ID: 1136399653

View in Genome Browser
Species Human (GRCh38)
Location 16:30010566-30010588
Sequence TGTCCCCCAAGGGGCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 194}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136399641_1136399653 15 Left 1136399641 16:30010528-30010550 CCTCTCCTCCGGGGCTCCCCTCT 0: 1
1: 0
2: 5
3: 58
4: 502
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399643_1136399653 7 Left 1136399643 16:30010536-30010558 CCGGGGCTCCCCTCTGCTCCTGA 0: 1
1: 0
2: 5
3: 54
4: 612
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399640_1136399653 19 Left 1136399640 16:30010524-30010546 CCTTCCTCTCCTCCGGGGCTCCC 0: 1
1: 1
2: 3
3: 85
4: 665
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399644_1136399653 -1 Left 1136399644 16:30010544-30010566 CCCCTCTGCTCCTGAGCCTGCCT 0: 1
1: 3
2: 5
3: 79
4: 592
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399646_1136399653 -3 Left 1136399646 16:30010546-30010568 CCTCTGCTCCTGAGCCTGCCTGT 0: 1
1: 1
2: 18
3: 73
4: 674
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399645_1136399653 -2 Left 1136399645 16:30010545-30010567 CCCTCTGCTCCTGAGCCTGCCTG 0: 1
1: 0
2: 17
3: 65
4: 598
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399637_1136399653 25 Left 1136399637 16:30010518-30010540 CCAGCTCCTTCCTCTCCTCCGGG 0: 1
1: 0
2: 6
3: 72
4: 741
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194
1136399642_1136399653 10 Left 1136399642 16:30010533-30010555 CCTCCGGGGCTCCCCTCTGCTCC 0: 1
1: 0
2: 4
3: 44
4: 514
Right 1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136399653 Original CRISPR TGTCCCCCAAGGGGCCCTGC AGG Intronic