ID: 1136399930

View in Genome Browser
Species Human (GRCh38)
Location 16:30011598-30011620
Sequence CCTACGGACGTGGGGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136399930_1136399948 25 Left 1136399930 16:30011598-30011620 CCTCCCTTCCCCACGTCCGTAGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1136399948 16:30011646-30011668 GGTCGCCTGCTGTCACCGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 81
1136399930_1136399941 1 Left 1136399930 16:30011598-30011620 CCTCCCTTCCCCACGTCCGTAGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1136399941 16:30011622-30011644 ACCCACAGGTTGACAGGAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 214
1136399930_1136399947 21 Left 1136399930 16:30011598-30011620 CCTCCCTTCCCCACGTCCGTAGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1136399947 16:30011642-30011664 AGGGGGTCGCCTGCTGTCACCGG 0: 1
1: 0
2: 0
3: 6
4: 81
1136399930_1136399946 4 Left 1136399930 16:30011598-30011620 CCTCCCTTCCCCACGTCCGTAGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1136399946 16:30011625-30011647 CACAGGTTGACAGGAGCAGGGGG 0: 1
1: 1
2: 2
3: 29
4: 374
1136399930_1136399945 3 Left 1136399930 16:30011598-30011620 CCTCCCTTCCCCACGTCCGTAGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1136399945 16:30011624-30011646 CCACAGGTTGACAGGAGCAGGGG 0: 1
1: 0
2: 3
3: 39
4: 329
1136399930_1136399940 -5 Left 1136399930 16:30011598-30011620 CCTCCCTTCCCCACGTCCGTAGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1136399940 16:30011616-30011638 GTAGGGACCCACAGGTTGACAGG 0: 1
1: 0
2: 0
3: 8
4: 75
1136399930_1136399950 27 Left 1136399930 16:30011598-30011620 CCTCCCTTCCCCACGTCCGTAGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1136399950 16:30011648-30011670 TCGCCTGCTGTCACCGGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 79
1136399930_1136399949 26 Left 1136399930 16:30011598-30011620 CCTCCCTTCCCCACGTCCGTAGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1136399949 16:30011647-30011669 GTCGCCTGCTGTCACCGGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 108
1136399930_1136399943 2 Left 1136399930 16:30011598-30011620 CCTCCCTTCCCCACGTCCGTAGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1136399943 16:30011623-30011645 CCCACAGGTTGACAGGAGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136399930 Original CRISPR CCTACGGACGTGGGGAAGGG AGG (reversed) Intronic
900657830 1:3768751-3768773 CCCACGGGTGTGGGGAAGTGAGG + Intronic
901210888 1:7525397-7525419 CCTGCGGATGTGGAGATGGGGGG - Intronic
902380566 1:16050462-16050484 CCTTGGGATGTGGGAAAGGGAGG + Intronic
902395532 1:16130485-16130507 CCTATGGAGGTGGGCAGGGGAGG + Intronic
905309729 1:37041095-37041117 CCTCTGGACCTGGGGCAGGGAGG - Intergenic
906239814 1:44235892-44235914 CCTAGGGACTCTGGGAAGGGGGG + Intronic
914688253 1:150001864-150001886 CTTAAGGACGTGTGGAAGGATGG - Intronic
916776326 1:167968552-167968574 TCTAGGGACGTGGGGAAATGAGG + Intronic
918101115 1:181375729-181375751 CTCACGGAGGAGGGGAAGGGGGG - Intergenic
920174669 1:204093106-204093128 CATAGGGACGTGGGGACGTGGGG + Intronic
1069826929 10:71260297-71260319 CCTAGGGTTGTGGGGAAAGGCGG - Intronic
1071203143 10:83243367-83243389 CCAATGGAAGTAGGGAAGGGAGG + Intergenic
1071771889 10:88738327-88738349 CCCAAGGAGTTGGGGAAGGGAGG + Intronic
1077888907 11:6405002-6405024 CCTTGGGGGGTGGGGAAGGGAGG + Intronic
1078372539 11:10761283-10761305 CCCCCGGGCCTGGGGAAGGGGGG + Intronic
1078432280 11:11297493-11297515 CCCAGGGAGGTGGGCAAGGGAGG - Intronic
1080871834 11:36243234-36243256 GGTAAGGACGTTGGGAAGGGTGG + Intergenic
1081569152 11:44278815-44278837 CCTGAGGACCTGGGGAGGGGAGG + Intronic
1082026012 11:47572912-47572934 CCTAAGGCTGTGGGGAGGGGAGG - Exonic
1085305876 11:75485893-75485915 GCTAGGGCCCTGGGGAAGGGGGG + Intronic
1089736547 11:120553687-120553709 CCTATGGGCCTGGGGAGGGGAGG + Intronic
1093488866 12:19681981-19682003 ACTGCGGAAGTGGGAAAGGGAGG - Intronic
1094513929 12:31117361-31117383 CCTAAGCCCGGGGGGAAGGGGGG - Intergenic
1095646104 12:44549370-44549392 CATAGGGAAGAGGGGAAGGGTGG + Intronic
1096529150 12:52232605-52232627 CCTACTGGAGTGGGGAGGGGAGG + Intronic
1098601775 12:72340068-72340090 CATAAGGAAGTGGGGAAGGTAGG - Intronic
1100564825 12:95785607-95785629 TCTATGGAAGTGGGGAAAGGAGG + Intronic
1102030385 12:109736907-109736929 CCTAGGGAGTTGGGGCAGGGTGG - Intronic
1104154751 12:126120680-126120702 GGTACCGACGTGGGCAAGGGTGG - Intergenic
1107742316 13:43464420-43464442 CCTGGGGACCTGGGGAAGGAGGG + Intronic
1112737963 13:102442825-102442847 ACTACAGAAGTGGGAAAGGGAGG + Intergenic
1116888945 14:50248985-50249007 CCTATGCACTTGGGAAAGGGAGG + Intronic
1119526302 14:75325103-75325125 CCTTCTCACGTGGGGAAGTGGGG + Intergenic
1119674301 14:76542332-76542354 GCTACGGGGGTGGGGCAGGGTGG - Intergenic
1120266686 14:82259768-82259790 CCTACTGAAATGGGGGAGGGGGG - Intergenic
1122081443 14:99270462-99270484 CAGACGGAGGTGGGGAAGTGGGG + Intronic
1124856289 15:33392397-33392419 CGTAGGGAAGTGGGGAAGTGAGG + Intronic
1126110739 15:45173404-45173426 CCCACAGCTGTGGGGAAGGGAGG + Intronic
1130795389 15:87203250-87203272 CCTGTGGAAGTGGGGAAAGGTGG + Intergenic
1131212526 15:90510225-90510247 TCCAAGGACGTGGGGCAGGGGGG + Intergenic
1131283749 15:91040808-91040830 ACTATGGAGGTGGGTAAGGGTGG + Intergenic
1132467498 16:84179-84201 CCTACTGAGGTGGGTCAGGGTGG + Intronic
1134435994 16:14257576-14257598 CCTACGGATGAGGGGATGAGGGG + Intronic
1135901476 16:26464240-26464262 ATTACGGAAGTGGGAAAGGGAGG + Intergenic
1136255208 16:29034388-29034410 CATATGGAAGAGGGGAAGGGAGG + Intergenic
1136399930 16:30011598-30011620 CCTACGGACGTGGGGAAGGGAGG - Intronic
1141846194 16:86610731-86610753 CATATGGGAGTGGGGAAGGGAGG + Intergenic
1142190801 16:88716466-88716488 CCCAGGGACCTGGCGAAGGGAGG - Exonic
1142697975 17:1643967-1643989 CCTGCGGGGGTGGGGACGGGAGG + Exonic
1146229438 17:31095154-31095176 CCCACGGGGGTGGGGATGGGGGG - Exonic
1149710967 17:58741858-58741880 TCCACGGACGAGGGGCAGGGGGG - Intergenic
1152300962 17:79495249-79495271 CCTCCTGAAGGGGGGAAGGGAGG + Intronic
1152636608 17:81432855-81432877 CCTGGGGATGGGGGGAAGGGTGG - Intronic
1152636635 17:81432904-81432926 CCTGGGGATGGGGGGAAGGGTGG - Intronic
1155066983 18:22276448-22276470 CCCAGGGACGTGGGGCGGGGAGG + Intergenic
1155913883 18:31536954-31536976 TCCACTGACATGGGGAAGGGGGG - Intronic
1158187788 18:54791547-54791569 GATACGGAAGAGGGGAAGGGAGG + Intronic
1160404400 18:78635238-78635260 CCGACGGGCCTGGGGAAGGAAGG - Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160893034 19:1389420-1389442 CCTGCGGCCGTGGAGCAGGGCGG + Intronic
1160904823 19:1447127-1447149 CCACCGGAGGTGGGGGAGGGTGG - Intronic
1161550726 19:4910580-4910602 CCTCTGGTCGTGGGGAAGGAGGG + Intronic
1162585018 19:11553188-11553210 CCCAGGGACCTGGGGAACGGCGG + Exonic
1162909729 19:13842499-13842521 CCTACGGAGCGGGGGAAGGGCGG - Intergenic
1163130177 19:15267587-15267609 TCTACAGAGGTGGGGAGGGGAGG - Intronic
1164201678 19:23024351-23024373 CCTACGGGCGGGGGGGGGGGGGG - Intergenic
1165666636 19:37636049-37636071 CCTACGAATGTGGGGAATGTGGG - Exonic
937669664 2:124524911-124524933 TCTAGGGATGTGGGGAAGGAGGG - Intronic
937987678 2:127645825-127645847 CCTACTGATGGGGGGCAGGGAGG - Intronic
941353674 2:164463284-164463306 CCCACTGTTGTGGGGAAGGGAGG - Intergenic
941666462 2:168247632-168247654 CCGGCGGAGGCGGGGAAGGGAGG + Exonic
941699796 2:168592359-168592381 GCTCAGGACGTGGGAAAGGGAGG + Intronic
944440703 2:199740556-199740578 CCCACGAAGCTGGGGAAGGGAGG - Intergenic
946074735 2:217064481-217064503 CCTAGGGACCTGGGAAAGGCTGG + Intergenic
1171291807 20:23986645-23986667 CCTAGGGAGGTGGGGAGGGAGGG + Exonic
1173800375 20:45891241-45891263 CCTACGGACCTGGGGGGCGGTGG - Exonic
1175196182 20:57244791-57244813 CCTCCTGTCCTGGGGAAGGGAGG - Intronic
1178891289 21:36523042-36523064 CCTGGGGAGGTGGGGAGGGGTGG - Intronic
1179982816 21:44905417-44905439 CCTTGTGCCGTGGGGAAGGGTGG - Intronic
1180002204 21:45000291-45000313 ACCACGGAGGTGGGGATGGGTGG - Intergenic
1182829636 22:33294578-33294600 CCCATGGAGGTGGGGAAGGGAGG - Intronic
1183093901 22:35541065-35541087 CCTAGAGACTTGGGGAGGGGGGG - Exonic
1184838515 22:47038428-47038450 CCCATGGAGGTGGGGAAGGCTGG + Intronic
1185129038 22:49027271-49027293 CCTGGGGAAGTGGGGAAGGGAGG - Intergenic
949434418 3:4013057-4013079 CATATGGAGGTGGGGAGGGGAGG + Intronic
952435784 3:33271253-33271275 CCTACAGACATGGGGAAGGCAGG - Intergenic
955688853 3:61570918-61570940 CTTACGGAAGTGGGGTTGGGTGG + Intronic
961094934 3:124146171-124146193 CCTACAGGCTTGGAGAAGGGAGG + Intronic
962251409 3:133838259-133838281 CCTAGAGATGAGGGGAAGGGGGG + Exonic
967189936 3:186976259-186976281 CTTACGGAGGAGGGGAAGGTTGG - Intronic
967849538 3:194071404-194071426 CCGCCGGGCGTGGGGAAGGCGGG - Intergenic
968938618 4:3626396-3626418 CGTTCAGACTTGGGGAAGGGTGG - Intergenic
969175957 4:5399302-5399324 CCTGCAGAGGTGGGGAAGGAGGG - Intronic
969511327 4:7619662-7619684 CCTAAGGACTTGGGAGAGGGAGG - Intronic
969576527 4:8039247-8039269 GGGACGGAGGTGGGGAAGGGAGG - Intronic
969633319 4:8351095-8351117 GTCAGGGACGTGGGGAAGGGTGG + Intergenic
970658889 4:18262271-18262293 TCTAAGGACGAGGGGCAGGGAGG + Intergenic
970708679 4:18836304-18836326 ACTATGGATGTGGGGAAGGCAGG - Intergenic
984859468 4:184224195-184224217 ACTAAGGACATGAGGAAGGGTGG - Intergenic
986120542 5:4831767-4831789 CCTATGGACATGGGGAAAAGTGG - Intergenic
988116835 5:26904598-26904620 CCTGCAGACTTGGGAAAGGGAGG + Intronic
994491340 5:100448318-100448340 CCTACGTATGTGGGGGGGGGGGG - Intergenic
998513794 5:142735302-142735324 CCTAAGGAGCTGGGGAGGGGTGG - Intergenic
1000532752 5:162444381-162444403 GATACGGAAGTGGGGCAGGGAGG + Intergenic
1010836990 6:80600698-80600720 CCTAGGGTAGTGGGGAAGGTAGG - Intergenic
1012979558 6:105815259-105815281 GCTAGGGAGGTGGGGAGGGGAGG - Intergenic
1015514478 6:134070606-134070628 CCGACTGACGGGGGGAAGAGAGG + Intergenic
1015957626 6:138614926-138614948 CCCACAGACCTGGGGTAGGGTGG - Intronic
1018981971 6:168608135-168608157 CCTATGGGCGGGGGGAAGGCGGG - Exonic
1023402226 7:39798469-39798491 CCCACGGAAGGGGGGATGGGAGG + Intergenic
1024214768 7:47239218-47239240 CCTGGTGACGTGGGGAAAGGGGG - Intergenic
1024647394 7:51382191-51382213 CCCACGGAAGGGGGGATGGGAGG - Intergenic
1026399007 7:69989982-69990004 CCCACAGACCTGGGGATGGGAGG - Intronic
1027025838 7:74851278-74851300 CCTGAGGGCCTGGGGAAGGGAGG - Intronic
1027061923 7:75092841-75092863 CCTGAGGGCCTGGGGAAGGGAGG + Intronic
1027415387 7:77968577-77968599 CATACAGAAGTGAGGAAGGGAGG - Intergenic
1028756433 7:94440256-94440278 CCAAGGGACTTGGGGAAAGGGGG + Intergenic
1029578965 7:101422436-101422458 CCTGGGGAAGTGGGGAAGGCAGG - Intronic
1029698530 7:102230592-102230614 CATACAGACATGGGGATGGGAGG - Intronic
1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG + Intergenic
1036668494 8:10764129-10764151 CATGGGGACGTGGGGAAAGGGGG + Intronic
1036935933 8:13002929-13002951 CCTGAGGAGCTGGGGAAGGGAGG - Intronic
1039430457 8:37521465-37521487 CGGACGGACGGGGGGAAGCGGGG - Intergenic
1047182607 8:122603999-122604021 CCTGCGGAGGTGGGGTAGGGAGG - Intergenic
1048622988 8:136155124-136155146 CCTATGGACATAGGGAAGGTGGG - Intergenic
1049472422 8:142782431-142782453 CATACGGAAGTGGGGATGGGTGG + Intergenic
1051347028 9:16161438-16161460 CCAAGGGTCATGGGGAAGGGTGG + Intergenic
1060720169 9:125971291-125971313 CCTACAGAGTTGGGAAAGGGAGG + Intergenic
1186446102 X:9630305-9630327 CCTAAGGACGTGAGGAATGGAGG + Intronic
1186609208 X:11122593-11122615 CCGACTGATGTGGGGAAGGGTGG - Exonic
1189701681 X:43719666-43719688 ACTACGGAATTGGGGAAGCGGGG + Intronic
1192263560 X:69523650-69523672 CCGACTGAGGTGGGGAAAGGAGG + Intronic
1193951742 X:87808783-87808805 CCCACGGACGTGGAGAGGGGAGG + Intergenic
1195232093 X:102860061-102860083 GCTATGGAAGTGGGAAAGGGGGG - Intergenic
1196740170 X:119017715-119017737 CCGACGGCAGTGGGGAAGGTGGG - Exonic
1196886460 X:120250928-120250950 CCTCCGGACGCGCGGAAGGCTGG - Exonic