ID: 1136399837

View in Genome Browser
Species Human (GRCh38)
Location 16:30011267-30011289
Sequence GAGCGTGCACACGTGGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136399837_1136399847 21 Left 1136399837 16:30011267-30011289 CCCGTGCCCACGTGTGCACGCTC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1136399847 16:30011311-30011333 CGCGCGCTGGCACACTTACCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
1136399837_1136399844 8 Left 1136399837 16:30011267-30011289 CCCGTGCCCACGTGTGCACGCTC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1136399844 16:30011298-30011320 GCACACACCCAGGCGCGCGCTGG 0: 1
1: 0
2: 2
3: 9
4: 136
1136399837_1136399841 -2 Left 1136399837 16:30011267-30011289 CCCGTGCCCACGTGTGCACGCTC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1136399841 16:30011288-30011310 TCACACCCTTGCACACACCCAGG 0: 1
1: 0
2: 2
3: 61
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136399837 Original CRISPR GAGCGTGCACACGTGGGCAC GGG (reversed) Intronic
900101921 1:965642-965664 GTGGGTGCACACGCGTGCACTGG + Exonic
900126167 1:1069809-1069831 GCGGGTTCACACGTGGTCACCGG - Intergenic
900478710 1:2888098-2888120 GTGCGTGCACACGTGGGATGGGG - Intergenic
900582825 1:3417711-3417733 TAGGGTGCTCAGGTGGGCACTGG - Intronic
900935011 1:5759518-5759540 GAGAGTTCCCACGTGGGCAGGGG - Intergenic
901844392 1:11972785-11972807 GAGGGTGCACACATGGGGCCTGG - Intronic
903307241 1:22421663-22421685 GAGGGTGCAGACTTGGGAACTGG - Intergenic
910374323 1:86552564-86552586 ACGCGTGGACACGTGAGCACTGG - Intronic
912212987 1:107575380-107575402 GAGCCTGCCCACTTGGCCACAGG + Intronic
1063159630 10:3409825-3409847 GTGTGTGCACAGGTGTGCACAGG - Intergenic
1064175623 10:13072528-13072550 GAGCCTGCTCACATGTGCACTGG + Intronic
1066045538 10:31592258-31592280 GAGCATGCACAGGTGAGCACAGG - Intergenic
1066460463 10:35608300-35608322 GCGCGTGCACCCGGGGGCGCCGG - Exonic
1070826729 10:79394534-79394556 GTGCCTGCACACATGGACACAGG - Intronic
1073448025 10:103592596-103592618 GTGCGTGCACATGTGGGGGCAGG + Intergenic
1076670373 10:132117653-132117675 GAGGGTGCAGGCGTGGGCTCGGG + Intronic
1076673458 10:132135702-132135724 GAGCGGGTTCACCTGGGCACTGG + Intronic
1077009423 11:373588-373610 GAGTGTGCGCAAGTGTGCACAGG - Intronic
1077119620 11:900867-900889 GGGGGTGGACAGGTGGGCACTGG - Intronic
1078182118 11:9020602-9020624 GAGCCTGCACACGAGTGCAGAGG + Intronic
1082079966 11:48005327-48005349 GAGTGAGCACTCGTGGGCATGGG - Intronic
1083815631 11:65130880-65130902 GAGCCTGCACAGCAGGGCACAGG - Intronic
1084473702 11:69377142-69377164 GTGCGTTCACAGGTGGGCATGGG - Intergenic
1084590266 11:70086111-70086133 GAGCGTCCTCACGTAGCCACAGG + Intronic
1087974356 11:104525937-104525959 GAGCATGTACATGTGGGTACTGG + Intergenic
1088045375 11:105443991-105444013 GAGCCTGGACCCATGGGCACTGG - Intergenic
1088507793 11:110542799-110542821 TAGCATGCACACTTGGGTACTGG - Intergenic
1089632253 11:119791196-119791218 GTGTGTGCACATGTGGGCAGGGG + Intergenic
1096224824 12:49860357-49860379 GCGCGTGCAATCGCGGGCACTGG - Intergenic
1097155630 12:57010215-57010237 GAGCGTGCGCACCTGGGGATTGG + Exonic
1101071359 12:101079685-101079707 GACCGTGCCCAGGTGTGCACAGG + Intronic
1101425332 12:104583516-104583538 GAGGGTGCACACGTGAGCTTTGG - Intronic
1101892498 12:108730461-108730483 GAGCGTGCGCCGGTGGGGACAGG + Intronic
1104716387 12:131019027-131019049 AAGTGTGCACACCCGGGCACAGG - Intronic
1108648377 13:52452092-52452114 CTGCGTGCCCACGTGGGCAGAGG + Intergenic
1109173039 13:59119344-59119366 CAGCATCCACACCTGGGCACTGG - Intergenic
1113008743 13:105739228-105739250 GAGGTTGCACACGTGGGGGCAGG - Intergenic
1113465068 13:110507023-110507045 GAGCATGCACACGTGTCCATGGG - Intronic
1113644181 13:111980719-111980741 ATGCGTGCACACGTGGACACAGG + Intergenic
1114667836 14:24390920-24390942 GGCTGTGCACATGTGGGCACTGG + Intergenic
1117938579 14:60936105-60936127 GAGCATGCCCACATGCGCACTGG - Intronic
1127688973 15:61376047-61376069 GAGCATGAACATGTGGGCAGGGG + Intergenic
1128541497 15:68537688-68537710 CAATGTGAACACGTGGGCACAGG - Intergenic
1131177819 15:90220953-90220975 GAGGGTGGACACATGGGCTCAGG - Intronic
1132830514 16:1925787-1925809 GTGAGTGTGCACGTGGGCACAGG + Intergenic
1133227814 16:4350954-4350976 GAGCGAGCAGCCGTGGGCAGCGG - Intronic
1133333950 16:4994712-4994734 GAGCGTGCACAGGAGGGGGCAGG - Intronic
1136399837 16:30011267-30011289 GAGCGTGCACACGTGGGCACGGG - Intronic
1142302576 16:89267083-89267105 GGGCGTGCACAGCTGGCCACGGG + Intergenic
1143433991 17:6909134-6909156 GGGTGTGCACACATGTGCACTGG + Intronic
1149302593 17:55318655-55318677 GAGTCTGCACACGGGGGAACAGG - Intronic
1151379062 17:73712283-73712305 GTGCGTGCACATGTGGGGGCCGG + Intergenic
1152088271 17:78233134-78233156 GCGTGTGCACACGTGCACACAGG - Intronic
1152746528 17:82042665-82042687 GAGCATTCACACGGGGACACAGG + Intergenic
1152746544 17:82042807-82042829 CAGCATGCACACGGGGACACAGG + Intergenic
1152859889 17:82690234-82690256 GAGTGTGCACACGTGTTCTCGGG + Intronic
1152922088 17:83070945-83070967 GAGCGCACACACGTGCACACAGG + Intergenic
1153525127 18:5987438-5987460 GTGCATCCACACGTGGCCACGGG - Intronic
1154219712 18:12441335-12441357 GAGCGAGCCCACGTCTGCACAGG - Intergenic
1156098708 18:33566801-33566823 GAGCATGCCCACATGTGCACTGG - Intergenic
1160204582 18:76822520-76822542 GGGCGCGCACGCGCGGGCACCGG - Intergenic
1160536307 18:79596171-79596193 GTGCGTGCACACTGGGTCACAGG - Intergenic
1161615721 19:5269185-5269207 ACGTGTGGACACGTGGGCACGGG - Intronic
1162735581 19:12745309-12745331 GAGCCTTCCCACCTGGGCACAGG - Intronic
1163416167 19:17187766-17187788 CAGGGTGCACACGTGGGTGCTGG - Intronic
1163820188 19:19492087-19492109 CAGGGTGCCCACCTGGGCACTGG + Intronic
1163822937 19:19506471-19506493 GAGCGTGCACAGGTGTGTGCAGG + Exonic
1164449349 19:28346749-28346771 GAGCGTGCACACATGCACATGGG + Intergenic
1167906617 19:52665807-52665829 GTGAGTGCACACTTGGGCAAGGG - Intronic
925194128 2:1909795-1909817 GAGCTTCCACACGTGTGCACAGG + Intronic
926199083 2:10780491-10780513 GGGCGTGCACAGGTGCGCATGGG - Intronic
937456513 2:122046124-122046146 GTGCATGCACACATGTGCACAGG - Intergenic
937502225 2:122491654-122491676 GAGCATGGACAAGTGGGGACTGG - Intergenic
937898515 2:126997356-126997378 CAGCGGGAACACGTGGACACAGG + Intergenic
939143171 2:138379465-138379487 GAGCTTGCCCCCATGGGCACAGG + Intergenic
942841244 2:180364158-180364180 GAACGAGAACACGTGGACACAGG + Intergenic
943351245 2:186798900-186798922 GAGTGAGAACACGTGGACACAGG + Intergenic
946371267 2:219282940-219282962 GAGCTTGCAAACGTGGGAAGGGG - Intronic
947232783 2:227904764-227904786 GAGTGTCTGCACGTGGGCACAGG - Intronic
1169872345 20:10261409-10261431 GAGGGTGCAAACGTAGGCAAGGG - Intronic
1175657352 20:60782620-60782642 GAGCGTGCACACGTGTGTGGCGG + Intergenic
1175793859 20:61758953-61758975 GAGTGTGCACATGTGCGCATGGG + Intronic
1175841311 20:62029463-62029485 GCGCGCGCGCACGTGGGCACTGG - Intronic
1176192009 20:63815990-63816012 CAGTGGGCACAGGTGGGCACAGG + Intronic
1176192029 20:63816070-63816092 CAGTGGGCACAGGTGGGCACAGG + Intronic
1176654021 21:9573921-9573943 CAGGCTGCACACCTGGGCACAGG - Intergenic
1177834142 21:26170907-26170929 GCGCGTGCACCTGTGGGCGCGGG - Intronic
1180185005 21:46135143-46135165 GAGGCTGCACACGTGGGAGCTGG - Intergenic
1180337265 22:11589211-11589233 GAGTGAGAACACGTGGACACAGG - Intergenic
1181950533 22:26550613-26550635 GAGCCTGAGCACGTGGGCACTGG - Intronic
1182053304 22:27329767-27329789 GAGCATGCAAAATTGGGCACTGG + Intergenic
1183381066 22:37490821-37490843 GAGTGTGCAAACCTGCGCACAGG + Exonic
1184639937 22:45865324-45865346 GCGTGTGCACACGTGCACACAGG + Intergenic
949166956 3:954392-954414 GAGCATGCCCACATGTGCACTGG - Intergenic
951017036 3:17742640-17742662 GAGCGTGGTCACGTGGCCGCTGG - Intronic
956893914 3:73640434-73640456 GAGCTTGCACGCATGGGCCCAGG - Intergenic
957108551 3:75923804-75923826 GAGTTTGCACATGTGTGCACTGG + Intronic
958801807 3:98764575-98764597 GAGCTTTCACAAGTGAGCACAGG - Intronic
961574484 3:127823304-127823326 GGCCGGGCACACGTGGGCCCCGG - Intergenic
968081164 3:195847746-195847768 GAGTCTGCAGAGGTGGGCACAGG - Intergenic
969204383 4:5632199-5632221 GTGCATGCACATGTGTGCACAGG + Intronic
969302002 4:6302559-6302581 CAGTCTGCACACGTGGGCACAGG - Exonic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
969903541 4:10371991-10372013 GAGCCTGCCCACATGCGCACTGG - Intergenic
969962911 4:10964225-10964247 GTGTGTGCACACGTGAACACAGG + Intergenic
980613316 4:135185440-135185462 GAGCATGCTCAGGTGTGCACTGG - Intergenic
985000042 4:185473416-185473438 AAGCGTGCACACCAGGGCGCAGG + Intergenic
989718423 5:44493627-44493649 GACATTGCACACCTGGGCACTGG + Intergenic
996759521 5:126973308-126973330 TAGCATGCAAACGTGGACACAGG - Intronic
1001491876 5:172161829-172161851 GAGTGTGCACACCTGGGCATGGG - Intronic
1002938863 6:1698703-1698725 GGTCGCGCACACGTGGGCACTGG - Intronic
1007694980 6:43726180-43726202 GAGGGTACACAGGTGGCCACAGG - Intergenic
1007943731 6:45806365-45806387 GAGCCTGCACTCGGGGTCACTGG + Intergenic
1008764245 6:54891939-54891961 GAGCCAGCACACCTGGCCACAGG + Intronic
1018824363 6:167398067-167398089 GACCGTGCGCACCTGGGCCCAGG + Intergenic
1019159865 6:170062656-170062678 GAGCAGCCACACGTGGGCACAGG - Intergenic
1023388962 7:39688977-39688999 GAGCGAGCACACGCGAGCAAGGG + Intronic
1025196747 7:56940178-56940200 CAGCGTGCACACCTGCACACCGG - Intergenic
1025280367 7:57622585-57622607 CAGGCTGCACACCTGGGCACAGG - Intergenic
1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG + Intergenic
1025675200 7:63636759-63636781 CAGCGTGCACACCTGCACACCGG + Intergenic
1029595905 7:101537592-101537614 GAGCCTGCAGACCTGGGCAGAGG - Intronic
1032325824 7:130927305-130927327 CAGCGTGTTCACGTGGGAACTGG - Intergenic
1034819763 7:154205917-154205939 GAGCAGGCACAAGTGGGCTCAGG + Intronic
1034949005 7:155284553-155284575 GAGCTTGGACACGGAGGCACTGG - Intergenic
1035548698 8:503436-503458 GTGCGTGCTGAGGTGGGCACGGG - Intronic
1036459488 8:8939133-8939155 CAGCCTGCAAAAGTGGGCACTGG + Intergenic
1037709582 8:21345128-21345150 GAGGGCGCACACCTGGGCCCTGG + Intergenic
1041372020 8:57171887-57171909 GAGTGTGCACACGTGTCCCCTGG + Intergenic
1042522255 8:69726084-69726106 GAGCGTGCACACATGTGCTTGGG + Intronic
1045499863 8:102736934-102736956 GAGGCTGGACAGGTGGGCACGGG - Intergenic
1046635140 8:116666968-116666990 GAGCGTGTACACATGCACACAGG - Intronic
1048450867 8:134532866-134532888 GAGTATGCCAACGTGGGCACCGG - Exonic
1049239672 8:141530792-141530814 CAGTGTGCACAAGTGGGCAGAGG - Intergenic
1049247504 8:141570611-141570633 CAGGGTGCACAGGAGGGCACAGG + Intergenic
1049251155 8:141589763-141589785 GTGTGTGCACACGTGTGTACAGG + Intergenic
1051064764 9:13089347-13089369 GTGCGTGCACAGATGAGCACTGG + Intergenic
1053000513 9:34574942-34574964 GGGCCTCCACATGTGGGCACAGG - Intronic
1054948553 9:70823558-70823580 GTGCATGCACACGTGTGCATTGG - Intronic
1061408274 9:130404639-130404661 GTGTGTGTACACGTGTGCACAGG + Intronic
1061436219 9:130563844-130563866 GGGCGTGTACACGAGGGGACAGG - Intergenic
1062568649 9:137174432-137174454 GAGCGTGTGGAGGTGGGCACAGG + Intergenic
1203631741 Un_KI270750v1:77373-77395 CAGGCTGCACACCTGGGCACAGG - Intergenic
1189594821 X:42553031-42553053 CAGCGTGAACACATGGGCACAGG - Intergenic
1190691004 X:52913164-52913186 GACTGTGCACACCTGGGCAGAGG + Intergenic
1190694979 X:52942628-52942650 GACTGTGCACACCTGGGCAGAGG - Intronic
1197971348 X:132118558-132118580 GAGCATGCCCACATGCGCACTGG - Intronic
1199654451 X:149980873-149980895 GAGCTTGAACACGTGGGCTATGG - Intergenic