ID: 1136402318

View in Genome Browser
Species Human (GRCh38)
Location 16:30025330-30025352
Sequence CACGGCCAGCAGGGGCAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 467}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136402307_1136402318 8 Left 1136402307 16:30025299-30025321 CCAGGTTGACGTGGGCAGGGATG 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG 0: 1
1: 0
2: 4
3: 68
4: 467
1136402306_1136402318 9 Left 1136402306 16:30025298-30025320 CCCAGGTTGACGTGGGCAGGGAT 0: 1
1: 0
2: 0
3: 5
4: 220
Right 1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG 0: 1
1: 0
2: 4
3: 68
4: 467
1136402300_1136402318 26 Left 1136402300 16:30025281-30025303 CCAGGAGCAGCGCAGCGCCCAGG 0: 1
1: 0
2: 3
3: 31
4: 293
Right 1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG 0: 1
1: 0
2: 4
3: 68
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136402318 Original CRISPR CACGGCCAGCAGGGGCAGGC CGG Exonic
900126938 1:1072885-1072907 CCCGGGCAGCAGGGCCAGCCAGG - Intronic
900290400 1:1921291-1921313 CACTGACAGGAGGGCCAGGCTGG + Intergenic
900314913 1:2051661-2051683 GACGGCCGGCAGGGTTAGGCGGG + Intronic
900421371 1:2557341-2557363 AAGAGCCAGCAGGGGCAGCCAGG - Intronic
900475375 1:2873982-2874004 AGCGGCCAGCCAGGGCAGGCAGG + Intergenic
900505349 1:3027607-3027629 CATCTCCACCAGGGGCAGGCGGG + Intergenic
900591450 1:3462068-3462090 CGCTGCCAGGAGGGGCGGGCAGG + Intronic
900621753 1:3590730-3590752 CCCTGCCAGCAGGGGCTGGAGGG + Intronic
901084436 1:6602050-6602072 CTCGCGCAGCAGGCGCAGGCAGG + Exonic
901790276 1:11650255-11650277 CTCAGCCAGCTGGGGCAGGGCGG - Intronic
901794692 1:11673492-11673514 CCAGGCCAGCAGGGGCACCCTGG - Intronic
902612922 1:17607790-17607812 CTTGGCCAGCAGGGGCAGAGAGG + Exonic
902613832 1:17612925-17612947 GACGGACAGCTCGGGCAGGCGGG - Intronic
902625449 1:17673668-17673690 CAAGGCATGCAGGGGCAGCCGGG - Intronic
903294498 1:22335181-22335203 CACAGCCAGCGAGGGCAGACTGG + Intergenic
903300539 1:22375619-22375641 CATGGCCATCAGGGCCAGGCAGG - Intergenic
903389456 1:22953754-22953776 CACGGCCAGCTTGGCCAGGTCGG + Exonic
903931375 1:26864241-26864263 CAGAGGCAGCAGGGGCAGGAGGG - Exonic
904374329 1:30070439-30070461 CTGGGACAGCAAGGGCAGGCTGG - Intergenic
904518176 1:31073228-31073250 CATGGTCAGCAGGGCCAGGTTGG - Intergenic
904613752 1:31738922-31738944 GACGGCCAGCGGGGGCCTGCGGG + Exonic
904986040 1:34549660-34549682 CACTGCAAGCAGGTGCAGCCAGG - Intergenic
905710413 1:40097400-40097422 CTCGGCCAGCGGGGTCTGGCGGG - Exonic
905792698 1:40798807-40798829 CACGGGCAGCAGCTGCAGCCAGG - Intronic
905882818 1:41475499-41475521 AACGGCTGGAAGGGGCAGGCAGG - Intergenic
906660399 1:47577816-47577838 AAAGGCCAGCAGGAGCAGGCCGG - Intergenic
907673387 1:56496610-56496632 TCCGGATAGCAGGGGCAGGCAGG + Exonic
907822803 1:57987725-57987747 GAGCGCCAGCAGAGGCAGGCAGG - Intronic
912069862 1:105796007-105796029 CAAGCACAGGAGGGGCAGGCCGG - Intergenic
912367968 1:109150423-109150445 GACGGCCAGCAAAGGCCGGCAGG + Intronic
912960109 1:114188563-114188585 CAGACACAGCAGGGGCAGGCTGG + Intergenic
912962659 1:114209716-114209738 CATGGCCTGCTGAGGCAGGCTGG - Intergenic
913231176 1:116741916-116741938 CACCGCCAGCAGGAGCAGGTGGG - Intergenic
914789906 1:150868603-150868625 CAAGACCAGCCTGGGCAGGCCGG + Intronic
915019854 1:152768938-152768960 TGTGGTCAGCAGGGGCAGGCAGG + Intronic
915341604 1:155179560-155179582 CATGGAGGGCAGGGGCAGGCAGG - Intronic
915485881 1:156220258-156220280 CAAGACCAGCATGGGCAGGCCGG - Intronic
915845594 1:159260785-159260807 CAAGGCCAGCACGGGGAGGGGGG - Intergenic
916631380 1:166618042-166618064 CACTGCCAGCGGGTGCAGCCAGG + Intergenic
916648898 1:166816813-166816835 CTGAGCCAGCAGGGGAAGGCGGG + Intergenic
917448588 1:175127689-175127711 CATTGCCAGCAGGAACAGGCTGG - Intronic
918696384 1:187551168-187551190 CAAGCCCAGCAGGCGCCGGCTGG + Intergenic
922496370 1:226061770-226061792 CACGGCCCCCACGGGCGGGCAGG + Intergenic
922537076 1:226389305-226389327 CTGAGCCAGCTGGGGCAGGCTGG - Intronic
922616464 1:226963938-226963960 CACAGCCAGCAGGGCCAGCCTGG + Intronic
922739351 1:228006849-228006871 CGGGGCAGGCAGGGGCAGGCGGG - Intergenic
923161382 1:231317558-231317580 CAAGCCCAGCAGGCGCCGGCTGG - Intergenic
924717892 1:246595082-246595104 CATGGCCAGCCCGGGCAGACAGG - Intronic
1063053241 10:2475937-2475959 CAGGGCCAGCAGGGAGAGCCAGG - Intergenic
1063963298 10:11325099-11325121 CACAGGCAGCAAGGGCAGGATGG - Intronic
1066526412 10:36284037-36284059 CAGGGCATGCAGGGGCGGGCGGG + Intergenic
1068261936 10:54594445-54594467 CACTGCTAGCAGGTACAGGCAGG - Intronic
1068461622 10:57336970-57336992 CAAGGCCAGCAGGCACTGGCTGG + Intergenic
1068845167 10:61663240-61663262 CACGGCGCGCCGGGGCCGGCTGG - Intronic
1068881231 10:62051161-62051183 CACGGCAACCAGGGGAAGGGAGG - Intronic
1069936612 10:71921869-71921891 CAGGGCCAGCTTGGGCAGGAGGG - Intergenic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070746474 10:78936777-78936799 CACGGCCAGCTGGAGCCAGCTGG - Intergenic
1070762030 10:79029898-79029920 CAAAGCCAGCAGTGTCAGGCCGG - Intergenic
1071565076 10:86667541-86667563 CAGGGCCAGGAGGGGCAGGGAGG - Intergenic
1072537831 10:96376811-96376833 CACAGCCAGCTGGGGGTGGCAGG + Exonic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072746051 10:97939820-97939842 CACATCCAGCAGGGGCAGTCGGG - Intronic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1073218007 10:101847358-101847380 CTTGGGCAGCAGGGGCAGGAGGG - Exonic
1073582516 10:104681332-104681354 CACTGCAGGCAGGGGCGGGCGGG - Intronic
1074818570 10:117163098-117163120 CCCGGCCAGCAGACGGAGGCTGG - Intergenic
1075461381 10:122618677-122618699 CACAGATAGCAGGGGCAGGGAGG + Intronic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1076035523 10:127196198-127196220 CCGGGCCAGCAGGGCCGGGCCGG - Intronic
1076209323 10:128627773-128627795 CAGGGTCAGCAGGGGCACGCTGG + Intergenic
1076684884 10:132194111-132194133 CTCGGCCTGCAGGCCCAGGCTGG + Intronic
1076704920 10:132296049-132296071 CAGGGCCAGCATCGGCAGGAAGG + Intronic
1076776237 10:132699656-132699678 CAGGGCCCGCAGGGTCAGCCAGG + Intronic
1076823798 10:132957222-132957244 AACTGCCATCAGGGCCAGGCAGG - Intergenic
1076869442 10:133186165-133186187 CACAGCCGGGAGGGGCTGGCCGG + Exonic
1077018690 11:407902-407924 CAGGGCCAGCAGGACCAGGAGGG + Exonic
1077094744 11:794539-794561 CAGGGCCAGCTGGGGCCAGCCGG + Intronic
1077266506 11:1653370-1653392 TACGCCCTTCAGGGGCAGGCGGG - Intergenic
1077360922 11:2139749-2139771 CCGGGCAGGCAGGGGCAGGCGGG + Intronic
1078002945 11:7512735-7512757 CACAGCCAGCAGGGGAAGGCTGG - Intergenic
1080685742 11:34513474-34513496 CACGGCCTGCGGAGGCAAGCAGG + Intronic
1082891617 11:58144899-58144921 CCCGGCCAGCAGCGCCAGGCGGG - Intronic
1083110344 11:60400169-60400191 CAGGGCCAACTGGGACAGGCAGG - Intronic
1083316322 11:61816782-61816804 CCGGGCCAGCAGGGGCTGTCAGG + Exonic
1083739051 11:64698117-64698139 CAGGGCCAGGAGTGGCAGTCAGG + Intronic
1083955872 11:65982479-65982501 CAGGACCAGCTGGGGAAGGCAGG - Intergenic
1084164138 11:67367177-67367199 CCCGGCCCCCAGGGGGAGGCGGG + Intronic
1084205055 11:67586343-67586365 CTCAGCCAGCGGGAGCAGGCTGG - Intronic
1084483902 11:69437179-69437201 CACAGCCGACAGGGGCAGACAGG + Intergenic
1085279816 11:75322588-75322610 CAAGGCCAGCAGGGACATGGGGG + Intronic
1085477092 11:76795627-76795649 CACGGCCAGCAGCAGCAGCAGGG - Exonic
1085517976 11:77122399-77122421 GCCGGCCAGCAGGGGCACACTGG - Intronic
1087318849 11:96635905-96635927 CAAGCCCAGCAGGCGCTGGCCGG - Intergenic
1088440705 11:109867207-109867229 TGAGGGCAGCAGGGGCAGGCTGG + Intergenic
1088481052 11:110296662-110296684 GCCGGCCGGCAGGGGGAGGCGGG - Exonic
1088593440 11:111422518-111422540 CATGGCCACCAAGCGCAGGCTGG + Intronic
1088626930 11:111736240-111736262 CTCGGCTAGCAGAGGCAGCCCGG + Intronic
1089160279 11:116432054-116432076 CACGTCCAGCAGGTTCTGGCTGG - Intergenic
1089467149 11:118692704-118692726 CACGGACAGCTGCAGCAGGCTGG - Intergenic
1090167873 11:124570538-124570560 CACAGCCACCAGCAGCAGGCAGG - Exonic
1090799085 11:130159672-130159694 CAGGGCCGGCGGGGGCGGGCAGG + Exonic
1091143720 11:133258820-133258842 CTGGGCAGGCAGGGGCAGGCTGG - Intronic
1091301505 11:134510783-134510805 CTGGGTGAGCAGGGGCAGGCAGG - Intergenic
1092028484 12:5263220-5263242 CACTGCAAGCAGAAGCAGGCAGG + Intergenic
1093512046 12:19941214-19941236 CGCGGCCAGCCGGGGCAGCCGGG + Intergenic
1094048664 12:26195694-26195716 CGCGGCCAGCAGAGGCAGGGGGG + Exonic
1095642693 12:44502758-44502780 CAAGCCCAGCAGGCACAGGCTGG + Intergenic
1096209053 12:49748357-49748379 CAGGGACAGCAGGGGCTGGTAGG - Intronic
1096403244 12:51324265-51324287 CACTGTCAGCTGGAGCAGGCCGG + Intronic
1097699027 12:62801775-62801797 CTGGGGCAGCAGGGCCAGGCTGG - Intronic
1100078912 12:90824159-90824181 CAAGCCCAGCAGGCGCCGGCAGG - Intergenic
1101399126 12:104372997-104373019 GAAGCCCAGCAGGGCCAGGCTGG + Intergenic
1101471295 12:104999433-104999455 CACTGCAAGCAGGGACAGCCAGG + Intronic
1101811732 12:108113331-108113353 AACTTCCAGCAGGGGCAGCCAGG + Intergenic
1102455282 12:113067025-113067047 CACAGACAGCAGTGGCAGGCCGG + Intronic
1102951692 12:117035568-117035590 CCCGAGCAGCAGGGGAAGGCAGG + Intergenic
1103518928 12:121524909-121524931 GAAGGGCAGCAGGGGCAGGTGGG + Intronic
1103905545 12:124325625-124325647 GGCGGCCAGCAGGGGCTGCCGGG - Intronic
1103914663 12:124370064-124370086 CACAGCCAGCAGGAGCGGGGCGG + Intronic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104439666 12:128784608-128784630 CACGTGCAGCAGGGCCTGGCAGG + Intergenic
1104581402 12:130013811-130013833 CAGGGCCAGGACGGGCACGCGGG + Intergenic
1104733872 12:131124090-131124112 CACTCCCCGCAGGGGTAGGCTGG - Intronic
1105209259 13:18248092-18248114 ACCGGCCAGCAGGGTCAGGCGGG + Intergenic
1105323416 13:19348050-19348072 CAAGGCCAGCAGGGCCAGCACGG - Intergenic
1105490476 13:20883094-20883116 CAGGGCCTGCAAGGGCAGGGCGG - Intronic
1105873972 13:24537787-24537809 CAAGGCCAGCAGGGCCAGCACGG + Intergenic
1106185337 13:27404891-27404913 CAAGGCCAGCAGGTCCCGGCAGG + Intergenic
1106483687 13:30155142-30155164 CCCTGCCTGCAGGGGGAGGCGGG - Intergenic
1107008748 13:35646242-35646264 CATGGCCTGCAGGGGAAGGAGGG - Exonic
1108673093 13:52711456-52711478 CTCAGTCAGCAGGGGCTGGCTGG - Intronic
1109261131 13:60146252-60146274 CCAGGCCACCAGGTGCAGGCTGG + Intronic
1110205941 13:72913575-72913597 CAAGGCCAGCCGGGGCAACCTGG + Intronic
1111096058 13:83517031-83517053 CAAGCCCAGCAGGCGCTGGCTGG - Intergenic
1111197560 13:84894792-84894814 CAAGCCCAGCAGGTGCCGGCTGG + Intergenic
1112507173 13:99982032-99982054 CAGGGCTCGCAGGGGCGGGCGGG + Exonic
1113709546 13:112454437-112454459 CACGTCCAGCAGGGACAGTGCGG - Intergenic
1113912290 13:113848584-113848606 CTTGGCCAGCAGAGGCCGGCCGG + Intronic
1113924154 13:113930931-113930953 CACGGCCTCCAGGGCCAGGCTGG + Intergenic
1115284918 14:31705857-31705879 CAAGCCCAGCAGGTGCTGGCTGG + Intronic
1115807966 14:37073657-37073679 CCAGGGTAGCAGGGGCAGGCTGG - Intronic
1118319169 14:64743231-64743253 CACGCCGAGCAGGGGGCGGCCGG + Exonic
1119085539 14:71735646-71735668 CAGGGCCAGTTGGGGCAGGTAGG + Intronic
1119887204 14:78152919-78152941 AAGGGCCAGCATGGTCAGGCTGG + Intergenic
1120948182 14:90017287-90017309 CACGGGCACCTGGGGCAGCCAGG - Intronic
1121775956 14:96591026-96591048 CAGGGCCTGCAGGGCCAGGCAGG - Intergenic
1121825690 14:97008036-97008058 CACTGGCAGCAGGGGCAGCTGGG + Intergenic
1122058200 14:99119348-99119370 AACAGCCAGCAGGGGGAGGGTGG + Intergenic
1122461839 14:101902470-101902492 CACGTCCAACAGAGGCAGGCAGG - Intronic
1122544164 14:102513083-102513105 CACAGGCAGTAGGGGGAGGCTGG + Intergenic
1122773804 14:104108466-104108488 CAGGCACAGCAGGGCCAGGCAGG - Intronic
1122774135 14:104109812-104109834 TGCGGCCAGCAGGTGGAGGCGGG - Intronic
1122817036 14:104318980-104319002 CAGAGCCAGCAGGGCCAGGACGG - Intergenic
1122893264 14:104742729-104742751 CATGGGCAGCTGGGGGAGGCGGG - Intronic
1123048377 14:105529199-105529221 CACGAGCAGCAGGAACAGGCCGG - Exonic
1123050018 14:105536811-105536833 GACGGGCAGCAGGGACAGGCAGG + Intergenic
1123107954 14:105851797-105851819 CTCGACCGGCAGGGGCTGGCTGG - Intergenic
1123203546 14:106691484-106691506 CAGGACTAGCAGGGGCATGCAGG - Intergenic
1202947487 14_KI270726v1_random:41958-41980 CACGGCCAGCAGGGGGCGCGCGG + Intergenic
1128708524 15:69855078-69855100 CAGAGCCAGTGGGGGCAGGCAGG - Intergenic
1129188987 15:73926853-73926875 CACGGGCAGCAGGCGCAGCCCGG + Exonic
1129243014 15:74262590-74262612 CAGGGCCGGCATGTGCAGGCAGG + Intronic
1129699316 15:77758518-77758540 CAGAGCCAGCAGGGGCAGTCAGG + Intronic
1129709396 15:77812823-77812845 CACAGCCATCAGGGACAGGGAGG + Intronic
1130299344 15:82667969-82667991 CAAGGGCATCAGGGGCCGGCAGG + Intronic
1131055366 15:89371621-89371643 CTCGGCCAGCTGGGGCGAGCCGG + Intergenic
1132095114 15:98978402-98978424 CACAGCCTGCAGGCCCAGGCAGG + Intronic
1132240623 15:100254832-100254854 CAGGGCCAGCCGGGGGAGGCGGG + Intronic
1132500545 16:282905-282927 CAGGGGCAGCAGGGGCAGCAGGG - Exonic
1132500548 16:282914-282936 CAGGGGCAGCAGGGGCAGCAGGG - Exonic
1132551970 16:557236-557258 CAAGGCCAGCAGCCTCAGGCTGG + Intergenic
1132622820 16:875785-875807 CTCCACCGGCAGGGGCAGGCGGG + Intronic
1132662994 16:1069851-1069873 CACGGCCAGGAGGGTCAGCCAGG + Intergenic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132769123 16:1551276-1551298 CACGGCTGGCAGGGGTGGGCAGG + Intronic
1132869160 16:2108022-2108044 CTCGGCCTGCAGAGGGAGGCTGG - Exonic
1132871186 16:2116473-2116495 CAAGGCCTCCAGGGGCAGGCAGG + Intronic
1132891951 16:2208964-2208986 CAGGTCCAGCTGGCGCAGGCCGG - Exonic
1132906345 16:2284633-2284655 CAGGGCCAGCTGGGGCAGAGGGG + Intronic
1132908562 16:2296965-2296987 CAGGGCCAGCAGGGGCTGACAGG - Intronic
1133116682 16:3581573-3581595 CCCGGGCTGCCGGGGCAGGCTGG + Exonic
1133126689 16:3651888-3651910 CACAGGCTGCAGGGGCAGGATGG + Intronic
1134521341 16:14920421-14920443 CGAGGCCTCCAGGGGCAGGCAGG - Intronic
1134550212 16:15135419-15135441 CTCGGCCTGCAGAGGGAGGCTGG - Intronic
1134709016 16:16319072-16319094 CGAGGCCTCCAGGGGCAGGCAGG - Intergenic
1134716225 16:16359106-16359128 CGAGGCCTCCAGGGGCAGGCAGG - Intergenic
1134718257 16:16367576-16367598 CTCGGCCTGCAGAGGGAGGCTGG + Intergenic
1134950589 16:18349573-18349595 CGAGGCCTCCAGGGGCAGGCAGG + Intergenic
1134956495 16:18384583-18384605 CTCGGCCTGCAGAGGGAGGCTGG - Intergenic
1134958527 16:18393053-18393075 CGAGGCCTCCAGGGGCAGGCAGG + Intergenic
1135338963 16:21630238-21630260 CAAGCCCAGCAGGCGCTGGCTGG + Intronic
1135541466 16:23333244-23333266 GATGGCCACCAGGGCCAGGCAGG + Intronic
1136012447 16:27372588-27372610 AAAGGCCAGCAGAGGGAGGCAGG - Intergenic
1136128498 16:28203073-28203095 CAAGGCCAGCAGGGGCAACATGG + Intronic
1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG + Exonic
1136778758 16:32884878-32884900 CCCGACCCGCAGGGGCAGCCAGG + Intergenic
1136891859 16:33976640-33976662 CCCGACCCGCAGGGGCAGCCAGG - Intergenic
1138143214 16:54586252-54586274 GACGGGCAGCTGGAGCAGGCTGG - Intergenic
1138474947 16:57265090-57265112 GACGGGCAGCAGAGGCTGGCAGG - Intronic
1139358071 16:66379375-66379397 CACTGCCAGCAGGCCCAGGCAGG - Exonic
1139633205 16:68243193-68243215 CACAGCCATTAGGGGCAGGATGG - Intergenic
1139655033 16:68382367-68382389 CAGGGCTGGCAGGGGCAGGCTGG + Intronic
1140802998 16:78506086-78506108 CTTGGCCAGCAGGGGCTGCCTGG + Intronic
1141177457 16:81730416-81730438 CCTGGCCACCAGGGGCAGACAGG - Intergenic
1141704645 16:85658181-85658203 CAGGGCAGGCAGGGGCAGGGAGG - Intronic
1141768430 16:86073916-86073938 CTGGGCAAGCAGGGGCAGCCAGG - Intergenic
1141806554 16:86345643-86345665 GCCGGCCAGCCAGGGCAGGCAGG - Intergenic
1141807540 16:86351868-86351890 GCCGGCCAGCCAGGGCAGGCAGG + Intergenic
1142130489 16:88429635-88429657 CACGTCCAGCTGGTCCAGGCTGG - Exonic
1142143545 16:88483224-88483246 CCTGGACAGGAGGGGCAGGCTGG - Intronic
1142290231 16:89190716-89190738 CACGGCTGGCAGGGACAGACTGG - Intronic
1142327476 16:89425533-89425555 CAAGGCCAGCTGGTGCAGACAGG + Intronic
1142349657 16:89574402-89574424 CACGGCCTGCAGGAGCTGCCTGG + Intergenic
1203081173 16_KI270728v1_random:1146967-1146989 CCCGACCCGCAGGGGCAGCCAGG + Intergenic
1142552142 17:747389-747411 CATGGCCAACAGGGGCATGGTGG + Exonic
1142742726 17:1940547-1940569 CCCAGCCTGCAGGGGGAGGCAGG + Intronic
1143018792 17:3905513-3905535 CCAGGCCAGCAGCGGGAGGCAGG - Intronic
1146357016 17:32142768-32142790 CAGGGGCTGCAGGGGCAGGGAGG - Intronic
1146399413 17:32491661-32491683 CCAGGCCAGCAGGGGTGGGCTGG + Intergenic
1147670483 17:42174192-42174214 CATACCTAGCAGGGGCAGGCAGG - Intronic
1147743238 17:42680384-42680406 CAGGGCCAGCTGGAGCAGGTGGG + Exonic
1148148958 17:45384870-45384892 CACGGACAGCAGAGGCATCCCGG + Intergenic
1149992339 17:61390097-61390119 CGCTGACAGCAGGGCCAGGCGGG - Intronic
1150791918 17:68205816-68205838 CGCGAGCAGCAGGGGCAGGTGGG + Intergenic
1151578354 17:74963905-74963927 AACGGCCTGTGGGGGCAGGCAGG + Exonic
1151815526 17:76469702-76469724 CACGGCCAGCACATGCAGGTGGG - Exonic
1152105463 17:78326124-78326146 CAAGGGCAGCAGGGGCAGTCAGG + Intergenic
1152311583 17:79554499-79554521 AAGGGCCAGCAGGGCCAGGTCGG - Intergenic
1152321109 17:79609396-79609418 CACCACCAGCTGGGGCAGGAAGG + Intergenic
1152589465 17:81204288-81204310 CAGGGCCAGCTGGGGAGGGCAGG - Intronic
1152877596 17:82795948-82795970 CACAACCAACAGAGGCAGGCAGG - Intronic
1154171993 18:12059341-12059363 CACTGCCCGCGGGGGCAGGTGGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154201218 18:12302032-12302054 AAAGCCCAGCAGGGGCAAGCTGG - Intergenic
1156245152 18:35290557-35290579 CAAGGCCAGCAAGGGCTGACTGG - Intergenic
1156574557 18:38299668-38299690 TATGTACAGCAGGGGCAGGCAGG + Intergenic
1157223156 18:45841310-45841332 CAGGGACAGTAGGGGCAGCCCGG + Intronic
1157780124 18:50430872-50430894 CAGGGCCAGAGGGTGCAGGCAGG + Intergenic
1157780130 18:50430891-50430913 CAGGGCCAGAGGGTGCAGGCAGG + Intergenic
1158765641 18:60447237-60447259 CCCAGCAAGCAGTGGCAGGCTGG - Intergenic
1159995044 18:74956280-74956302 CGAGGCCAGCAAGGACAGGCTGG - Intronic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160986523 19:1841544-1841566 AACGCCCAGCAGGAGGAGGCCGG + Intronic
1161018712 19:1997511-1997533 CACGGCCGGGAGGGCCAGCCCGG + Intronic
1161071924 19:2266723-2266745 GGCGGCCATCAGAGGCAGGCAGG + Intronic
1161513083 19:4682596-4682618 CAGGGCCAGCTGGGGCAGGAGGG + Intronic
1161587722 19:5114523-5114545 CACTCCCTGCAGGGGCTGGCAGG - Intronic
1161673016 19:5624577-5624599 CACTGCCTGCAGGGGCTGGGGGG - Intronic
1161746512 19:6063499-6063521 CCCCTCCAGCAGGGCCAGGCAGG + Intronic
1161925047 19:7293870-7293892 CATGGCCACCGGGGGCCGGCGGG - Exonic
1162115921 19:8429263-8429285 CACTGCCAGCATGGGAGGGCAGG + Intronic
1162808664 19:13151729-13151751 CCCGGGCAGCCGGAGCAGGCTGG - Intronic
1165112841 19:33512366-33512388 CATGGCCACCATGGCCAGGCTGG + Intronic
1165460266 19:35940102-35940124 CCTGGCGAGCAGGGGCAGGCGGG - Exonic
1165495823 19:36151602-36151624 CGCGCCGAGCCGGGGCAGGCGGG - Intronic
1165723127 19:38093706-38093728 GACGGCCATCTGGGGCAGGCTGG - Intronic
1165838030 19:38771134-38771156 CACGGCCTGCAGGGGAGGGTCGG + Exonic
1165841535 19:38791563-38791585 CACGGCCTGCAGGGGAGGGTCGG - Exonic
1165900548 19:39167438-39167460 CAGGGCCACCAGGGGTGGGCTGG + Intronic
1166911389 19:46160742-46160764 CAGGGCCAGAAGGTGCAGGGGGG - Exonic
1167037563 19:47003146-47003168 CATGGCCAGTCGTGGCAGGCCGG + Exonic
1167103842 19:47419327-47419349 CGGGGGCAGCAGGCGCAGGCGGG + Intronic
1167281443 19:48571491-48571513 CAAGACCAGCCTGGGCAGGCTGG - Intronic
924960008 2:26332-26354 CAAGGCCAGGCAGGGCAGGCAGG + Intergenic
925085041 2:1101204-1101226 AGGGGGCAGCAGGGGCAGGCAGG - Intronic
925411767 2:3643640-3643662 CACAGGCAGCAGGGGCCGGCAGG - Intronic
925876527 2:8316007-8316029 GACAGCCAGCATGGGAAGGCTGG + Intergenic
926976424 2:18520931-18520953 CACAGCGTGCATGGGCAGGCTGG - Intergenic
927111741 2:19868834-19868856 CACGGCGAGGAGGAGCAGGAGGG - Intergenic
927515088 2:23667658-23667680 CAGGGCCAGGAGGAGCAGCCGGG - Intronic
927856114 2:26528970-26528992 CACAGCCAACAGTGGCAGGCTGG - Intronic
929999466 2:46851047-46851069 TACGGCCAGCAAAGGCATGCAGG + Intronic
930022736 2:47011386-47011408 CGCGGCCATCAGGGGCACGGTGG - Exonic
931412086 2:62042495-62042517 CAAGCCCAGCAGGTGCTGGCGGG + Intronic
932432790 2:71685700-71685722 CAGGGCCAGCGTGGGGAGGCAGG + Intronic
932466946 2:71930137-71930159 CTTGGCCAGGAGTGGCAGGCTGG - Intergenic
933896206 2:86812107-86812129 CAGGGGGAGCAGGGGCAGTCAGG - Intergenic
934654070 2:96108282-96108304 CCAGGCCAGCAGGGGCAGAGGGG + Intergenic
934712852 2:96527262-96527284 CAGGGCCCGCTGGGACAGGCAGG + Intergenic
935262946 2:101370769-101370791 CAAGCCCAGCAGGGTCAGGCTGG + Intronic
935270139 2:101427396-101427418 CAAAGCCAGCAAAGGCAGGCCGG - Intronic
936233796 2:110726107-110726129 GAAGGCCTGCAGAGGCAGGCTGG - Intergenic
936463770 2:112729464-112729486 GAAGGTCAGCAGGGGCAGGAAGG - Intronic
936984143 2:118291863-118291885 CTCTGCCAGCAAGGCCAGGCAGG - Intergenic
937470736 2:122171953-122171975 AACGGGCAGCAGGGACAAGCCGG + Intergenic
938770408 2:134496460-134496482 CACGGCCTGCAGAGCCAGCCTGG + Intronic
940346110 2:152630788-152630810 TACAGCCAGCAGGTGCATGCAGG - Intronic
940453821 2:153872214-153872236 CAAGCCCAGCAGGCGCCGGCCGG - Exonic
940485575 2:154291561-154291583 CAAGCCCAGCAGGTGCTGGCCGG + Intronic
941568010 2:167132624-167132646 GATGGCCTGCAGAGGCAGGCCGG - Intronic
942278065 2:174336834-174336856 CTGGGCCAGCAGGTGCTGGCTGG - Exonic
945891459 2:215435761-215435783 GACGGCCAGCAGCAGCAGCCCGG + Exonic
946386633 2:219387862-219387884 CGCGGCCTGAAGGGGCACGCGGG - Exonic
946855396 2:223945143-223945165 CACGGCCAGCGAGGACAGGTAGG - Exonic
947538131 2:230953869-230953891 CACGGCCAGGAGATGAAGGCTGG + Intronic
948048059 2:234958586-234958608 CACCCCCAGAAGGGGCAGGAAGG + Intronic
948242172 2:236446894-236446916 CACGCCCAGCAGCCGCAGTCAGG - Intronic
1168959431 20:1858667-1858689 AATGGCCACCAGTGGCAGGCTGG - Intergenic
1169269363 20:4187450-4187472 CACGGCAGCAAGGGGCAGGCTGG - Exonic
1169934248 20:10865880-10865902 CAGGGTCAGAAGGGGCAGACAGG + Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171245682 20:23608029-23608051 GACGGCCCGGAGGGGCTGGCTGG + Intergenic
1171290429 20:23979805-23979827 ACCGGCCAGCAGGGTCAGGCGGG + Intergenic
1171387773 20:24781640-24781662 CAGGTCCAGCAAGGGCAAGCGGG + Intergenic
1171426351 20:25051043-25051065 CCCGGTCAGCAGGGAGAGGCAGG - Intronic
1172229681 20:33328317-33328339 CAACACCTGCAGGGGCAGGCGGG + Intergenic
1173069868 20:39753034-39753056 AAAAGCCAGCAGGGGTAGGCTGG - Intergenic
1173256348 20:41396377-41396399 CACAGCCAGCAGGGGCCTGATGG + Intergenic
1173612994 20:44384531-44384553 CACGCCCAGCATGGGTCGGCAGG + Intronic
1174546807 20:51331716-51331738 CACTGCGAGCAGGGCCAGCCAGG + Intergenic
1175177637 20:57122312-57122334 CACAGGCTGTAGGGGCAGGCTGG - Intergenic
1175736155 20:61388688-61388710 CACAGACAGCAGGGGGATGCTGG + Intronic
1175760541 20:61559834-61559856 CATGGCCAGCTGGGACATGCAGG - Intronic
1176151641 20:63594473-63594495 CACGTCCTGCTGGGGCAGCCTGG - Intronic
1176864800 21:14041248-14041270 CACGCCCATCAGGGACAGACTGG - Intergenic
1178493815 21:33070812-33070834 GGCGGCGAGCAGGGGCAGCCCGG - Exonic
1178875670 21:36412235-36412257 CCTGGGCAGCAGGGGCATGCAGG - Intronic
1179029046 21:37703964-37703986 CAGGCCCAGCAGGGCAAGGCGGG - Intronic
1179904577 21:44415787-44415809 CACGTCCACCAGGGGCCGGATGG - Intronic
1179949078 21:44699611-44699633 CAGGCGCAGCAGGGGCTGGCCGG - Intronic
1179995579 21:44972557-44972579 CACCCCCCGCAGGTGCAGGCAGG + Intronic
1180048237 21:45319565-45319587 CGCGGCTGGCAGGTGCAGGCTGG - Intergenic
1180367846 22:11957021-11957043 CTGGGCCTGCAGGGGCAGGGGGG - Intergenic
1180767000 22:18351205-18351227 ACCGGCCAGCAGGGTCAGGCGGG - Intergenic
1180779313 22:18511174-18511196 ACCGGCCAGCAGGGTCAGGCGGG + Intergenic
1180812030 22:18768494-18768516 ACCGGCCAGCAGGGTCAGGCGGG + Intergenic
1180992263 22:19943777-19943799 CAAGGCCAGCAGGGGCACTCAGG + Intronic
1181168142 22:20994165-20994187 CACGTGCAGCAGGGGCGGCCGGG - Exonic
1181198185 22:21202738-21202760 GCCGGCCAGCAGGGTCAGGCGGG + Intergenic
1181401560 22:22653066-22653088 ACCGGCCAGCAGGGTCAGCCGGG - Intergenic
1181443212 22:22949284-22949306 CAGGGCAACCAGGGGCAGGGTGG + Intergenic
1181499029 22:23305409-23305431 CACCCTCAGCAGGGGCAGGGAGG - Intronic
1181647993 22:24244051-24244073 ACCGGCCAGCAGGGTCAGGCGGG + Intronic
1181703521 22:24634163-24634185 ACCGGCCAGCAGGGTCAGCCGGG - Intergenic
1182278964 22:29207150-29207172 CTAGCCCAGCAGGGGCATGCTGG - Intronic
1182421126 22:30249060-30249082 CATGGACAGGAGGGGGAGGCTGG - Intergenic
1182681857 22:32085737-32085759 CAGGGCCAGCAGGGCGGGGCAGG + Intronic
1182877035 22:33701136-33701158 CACGGCCTGGAGGGGAACGCAGG + Intronic
1183475288 22:38032832-38032854 GAAGGCCTGCAGGGGCAGGAGGG + Intronic
1183484326 22:38081303-38081325 CAAGTCCAGCAGGCGCCGGCGGG + Exonic
1183645463 22:39123792-39123814 CAGGGGGTGCAGGGGCAGGCGGG + Intronic
1184018026 22:41800519-41800541 CAGAGCCTGGAGGGGCAGGCAGG + Intergenic
1184020036 22:41814622-41814644 CAGGGCTAGGAGGGGCAGGAAGG + Intronic
1184102402 22:42347719-42347741 CAGCGCCAGCAGGGGCAGAGGGG + Intergenic
1184458866 22:44626052-44626074 CACCCCCGGCCGGGGCAGGCTGG + Intergenic
1184651865 22:45923035-45923057 CACGGGCAGCGTGGGCACGCAGG - Exonic
1184759480 22:46536689-46536711 CGCGGCGGGCAGCGGCAGGCGGG + Exonic
1185055347 22:48576087-48576109 CACCGCCAGCAGGGCCCGGACGG - Intronic
1203228622 22_KI270731v1_random:92099-92121 GCCGGCCAGCAGGGTCAGGCGGG - Intergenic
950450947 3:13065138-13065160 CACCTCCTGCAGGGGCCGGCTGG + Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
950613618 3:14141662-14141684 CACGGTCAGCAGGGTCAGCGAGG - Exonic
950940156 3:16884309-16884331 CACGGCGGGCAGGGGCGGCCGGG - Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
951424066 3:22521308-22521330 CAGGGCCAGCTGGGGGAGGGGGG + Intergenic
951581781 3:24172317-24172339 GCCGGCCAGAAGAGGCAGGCTGG + Intronic
951736521 3:25871559-25871581 CACTGCCTGCATAGGCAGGCAGG - Intronic
952223860 3:31353372-31353394 TAAGGCCAGCAGATGCAGGCAGG - Intergenic
953705276 3:45226007-45226029 CGCGGCGAGCAGGGGCAGCATGG + Exonic
954674219 3:52306847-52306869 CAAGGCCAGCAGGGGCCAGCAGG + Intergenic
954866993 3:53738084-53738106 CCCGACCAGCAGAGGGAGGCTGG + Intronic
954930089 3:54273633-54273655 CACGGACAGCAGGAGCAGGCTGG + Intronic
955098986 3:55828463-55828485 CAGGGGCAGCAGGGGCAGCAGGG + Intronic
955098989 3:55828472-55828494 CAGGGGCAGCAGGGGCAGCAGGG + Intronic
955510977 3:59679935-59679957 CAGGGGCAGCAGGGGCAGGGAGG - Intergenic
955649007 3:61172901-61172923 AATGGCCAGCAGGGGCAGGCAGG + Intronic
956386512 3:68725261-68725283 GCTGGCCAGCAGTGGCAGGCTGG - Intergenic
956731835 3:72203701-72203723 CAAGGCCAGCAGGGAGAGGGAGG + Intergenic
960015679 3:112885248-112885270 CACTGCCAGTGGGTGCAGGCAGG + Intergenic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
961016172 3:123469972-123469994 CAGGGCCCACAGGGGCAGGGAGG + Intergenic
961356671 3:126343929-126343951 CGGGGCAGGCAGGGGCAGGCAGG - Intronic
961450347 3:126999703-126999725 TACAGCCAGCAGGGCCAGCCTGG + Intronic
961625131 3:128256528-128256550 CACTGGCAGCCGGGCCAGGCTGG + Intronic
961827587 3:129606891-129606913 CAGGGCGGCCAGGGGCAGGCGGG - Intergenic
961863792 3:129938841-129938863 GGCAGGCAGCAGGGGCAGGCTGG - Intergenic
962280523 3:134048672-134048694 CACGGCAAACAGGGGAAGGGTGG - Intronic
963004152 3:140710422-140710444 CACAGCCTGCAGGGTGAGGCAGG - Intergenic
964501798 3:157356097-157356119 CACGGCCAGCCTGGGCAGTATGG - Intronic
965652373 3:170947407-170947429 CAAGCACAGCATGGGCAGGCCGG - Intergenic
966677143 3:182601832-182601854 CATGGCCAGCAGGGGAGGTCAGG + Intergenic
967299660 3:188000559-188000581 CAGAGCCAGAAGGGGCAGGTGGG + Intergenic
968235067 3:197026584-197026606 CAGGCCCAGCAAGGGCAGCCTGG + Intronic
968615965 4:1578000-1578022 CCCGGCCTGCAAGGGCAGCCAGG - Intergenic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
968672200 4:1857614-1857636 CATGGACAGCAGGGGCAGAGGGG - Intergenic
968905660 4:3449520-3449542 CATGGCCTGGAGGGGAAGGCGGG - Intergenic
968920766 4:3521235-3521257 CTCGGCCCGGAGGGGAAGGCAGG - Intronic
968950254 4:3687813-3687835 CAGCGCCCGCAGGGCCAGGCAGG + Intergenic
969227493 4:5808262-5808284 CACGCCCAGCAGCAGCAGGCAGG + Exonic
969301830 4:6301519-6301541 CACGCCCACCAGGGCCAGGCCGG - Exonic
969326321 4:6446403-6446425 CACTGCCAGGAGGGGCAGCCAGG + Intronic
969390284 4:6887720-6887742 CACGGCCAGCCTGGGCAGCATGG - Intergenic
969480406 4:7443908-7443930 ATCGGCCAGCAGCGGCAGCCAGG - Intronic
970441451 4:16083797-16083819 CGCGGCCGGCAGTGGGAGGCGGG - Intronic
971798558 4:31259350-31259372 CAAGCCCAGCAGGCGCTGGCCGG - Intergenic
976015093 4:80542891-80542913 CAGGGGCAGCAGGGGCATGCAGG - Intronic
977065312 4:92305685-92305707 CGCGGCGAGCAGGGGCGGGCGGG + Intronic
977370289 4:96126345-96126367 CACGCCCAGCAGGCGCCGGCAGG + Intergenic
977979238 4:103303379-103303401 CAGGGCTAGCAGGAGCAAGCAGG + Intergenic
978382070 4:108139563-108139585 CAGGGCCAGCAGGGCCAGGGTGG - Intronic
982358287 4:154491966-154491988 CACGGCAGGGAGGGGAAGGCAGG - Intergenic
982840221 4:160174979-160175001 CACTGCAAGCAGGTGCAGCCAGG - Intergenic
985423548 4:189807144-189807166 CAAGCCCAGCAGGTGCCGGCCGG + Intergenic
985469690 5:32359-32381 CAAGGCCAGGCAGGGCAGGCAGG + Intergenic
985520400 5:371519-371541 CAGGTGCAGCAGGGGCTGGCAGG + Intronic
985717293 5:1469822-1469844 CAGGGCCAGCAGGGGCCGCAGGG + Intronic
985777565 5:1852687-1852709 CACCGCCTGCAGGGGCCTGCTGG + Intergenic
985896275 5:2751518-2751540 GACGGCCGGCGGAGGCAGGCCGG + Exonic
986285946 5:6359089-6359111 CTTTGTCAGCAGGGGCAGGCTGG - Intergenic
986402905 5:7396466-7396488 GACGGCGAGCAGGGCGAGGCAGG - Exonic
986523455 5:8646122-8646144 CACGGCCAGGAGAGGCAGAGAGG + Intergenic
986540610 5:8840551-8840573 CAAGCCCAGCAGGCGCCGGCCGG - Intergenic
986626152 5:9725415-9725437 CAGGGCCAGCAGGGCCAGCAGGG - Intergenic
986661735 5:10065588-10065610 CCCGGCCCGCTGGGGCCGGCCGG - Intergenic
987247284 5:16061338-16061360 CACACCCAGCAGGAGCAAGCTGG + Intergenic
992703979 5:79369387-79369409 CACAGGCTGCAGGGGCAGGTGGG + Intergenic
994411348 5:99410542-99410564 CAAGTCCAGCAGGCGCCGGCTGG + Intergenic
995597519 5:113763909-113763931 CAAGGCCAGCTGGGTCAGCCAGG - Intergenic
998139995 5:139694344-139694366 CCCGGCCAGGCTGGGCAGGCAGG - Intergenic
999652676 5:153783004-153783026 GAGGGCCAGCAGGGTCAGGCTGG + Intronic
1000334114 5:160229304-160229326 CATTGCCAGCAGGGTCAGGATGG - Intronic
1001787443 5:174425888-174425910 CACTGCCTGCAGGGTGAGGCAGG + Intergenic
1001907414 5:175484479-175484501 CGGGGCCAGCAGGTGCACGCCGG + Intronic
1002297724 5:178240613-178240635 CGGGGACAGCAGGGGCAGGGTGG - Intronic
1002442126 5:179269958-179269980 CAAGGCCAGCATGGCCAGGGAGG + Intronic
1003845717 6:10171822-10171844 CAGGGCCAGCAAGGGCTCGCCGG - Intronic
1003907985 6:10720169-10720191 CAAGCCCAGCAGGGGCCGGCAGG + Intergenic
1004321643 6:14636016-14636038 CACCCCCAGCAGGTGAAGGCTGG + Intergenic
1004431234 6:15545934-15545956 CAGGGCCAGCTCAGGCAGGCGGG + Intronic
1005989997 6:30896765-30896787 CACTGCCCCCAGGGGCAGTCGGG + Exonic
1006155708 6:32011801-32011823 CACAGACAGCTGGGACAGGCGGG + Intergenic
1006162039 6:32044655-32044677 CACAGACAGCTGGGACAGGCGGG + Exonic
1006844448 6:37052481-37052503 CAGGGCCGGCAGGTGCAGTCAGG - Intergenic
1006912398 6:37571916-37571938 CAAGGGCAGCAGGGGCTGGATGG - Intergenic
1007248958 6:40482755-40482777 CCTGGCCAGGAGGGGGAGGCAGG - Intronic
1010083102 6:71886722-71886744 CTCGGCCGGCGGGGGCGGGCAGG - Intronic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1014109306 6:117602517-117602539 CATGCGCAGCGGGGGCAGGCTGG - Intronic
1014632527 6:123803891-123803913 CAGGGGCAGCAGCGGCAGCCTGG - Intergenic
1016182812 6:141168223-141168245 CAAGCCCAGCAGGCGCTGGCCGG - Intergenic
1016363154 6:143289437-143289459 CACAGCCATTAGGGGAAGGCAGG - Intronic
1016384185 6:143515033-143515055 CACGGCCAGCAGCCGCATGTTGG + Intergenic
1017017789 6:150115892-150115914 CAAGCCCAGCAGGCGCCGGCCGG + Intergenic
1017726774 6:157281753-157281775 GACGGCCAGCAGGAGGCGGCTGG - Intergenic
1017800423 6:157890683-157890705 CACGGGCAGCAGGAGATGGCAGG + Intronic
1019128739 6:169858801-169858823 CAGGGCCTGCTGGGGCTGGCCGG + Intergenic
1019492925 7:1323535-1323557 CGCGGCCGGCAGGGGAAGCCGGG - Intergenic
1019507366 7:1399056-1399078 CAGGGCCACCAGAGCCAGGCTGG + Intergenic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1019525229 7:1477712-1477734 CACGGCCAGGGTGGGCAGGCGGG - Intronic
1019667360 7:2258550-2258572 CACGCCCAGGAGGGGCACGGAGG + Intronic
1021006171 7:15397266-15397288 CAAGCCCAGCAGGCGCCGGCTGG + Intronic
1021698968 7:23299447-23299469 CACGGCCAGCAGCCGAAGCCCGG - Exonic
1022479438 7:30733422-30733444 CACAGTCAACAGGGGCAGTCAGG - Intronic
1024196027 7:47059739-47059761 CCCAGCCAGCAGGGCCAGGAAGG + Intergenic
1026740588 7:72976129-72976151 CAGCGCCAGCCGGGGCGGGCTGG + Intergenic
1026797887 7:73377614-73377636 CAGCGCCAGCCGGGGCGGGCTGG + Intergenic
1027058194 7:75064837-75064859 TAGGGCCAGGAGGGGAAGGCGGG - Intronic
1027103144 7:75388942-75388964 CAGCGCCAGCCGGGGCGGGCTGG - Intergenic
1027172032 7:75879257-75879279 CAAGGTGAGCAGGGGCGGGCCGG + Exonic
1027593012 7:80137766-80137788 CTGGGCCAGCAGGGACAGCCAGG - Intronic
1028282531 7:88948596-88948618 GATGGACAGCAGGAGCAGGCTGG - Intronic
1029525091 7:101089196-101089218 CAAGGCCAGCCGGGGCCTGCGGG + Exonic
1030008109 7:105138343-105138365 CATGGCCAGCAGGAGCAGAGGGG + Intronic
1032011891 7:128352344-128352366 CAGGTCCAGCAGCGCCAGGCAGG + Exonic
1032257778 7:130311020-130311042 CAGCGCCAGGAGGGTCAGGCGGG - Intronic
1032783883 7:135185694-135185716 CAGGGCCAGCAGAGCCAGGCTGG + Exonic
1033951300 7:146788144-146788166 CAAGCCCAGCAGGCGCGGGCTGG + Intronic
1034260652 7:149753255-149753277 CAGGGGCAGCAGGGGCAGCAGGG + Intergenic
1034417309 7:150971928-150971950 CCCGGGCAGCAGGTGCTGGCTGG - Intronic
1035102889 7:156416041-156416063 CACTGCCAGCAGGGAGAGCCTGG + Intergenic
1035566310 8:643533-643555 CCCAGCCGGCAGGGGCAGGAGGG - Intronic
1035786614 8:2266225-2266247 CACGGGCGGCTGGAGCAGGCAGG + Intergenic
1035806193 8:2455491-2455513 CACGGGCGGCTGGAGCAGGCAGG - Intergenic
1035830394 8:2688770-2688792 AAGGGCCAGGAGGGCCAGGCCGG - Intergenic
1037816326 8:22114658-22114680 CACTGCCACCAAGGGCAGACAGG + Exonic
1037826977 8:22165419-22165441 CCCGAGCAGCAGCGGCAGGCGGG - Exonic
1037894227 8:22641232-22641254 CAGGGCAAGCTGGGCCAGGCTGG + Intronic
1038694406 8:29793295-29793317 CAAGCCCAGCAAGGACAGGCCGG + Intergenic
1039274745 8:35923097-35923119 CACAGCCAGAAGGGGCAAGTGGG + Intergenic
1039829658 8:41202654-41202676 CACTGCCAGAATGGGTAGGCTGG - Intergenic
1040283916 8:46089840-46089862 GAAGGCCAGCAGGTGCAGGTGGG + Intergenic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1041659958 8:60391891-60391913 CATGGGCAGCAGGGGCAGGCAGG - Intergenic
1042624978 8:70748204-70748226 CAGAGCCAGCAGGAGCAGGTGGG + Intronic
1043052810 8:75404361-75404383 CTCGGCCAGCAGGGTGAGGGTGG - Intergenic
1045459292 8:102412403-102412425 CGCGGCCCGGAGGGGCGGGCAGG + Exonic
1045510874 8:102810900-102810922 CTCGGCGAGCGGGGGCAGGGCGG + Intergenic
1045873446 8:106950898-106950920 CACAGCCAGCTGGGCCAGGTGGG + Intergenic
1049223172 8:141437039-141437061 CACGGCGGGCAGGGCCAGGCCGG - Intergenic
1049223187 8:141437076-141437098 CATGGCGGGCAGGGCCAGGCCGG - Intergenic
1049223202 8:141437113-141437135 CACGGCGGGCAGGGCCAGGCCGG - Intergenic
1049223217 8:141437150-141437172 CACGGCGGGCAGGGCCAGGCCGG - Intergenic
1049223232 8:141437187-141437209 CACGGCGGGCAGGGCCAGGCCGG - Intergenic
1049223247 8:141437224-141437246 CACGGCGGGCAGGGCCAGGCCGG - Intergenic
1049223262 8:141437261-141437283 CACGGCGGGCAGGGCCAGGCCGG - Intergenic
1049251342 8:141590796-141590818 GGCTGCCTGCAGGGGCAGGCAGG + Intergenic
1049409843 8:142467719-142467741 TACGGCAAGCCGGGTCAGGCTGG - Intronic
1049411419 8:142475549-142475571 CACGCCCGGCGCGGGCAGGCAGG - Exonic
1049586588 8:143435268-143435290 CCCGGGCAGCAGGAGCAGGGTGG - Intergenic
1049684151 8:143932601-143932623 CAGGGCCAGCCGGGGGAGGTGGG - Intronic
1049731411 8:144180464-144180486 CACGCCCAGCACGGGCAGCAGGG - Exonic
1053432975 9:38055621-38055643 CATTGCCAGCATAGGCAGGCAGG - Intronic
1053897142 9:42753694-42753716 CAGAGCCAGCAGGGGGTGGCAGG + Intergenic
1056921350 9:90792051-90792073 CAGGGCCAGCAGGGTCAGCAGGG + Intergenic
1056960477 9:91118124-91118146 CAAGGGCCGCAGGTGCAGGCGGG + Intergenic
1056992415 9:91423945-91423967 CGCGGCCGGCAGGGGCGGGCCGG + Intergenic
1057214578 9:93220788-93220810 CTGGGGCAGCACGGGCAGGCAGG - Intronic
1057794607 9:98146289-98146311 CAAAGGCAGCAGGGGAAGGCTGG - Intronic
1057904147 9:98971520-98971542 GAAGGCCAGCAGGTGCGGGCAGG - Intronic
1057943738 9:99306631-99306653 GTCAGCCAGGAGGGGCAGGCGGG - Intergenic
1059154231 9:111975830-111975852 CACAGCCAGCTGGGCCAGCCTGG - Intergenic
1059438563 9:114290221-114290243 CAGGGCCTGCAGGGGCTGCCAGG + Exonic
1060151205 9:121289435-121289457 CACAGCCAGCACCAGCAGGCAGG - Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060766599 9:126298650-126298672 CCCGGAGAGCAGGGGCAGGCGGG - Intergenic
1060934498 9:127507337-127507359 CTCGGCCAGCAGGTGCAGGTTGG + Exonic
1061034463 9:128105993-128106015 CAGGGACAGCAGGGCGAGGCAGG + Intronic
1061242776 9:129383958-129383980 CTGGGCCAGCAGGGCCTGGCGGG - Intergenic
1061501945 9:131009113-131009135 CCCGCCCCGCAGGGGAAGGCGGG + Exonic
1061519901 9:131111851-131111873 CGGGGCCCGCAGGGGCAGGGAGG - Intronic
1061682317 9:132249143-132249165 CACTGCCAGCCGGCCCAGGCTGG - Intergenic
1061887437 9:133598974-133598996 TGCATCCAGCAGGGGCAGGCTGG - Intergenic
1061929016 9:133822708-133822730 TACGGCCAGGAGGGACAGTCCGG - Intronic
1062031684 9:134364776-134364798 TAACGTCAGCAGGGGCAGGCTGG - Intronic
1062390577 9:136332095-136332117 CACGGGCAGCAGCAGCGGGCGGG - Intronic
1062439533 9:136563505-136563527 CAGAGCCAGCTGGGGCAGGCTGG + Intergenic
1062539723 9:137036179-137036201 CAGGGTCAGCAGGCTCAGGCCGG + Exonic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1185469328 X:373423-373445 CACGGCCAGCAGCGGCGAGCGGG + Intronic
1189245690 X:39561570-39561592 CCAGGCCTGGAGGGGCAGGCTGG + Intergenic
1190136376 X:47803209-47803231 CAGCGACAGCAAGGGCAGGCTGG - Intergenic
1198565117 X:137896319-137896341 CACAGGCAGCAGGGGCAGCAAGG + Intergenic
1199685655 X:150263053-150263075 CACGGCAACCAGGTGGAGGCAGG - Intergenic
1200097539 X:153671231-153671253 CCAACCCAGCAGGGGCAGGCAGG + Intronic
1200232350 X:154450316-154450338 CACGGTGAGGAGGGGCTGGCAGG + Exonic
1200430356 Y:3072745-3072767 CAAGCCCAGCAGGTGCCGGCAGG - Intergenic