGTTCCACAGGGGGTCCTGCAGG - Intergenic
1089119824 11:116125648-116125670 TGTCCACCCTGGGGCTCTGCTGG + Intergenic
1089690421 11:120183697-120183719 TGTCCTCCAAGAGGCCCTCCTGG + Intronic
1089752637 11:120662302-120662324 TTTCCAGCCAGGGGCCCTGCTGG + Intronic
1090733182 11:129589373-129589395 TTGCCCCCAAGAGGCTCTGCAGG + Intergenic
1091997943 12:5009950-5009972 TGTCCCACAAATGTCCCTGCTGG + Intergenic
1095982809 12:47982575-47982597 TGAGCCCCAGGGGGGCCTGCTGG + Exonic
1096785538 12:54015243-54015265 GGTCCCTCAAGGAGCCCTTCAGG - Intronic
1097175778 12:57142143-57142165 TTTCCCCCAAAGGGCCCTGTGGG + Intronic
1100400506 12:94225203-94225225 AGCCTCCCAAGGTGCCCTGCAGG - Intronic
1101754757 12:107612885-107612907 TGCCGGCCGAGGGGCCCTGCTGG - Intronic
1102351272 12:112194021-112194043 TGTGCCCTAAGGTACCCTGCGGG - Intronic
1103184713 12:118946457-118946479 TGGGCCCCAAGGGGCACTTCTGG - Intergenic
1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG + Intergenic
1104795107 12:131511790-131511812 TATTCCCTAAAGGGCCCTGCAGG + Intergenic
1104872728 12:132011936-132011958 TTTCCCCCTGGAGGCCCTGCTGG + Intronic
1104993774 12:132641720-132641742 TGTCCTCCAGGGAGGCCTGCTGG + Exonic
1106705880 13:32279054-32279076 TGTCCTCCATGGGGCCATACAGG - Intronic
1112370398 13:98788382-98788404 TGACCCCCAGAGGGCCCTGGTGG - Intergenic
1113508399 13:110832290-110832312 TATCACCCAAGGGGCTCTGTGGG + Intergenic
1113846408 13:113394135-113394157 AGTCCGCCAGGGGGCGCTGCCGG - Intergenic
1118281167 14:64430174-64430196 TGTCCCCTAGGTGGCGCTGCAGG + Exonic
1122267622 14:100554067-100554089 TGAAGCCCATGGGGCCCTGCCGG + Intronic
1122367047 14:101200520-101200542 TGTCCTCCAGGGAGCCATGCAGG + Intergenic
1122830672 14:104394098-104394120 AGTCACCCCAGGAGCCCTGCGGG + Intergenic
1123065762 14:105618409-105618431 TGCCCTTCAAGGGGCCCTACGGG - Intergenic
1123069923 14:105637655-105637677 TGCCCTTCAAGGGGCCCTACGGG - Intergenic
1123072536 14:105648769-105648791 TGACCCCCACTGGGCCCTGGTGG + Intergenic
1123089160 14:105734442-105734464 TGCCCTTCAAGGGGCCCTACGGG - Intergenic
1123094946 14:105762599-105762621 TGCCCTTCAAGGGGCCCTACGGG - Intergenic
1123098122 14:105775996-105776018 TGGCCCCCACTGGGCCCTGGTGG + Intergenic
1124155484 15:27221563-27221585 TGTACCCCAAGGGACTCTCCGGG - Intronic
1124651652 15:31478633-31478655 TGTTCCCAAGGGGTCCCTGCAGG + Exonic
1125676252 15:41503976-41503998 TGAGCCCCAAGGGGCCCTGAGGG - Exonic
1125719195 15:41836985-41837007 CCTCCCCCCAGAGGCCCTGCTGG - Intronic
1126898444 15:53286001-53286023 TGTCCCCTAAGAGGACCTTCTGG - Intergenic
1128450819 15:67805010-67805032 TGTGCCCTTAGGGGTCCTGCAGG + Intronic
1130664685 15:85859851-85859873 TGTCTCCCTAAGGGACCTGCGGG + Intergenic
1130869999 15:87962948-87962970 TGTTCCCCAAAGGGCTCTTCTGG - Intronic
1131109813 15:89758274-89758296 AGTCGCCCCAGGGGCCCAGCTGG + Intergenic
1131965943 15:97842393-97842415 TGTCCCCTAAATGTCCCTGCTGG + Intergenic
1131989238 15:98077221-98077243 TGTTCCAGAATGGGCCCTGCGGG - Intergenic
1132206933 15:99992832-99992854 TGAGCCCCAAGGGGCAGTGCTGG + Intronic
1132745213 16:1433594-1433616 TGCCCCTCCAGGGGCTCTGCTGG - Intergenic
1134243362 16:12522051-12522073 TGGCCCCGAGGGGCCCCTGCTGG + Intronic
1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG + Intronic
1138556510 16:57774026-57774048 TGTCCCCCAGGAGGCCTGGCTGG - Intronic
1141410078 16:83827233-83827255 TCCCACCCAAGGGGGCCTGCGGG + Intergenic
1145251460 17:21298990-21299012 TCCCCCCAAAGTGGCCCTGCAGG - Intronic
1145749028 17:27342026-27342048 TGGCCCTGAAGGGGCCCTGGGGG - Intergenic
1145992391 17:29086902-29086924 TGTCCCCCACGGGGCCCACATGG - Intronic
1146213094 17:30957118-30957140 TTTCCCCCAAGGGGCTGTGCGGG - Intronic
1146933343 17:36793553-36793575 TGTCACCCAAAGGCCTCTGCTGG + Intergenic
1147132184 17:38415906-38415928 TGTTCCCCAGGGAGCCCTGGAGG + Intergenic
1147458270 17:40552217-40552239 TGTCCCCGAGGGGAACCTGCCGG - Intergenic
1147965464 17:44192239-44192261 TGTTCCCTCAGGGTCCCTGCTGG + Exonic
1148394810 17:47299462-47299484 TGTCCCCATAGGAGCCCGGCTGG - Exonic
1152716097 17:81901634-81901656 TGCCCCCCAAGGGGCAGAGCTGG + Intronic
1152735543 17:81995300-81995322 TGGCCCCCCAGGGCCCCTCCGGG - Intronic
1153816435 18:8794353-8794375 TGTCCCCCAAGGTACCCAGGGGG + Intronic
1154067180 18:11118287-11118309 TGTACCCCCAGGGCCCCTCCAGG - Intronic
1157136428 18:45061324-45061346 TGTCCCTCAAAGGGCCTAGCAGG - Intronic
1160616783 18:80136685-80136707 TGTCACCCCTGGGGTCCTGCAGG + Exonic
1160667719 19:340884-340906 CTTCCCCCTGGGGGCCCTGCTGG - Intronic
1160762262 19:791671-791693 CGTCCCCTAAGAGGCCCTGTGGG - Intergenic
1160883266 19:1332174-1332196 CATCCCCCAAGGGGCTGTGCTGG - Intergenic
1160980966 19:1816419-1816441 TGGCCCTGAAGGTGCCCTGCCGG - Exonic
1161562067 19:4978947-4978969 CTTCCACCAAGAGGCCCTGCGGG - Intronic
1161681541 19:5682136-5682158 TGCACCCCATGAGGCCCTGCAGG - Intronic
1162451371 19:10757158-10757180 AGACCCCCCAGGGGCGCTGCTGG - Intronic
1163000131 19:14362068-14362090 TGTGGCCCACAGGGCCCTGCAGG - Intergenic
1163681432 19:18684519-18684541 TGTCCCCCAGGGGGTCCAGAGGG + Intronic
1163800391 19:19361422-19361444 CGAGCCCCAAGGGGCTCTGCTGG + Intergenic
1165383326 19:35495869-35495891 TGTCCCCCTGGGATCCCTGCAGG - Intergenic
1167612133 19:50512705-50512727 TGTGGCCCGAGGGGCCCTGTGGG - Exonic
1167785188 19:51630205-51630227 TGTCCCCCCAGGGTCCCTGCAGG - Intronic
1167787287 19:51646629-51646651 TGTCCCCCCAGGGTCCCTGCAGG - Exonic
925107152 2:1301333-1301355 TGTCCTCCAGGGGGACCTGCAGG + Intronic
929552033 2:42900408-42900430 AGTTCCCCAAGGGCCTCTGCTGG + Intergenic
938070837 2:128307345-128307367 TGAACCCCATGGGACCCTGCTGG - Intronic
946188266 2:217994033-217994055 TGACCACCAGGGGGCACTGCTGG - Intronic
946193817 2:218021748-218021770 TGTCCCCCAAGGAGACCAGGAGG + Intergenic
948845938 2:240682864-240682886 TGTCCCCTCAGGTGTCCTGCAGG - Exonic
948847918 2:240691865-240691887 TGTCCCCTCAGGTGTCCTGCAGG + Exonic
948891020 2:240907136-240907158 TGTCCCCCGAGAGGCCCTGCTGG - Intergenic
1171177251 20:23061699-23061721 GGTCCCTTAAAGGGCCCTGCAGG + Intergenic
1171179897 20:23084670-23084692 AGTCCCACAAGGGGCCCCGAGGG - Exonic
1172283474 20:33724554-33724576 CTGCCCTCAAGGGGCCCTGCAGG + Intergenic
1173124792 20:40326792-40326814 TCTCCCTCCAGGGGCCCTGCAGG - Intergenic
1174393534 20:50232711-50232733 TGTGCCCCAAGAAGCTCTGCTGG + Intergenic
1175935721 20:62513078-62513100 TCTCCCCCGAGGAGCTCTGCCGG + Intergenic
1176047309 20:63099648-63099670 TGTCCCCCAAGGTGCCCATGAGG + Intergenic
1176239267 20:64068414-64068436 CTTCCCCCAAGGCCCCCTGCTGG + Intronic
1176240446 20:64073530-64073552 GGTCCCCCCAGGAGCCATGCTGG - Exonic
1178664050 21:34531401-34531423 TGTCCTCCTATGTGCCCTGCAGG + Intronic
1179439110 21:41380778-41380800 TCTCCCCCGAGGGGCCCTAGTGG + Intronic
1179912538 21:44457722-44457744 TCTCCCACACGGGGCCCTGCAGG + Exonic
1180049785 21:45325872-45325894 TGCCCCCCAAGGGGCCTGGCTGG + Intergenic
1180146154 21:45920188-45920210 TGTCACCAGAGGGTCCCTGCAGG - Intronic
1180197648 21:46207243-46207265 TGGACCCCTAGGGGCCTTGCTGG - Intronic
1180895753 22:19331121-19331143 TGTCCACCTTGGGGCCGTGCTGG + Exonic
1181037942 22:20178931-20178953 TGTCCCTCAAGGGGTCTTGCTGG - Intergenic
1181572164 22:23773478-23773500 TGTCCCCCGCGGGCACCTGCCGG + Intronic
1182272753 22:29165815-29165837 AGTCCCCCTAGGGACCCGGCAGG - Intronic
1182295428 22:29309209-29309231 GGTGCCCCAGGGGGCTCTGCAGG + Intronic
1183367053 22:37412499-37412521 TCTGCCCCAAGGGGCCAAGCAGG + Intronic
1183641463 22:39095441-39095463 TGTGACCCCAGGGGCCATGCAGG + Intergenic
1184339870 22:43880332-43880354 TCACCCCCAAGGGCCGCTGCAGG + Exonic
1184666625 22:45992703-45992725 TGTCCCCATAGGGCCCCTGCAGG + Intergenic
1185294084 22:50044890-50044912 TCTCCCCAAAGGGGCCCCGTGGG - Intronic
950462969 3:13136063-13136085 TGTCCCGCAGGCGGCCCTGTGGG - Intergenic
950638509 3:14332947-14332969 TGTCCCCACAGGGGCCCAGCTGG + Intergenic
950708341 3:14797691-14797713 TGTGGCCCAAGGGGCTCTACGGG + Intergenic
954705322 3:52477430-52477452 TGTCCCACCAGTGGTCCTGCAGG + Intronic
956366053 3:68504298-68504320 TGGCAGCTAAGGGGCCCTGCTGG - Intronic
956835827 3:73095304-73095326 TGTCACCCAGGAGTCCCTGCTGG + Intergenic
961827137 3:129605146-129605168 TGTCCCCCGAGGGGTACTACTGG - Intronic
964720502 3:159764304-159764326 CGTCCCCCAAGGAGGCCTGGGGG - Intronic
966895747 3:184443798-184443820 TGTCCCCCAGGTGGCTCTGGAGG - Intronic
968389706 4:180126-180148 TCTCTCCCAGGAGGCCCTGCTGG - Intergenic
969204730 4:5634908-5634930 CGTCCACCAAAGGGCTCTGCAGG + Intronic
969329985 4:6468983-6469005 TGTGCCCCCAGGTGGCCTGCAGG + Intronic
969898896 4:10330185-10330207 TGTGCCCCCAGGGGCCTGGCAGG - Intergenic
972293515 4:37714496-37714518 TGTCCCCCATAGGTCCCTGCAGG - Intergenic
973684925 4:53359969-53359991 TGGCCCCCTAGGGGCACTGAGGG - Intronic
981517413 4:145624895-145624917 TGGCCCCCAAGTGGTCATGCAGG + Intronic
983014648 4:162597949-162597971 GGTCACCCAAGGGGCTCTGATGG - Intergenic
985825169 5:2185989-2186011 TTTCTCCCCAGTGGCCCTGCGGG - Intergenic
985860576 5:2467398-2467420 TGTACCCCAAGGCTTCCTGCTGG - Intergenic
992039626 5:72816926-72816948 TGCCCGCCCAGGCGCCCTGCGGG + Intronic
997659664 5:135579481-135579503 TGACCCCCAAGGGCCCCTGCTGG + Intergenic
997716905 5:136049261-136049283 TGGCCCCCAGGGGGCCTTGCTGG - Intronic
1001244810 5:170098190-170098212 TGTCCTGCAAGGGGCCAGGCAGG + Intergenic
1004883253 6:20028863-20028885 TGTTCTCCAAGGTGCCTTGCTGG - Intergenic
1005858635 6:29884376-29884398 TGTGCCACAAGCAGCCCTGCAGG + Intergenic
1010282974 6:74041580-74041602 CCTCCCCCAAGGAGCCCTGATGG + Intergenic
1010461674 6:76120750-76120772 AGTCCTCCAAAGGGTCCTGCTGG + Intergenic
1011766847 6:90629544-90629566 CATCCCCCAAGAGGCCCTGGTGG - Intergenic
1015514596 6:134071568-134071590 TGTTCCCCATGGGGCCCTGGAGG + Intergenic
1018172655 6:161154105-161154127 TGTGTCCCAAGGGCTCCTGCAGG - Intronic
1018808684 6:167281501-167281523 ACTTTCCCAAGGGGCCCTGCAGG - Intronic
1019157843 6:170050957-170050979 GGTGGCCCATGGGGCCCTGCTGG + Intergenic
1019175988 6:170159795-170159817 TGTCACCCAAGAAGCCGTGCCGG - Intergenic
1019725873 7:2602418-2602440 TGTCCCTGAAGGGGCCCTAGAGG - Intronic
1019799082 7:3074575-3074597 TCACCCCCAGGGGCCCCTGCAGG - Intergenic
1022513733 7:30962132-30962154 TGTTCCCCAAGGATCCCTGCAGG - Intronic
1024608553 7:51043411-51043433 TCTCCCACAAGGGGCTCTTCTGG + Exonic
1029243052 7:99178098-99178120 TATCCCCCAAAGGCTCCTGCCGG - Intronic
1029425803 7:100493509-100493531 TGCCCCCCAACGGCCTCTGCTGG - Intronic
1032439653 7:131932675-131932697 TGTCCCCCAAGAGGGCCTGAGGG - Intergenic
1034488426 7:151380622-151380644 AGTCTGCCGAGGGGCCCTGCAGG - Intronic
1035203689 7:157281492-157281514 TGGGCACCAAGGGGTCCTGCCGG + Intergenic
1036581033 8:10076248-10076270 TGTCCCCTAAGTGTCCCTACTGG - Intronic
1037581161 8:20246792-20246814 TGTCCCCAAAGGACGCCTGCAGG - Exonic
1038324993 8:26566334-26566356 CCTCCCTAAAGGGGCCCTGCAGG + Intronic
1042945932 8:74154428-74154450 TGTCCCCCCTTGGGCCATGCTGG - Intergenic
1049249522 8:141580768-141580790 TGTCAGCCAAGGGGCACTCCTGG - Intergenic
1049592463 8:143468835-143468857 TGTCCCCAGAGGGGCCTGGCAGG - Intronic
1049781808 8:144432534-144432556 TTTCCCCAAAGGGGTCCTGAGGG - Intronic
1056275200 9:84987998-84988020 TAGCCCCCATGGGGCTCTGCAGG + Intronic
1056942152 9:90964949-90964971 ACTCCCCCAAGGGGTCCTCCTGG + Intergenic
1057487954 9:95500657-95500679 TGTCCCCCCAGGAGCCCTTGTGG - Intronic
1057553150 9:96066836-96066858 TGTCCCCAAAGGGGGCATGGGGG - Intergenic
1059359856 9:113733807-113733829 TGTCCCCCATCTGCCCCTGCAGG - Intergenic
1060809764 9:126604854-126604876 TGTCCCCCAAGCAACCCCGCTGG - Intergenic
1060976090 9:127766116-127766138 CGTTCCCCCAGGGGCCCTGTAGG + Intronic
1060994624 9:127868999-127869021 GGTCTCCCAAGGGCCCCTGAGGG + Intronic
1061067616 9:128288449-128288471 TGTCCCCCACGGGCCCCACCTGG - Intronic
1061263975 9:129495198-129495220 TGACCCCCAGGGGATCCTGCAGG + Intergenic
1062216923 9:135394220-135394242 TGCCCCACAAGGCGCCCAGCAGG - Intergenic
1062270774 9:135707355-135707377 TGTCCCCAAGGGTCCCCTGCCGG + Intronic
1062271594 9:135712391-135712413 TGTGACCCAAGGGGCCCTGGAGG - Intronic
1062606870 9:137352392-137352414 TGTCCCCCCAGGGTCCCTCATGG + Intronic
1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG + Intronic
1191902270 X:66053560-66053582 TGTTCCCTCAGGGTCCCTGCTGG + Intergenic
1192207987 X:69108756-69108778 TGTCTCCCAAGAGGCCCTGGGGG - Intergenic
1197104800 X:122701346-122701368 TGTCCTCCAAGGAGCCTTACAGG + Intergenic
1197726514 X:129780569-129780591 TCTCACTCAAAGGGCCCTGCTGG + Intronic
1200149617 X:153944792-153944814 AGTCCCTCCAGGGCCCCTGCTGG + Intergenic
1200238159 X:154479070-154479092 TTCCCGCCAAGCGGCCCTGCCGG + Exonic