ID: 1136412373

View in Genome Browser
Species Human (GRCh38)
Location 16:30084922-30084944
Sequence ACATTCCCACAGCTGGAAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136412373_1136412377 -9 Left 1136412373 16:30084922-30084944 CCGCCTTCCAGCTGTGGGAATGT 0: 1
1: 0
2: 3
3: 33
4: 326
Right 1136412377 16:30084936-30084958 TGGGAATGTGGCAGCCATCTTGG 0: 1
1: 0
2: 3
3: 25
4: 268
1136412373_1136412378 -3 Left 1136412373 16:30084922-30084944 CCGCCTTCCAGCTGTGGGAATGT 0: 1
1: 0
2: 3
3: 33
4: 326
Right 1136412378 16:30084942-30084964 TGTGGCAGCCATCTTGGAGCTGG 0: 1
1: 0
2: 5
3: 27
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136412373 Original CRISPR ACATTCCCACAGCTGGAAGG CGG (reversed) Exonic
900518570 1:3094954-3094976 ACCTTCTCACAGCTGCATGGGGG + Intronic
900696638 1:4016295-4016317 CCAGTCCAACAGCTGGAAAGTGG - Intergenic
901380732 1:8872095-8872117 TAATTCACACAGCTGGTAGGAGG - Intronic
903350944 1:22716261-22716283 ACAATCCCACAGGAGGGAGGGGG - Intronic
903684327 1:25119895-25119917 AGAATCACACAGCTAGAAGGTGG - Intergenic
906200799 1:43958937-43958959 ACATTCCCACAGGTGGGGGTTGG - Intronic
906221830 1:44086528-44086550 ACAGTACAATAGCTGGAAGGGGG + Intergenic
907309049 1:53528985-53529007 ACCATCGCACAGCTGGACGGTGG - Intronic
909087135 1:71181420-71181442 ACATTCTCACAGTGGGAAGCTGG + Intergenic
910425150 1:87114188-87114210 ACAGTCACACAGCTAGAAAGTGG + Intronic
911944266 1:104086155-104086177 ACATTCACACAGCTGCTAAGGGG + Intergenic
914457166 1:147846857-147846879 ACAGTCACACAGCTGGTAAGTGG + Intergenic
915622698 1:157095641-157095663 GCATTCCCAGAGCTGGGACGGGG + Intronic
916818435 1:168375286-168375308 ACCTTCCCCCACCTGGAAGTGGG - Intergenic
917655159 1:177118843-177118865 ACAGTCCCCCAACTAGAAGGTGG - Intronic
917770239 1:178269355-178269377 ACATTCCCCCATTTTGAAGGAGG + Intronic
918136896 1:181681723-181681745 ACTTACTCACAGCTGGTAGGTGG - Intronic
921157370 1:212449150-212449172 AGAGCCCCACAGCTGGGAGGAGG - Intergenic
922272424 1:224045797-224045819 AAATTCCCACTGCTGGGAGCAGG - Intergenic
922738730 1:228004237-228004259 ACATTCCAACACTTGGAACGGGG - Intergenic
923567793 1:235089733-235089755 ACAGCGGCACAGCTGGAAGGCGG + Intergenic
924193213 1:241577999-241578021 ACATTCCTGCAGATGGAAAGAGG - Intronic
1063206171 10:3833300-3833322 ACTATCACACAGCTGGCAGGTGG + Intergenic
1066404838 10:35108603-35108625 ACATTCCCAAATCTGGAAACAGG - Intergenic
1068665442 10:59670469-59670491 ACAGTCACACAGCTGGCAAGTGG + Intronic
1070698663 10:78582707-78582729 TCAATCCCACACCTGGAAGAAGG + Intergenic
1071008652 10:80912370-80912392 TGATTCCCAGGGCTGGAAGGTGG + Intergenic
1071251295 10:83822537-83822559 AAATTCCCACAGGTAGGAGGTGG + Intergenic
1071629184 10:87204296-87204318 AGGGTCCCACAGCTAGAAGGTGG - Intergenic
1071988527 10:91076502-91076524 ACATTTACACAGCTGGTTGGAGG + Intergenic
1073312017 10:102549754-102549776 ACATACCCGCAGCTGGCAGGAGG + Intronic
1075707177 10:124508248-124508270 AAATGCCCACGGCTGGGAGGTGG - Intronic
1076552893 10:131295749-131295771 ACATTCAAATAGCTAGAAGGAGG - Intronic
1077561762 11:3267531-3267553 AAATGCCCACAGCAGAAAGGGGG - Intergenic
1077567656 11:3313351-3313373 AAATGCCCACAGCAGAAAGGGGG - Intergenic
1079348901 11:19676300-19676322 ACAGACACACAGCTGGAAGGTGG - Intronic
1080188111 11:29515800-29515822 ACATTCCCACAAGTGGCAGGTGG - Intergenic
1080636126 11:34125236-34125258 CGATTCCCCCAGCTGGGAGGAGG + Intronic
1080702452 11:34655552-34655574 AGAGTCACACAGCTGGAATGTGG - Intronic
1080842387 11:35996921-35996943 CCATTCCCAAAGCTGCATGGAGG - Intronic
1080855430 11:36107740-36107762 ACTTACACAAAGCTGGAAGGAGG - Intronic
1081764516 11:45600318-45600340 ACATCCCCCCAGCTGGTAAGTGG + Intergenic
1082044067 11:47710694-47710716 CCATTTCCTCAGCTGTAAGGTGG - Intronic
1083417844 11:62536782-62536804 AGGGTCCCACAGCTAGAAGGAGG - Intronic
1084192086 11:67503971-67503993 CCATTCCCACATCTGAAGGGGGG + Intronic
1084712841 11:70854747-70854769 AAACACCCACAGCTGGAAGCAGG + Intronic
1085491149 11:76918805-76918827 AAGTTCACACAGCTAGAAGGTGG + Intronic
1085989579 11:81825613-81825635 AAATTCCAAGAGCAGGAAGGAGG + Intergenic
1086076373 11:82857391-82857413 ACATTCACACAGCTAGTAAGCGG + Intronic
1086435442 11:86775456-86775478 ATTTTCCCACAACTGGAAGATGG - Intergenic
1087051518 11:93890500-93890522 AGATGCCTACAGCTGCAAGGAGG + Intergenic
1087764766 11:102138479-102138501 ACATTCCAAAAGGGGGAAGGTGG + Intronic
1088703336 11:112434573-112434595 ACATTCCCACTGCTGGCATCAGG - Intergenic
1089375066 11:117988344-117988366 TCAGTACCACAGCTGGGAGGGGG - Intronic
1090157951 11:124461289-124461311 ACATCCCTATAGCTGCAAGGTGG - Intergenic
1090167906 11:124570845-124570867 ACATTCCCACGGCTGCAAGGTGG - Exonic
1090915946 11:131162101-131162123 ACAGCCCCATGGCTGGAAGGAGG - Intergenic
1093162002 12:15758198-15758220 ACATTCCTGCAGCTGAGAGGTGG - Intronic
1093533965 12:20201518-20201540 ACATTCCTACAGGTGAAAAGAGG - Intergenic
1093684462 12:22040467-22040489 AAATCCCCACAGCTGGCAAGTGG - Intergenic
1093885543 12:24455786-24455808 ACCTCCCGGCAGCTGGAAGGAGG - Intergenic
1094062976 12:26334372-26334394 ACATTTCCACAGCTGTGAGTAGG + Intergenic
1095404051 12:41848027-41848049 ACAGTCCCACAGCTAGGAAGTGG - Intergenic
1096868663 12:54579735-54579757 GCGGTCCCACAGCTGGAAGAGGG + Exonic
1097269939 12:57767688-57767710 AAATTCCCATGTCTGGAAGGAGG - Intronic
1098184758 12:67884239-67884261 AAATTCTCAAAGATGGAAGGAGG + Intergenic
1098789525 12:74804055-74804077 ACATTCCCACATCTTCAAGATGG - Intergenic
1098795445 12:74882441-74882463 TGATTCCCAAAGCTGGAAGTGGG - Intergenic
1099567133 12:84265938-84265960 ACTTTCCCACATTTGGAAAGGGG - Intergenic
1099658718 12:85527879-85527901 CCATTCTCACATCTGGAGGGTGG - Intergenic
1099898888 12:88682493-88682515 ACATTGCCAGAGCAGGAAGAAGG - Intergenic
1100578242 12:95913189-95913211 ATATTCCCACAGCTAGTAAGAGG - Intronic
1100920995 12:99486794-99486816 ACATTCCTACAGATGAAAAGAGG - Intronic
1103167357 12:118781787-118781809 AGATTCCCACAGCTGGTAAGTGG - Intergenic
1103554313 12:121756853-121756875 ACAGTCCCACAGCCGGGAAGAGG - Intronic
1104399245 12:128462040-128462062 TCATTCCCAGAGCTCCAAGGAGG - Intronic
1104593375 12:130102579-130102601 TCATTCCCACTGTTTGAAGGAGG - Intergenic
1106767238 13:32925292-32925314 ACAGTCACACAGCTGGTAGGCGG - Intergenic
1106778575 13:33032651-33032673 ACATGCCCACAGATTCAAGGGGG + Intronic
1109018391 13:57050968-57050990 AAATTCCCACATCTGAAAGTTGG + Intergenic
1110854341 13:80279520-80279542 ACATTTCCACAACTGGAATTTGG + Intergenic
1111742061 13:92217016-92217038 ACAGTCACACAGCTGGCAAGAGG + Intronic
1112375385 13:98835451-98835473 ACCTCCCCCCAGCTGGGAGGTGG - Intronic
1112760573 13:102689767-102689789 CCATTTCCTCAGCTGAAAGGTGG + Intronic
1113072513 13:106435254-106435276 ATAGTCCCAGGGCTGGAAGGGGG - Intergenic
1113368782 13:109704318-109704340 ACATTCCCACAGGTACATGGAGG - Intergenic
1113571463 13:111361203-111361225 ATATGGCCACAGCTGGGAGGTGG + Intergenic
1116522134 14:45862416-45862438 GCATTCTCACAGGTGTAAGGTGG - Intergenic
1116631690 14:47343336-47343358 ATACTCCCACAGCTCAAAGGAGG + Intronic
1117324358 14:54655242-54655264 TCCTTCCCACAGCTGGAGGTAGG + Intronic
1117668646 14:58082884-58082906 ACATGACCCCAGCTGGATGGAGG - Intronic
1118178933 14:63471686-63471708 ACCATCACACAGCTGGAAAGGGG + Intronic
1118771195 14:68943811-68943833 ACAGTCACACAGCTGGCAAGAGG + Intronic
1119005827 14:70927000-70927022 ATATGCCCACAGCTGGTAAGCGG - Intronic
1119612346 14:76074349-76074371 ACATTTCCACAGATGAAAGCTGG + Intronic
1120146492 14:80984520-80984542 AGATTCCCACAGCAGGCAGGTGG + Intronic
1120392275 14:83924235-83924257 GAGTTCCCACAGCTGGAATGGGG + Intergenic
1121740377 14:96247802-96247824 AAATTCCCACAGCTGGGAAGTGG - Intronic
1121835435 14:97088049-97088071 AAAGTCGCACAGCTGGTAGGAGG - Intergenic
1122125630 14:99577016-99577038 TCAGTCCCACAGCTGGCTGGAGG + Intronic
1122569287 14:102683796-102683818 CCCTTCCCACAGCTGGAAGCTGG + Intronic
1122578752 14:102758028-102758050 AGAGTCCCACAGCTGGAACGTGG + Intergenic
1122638924 14:103145795-103145817 AAACTCCCACAGCTGGGAGACGG + Intergenic
1122665450 14:103326644-103326666 GCATACCCACACCTGGAGGGGGG + Intergenic
1124058321 15:26263009-26263031 AGACTCCCACAGCAGGATGGAGG + Intergenic
1124145569 15:27122442-27122464 AGGTTCCCACAGCTAGAAGTGGG + Intronic
1127029650 15:54847911-54847933 ACATTCTAAGAGCTTGAAGGAGG - Intergenic
1127539359 15:59921738-59921760 ACATGCTCACTTCTGGAAGGAGG - Intergenic
1129457492 15:75683499-75683521 CCCCTCCCTCAGCTGGAAGGAGG - Intronic
1129726302 15:77903446-77903468 TCCCTCCCTCAGCTGGAAGGAGG + Intergenic
1130407928 15:83618905-83618927 TCCATCCCCCAGCTGGAAGGAGG - Intergenic
1130509036 15:84573130-84573152 AAGTTCACACAGCTGGAGGGTGG - Intergenic
1130756062 15:86764827-86764849 ACATTCACCCAGCTCAAAGGTGG - Intronic
1131201626 15:90402142-90402164 ACTTTCCCTCAGGTGGCAGGTGG - Intronic
1131385620 15:92004248-92004270 ACAATCACACAGCTAGCAGGTGG - Intronic
1131667191 15:94583036-94583058 CCATTTGCACAGCTGGAAAGTGG - Intergenic
1131972978 15:97910961-97910983 ACAATCACACAGCTAGAAAGTGG - Intergenic
1134016049 16:10889196-10889218 ACATTGCCAGAGCGGGATGGAGG - Intronic
1136098895 16:27978725-27978747 CCAGTCCCACAGCTAGCAGGTGG - Intronic
1136412373 16:30084922-30084944 ACATTCCCACAGCTGGAAGGCGG - Exonic
1136596865 16:31256710-31256732 TCACTCCCACAGCTGGCAGTTGG - Intergenic
1138115433 16:54357188-54357210 ACAGTCACACAGGTAGAAGGTGG - Intergenic
1138629196 16:58280047-58280069 ACCTTCCCACACCTGGGAGAGGG + Exonic
1139022059 16:62761680-62761702 ATATTACCATAGATGGAAGGTGG + Intergenic
1139349482 16:66326289-66326311 ACATTCAGACTGCAGGAAGGTGG + Intergenic
1139391405 16:66608167-66608189 ACAGTCCCGCAGCTGGGAAGTGG - Intronic
1141479057 16:84294359-84294381 ACATGCCCACATCAGGCAGGAGG + Intergenic
1141629740 16:85280768-85280790 ACACTGACACAGCTGCAAGGAGG - Intergenic
1141970122 16:87475854-87475876 AATTTCCCACAGCTGGCAGAAGG + Intronic
1142799678 17:2337455-2337477 CCCTTCCCACAGCCGGAGGGGGG - Exonic
1143366808 17:6413965-6413987 AGACTCCCACAGGTGGAAGAAGG + Intronic
1144276394 17:13672505-13672527 ACATTCCTACAGATGAAAAGGGG + Intergenic
1144749958 17:17641745-17641767 AATGTCACACAGCTGGAAGGTGG + Intergenic
1144939696 17:18929962-18929984 ACATTCCCACAGCCGTGAGTTGG + Intronic
1145067423 17:19771194-19771216 AAAGCCCCACAGCTGGAAAGCGG - Intronic
1146442791 17:32911722-32911744 ACATTTCTACAGCTGGTAAGTGG - Intergenic
1146531914 17:33614864-33614886 ATAGTCCCACAGCTGGAAAGTGG - Intronic
1146931160 17:36778878-36778900 AAATTCCCACATCTGCCAGGTGG + Intergenic
1147886102 17:43685364-43685386 GCATTCCCACAACTAGGAGGTGG + Intergenic
1148403726 17:47391607-47391629 GCATTGACACATCTGGAAGGAGG + Intronic
1149146064 17:53494271-53494293 AGTTTCCAGCAGCTGGAAGGAGG + Intergenic
1149260411 17:54874337-54874359 ACCTTTCCACATCTGGAAAGGGG + Intergenic
1149442332 17:56685190-56685212 ACAGTCCCTCAGTTGAAAGGGGG - Intergenic
1149596642 17:57868298-57868320 CCTTTCCCACACCTGGGAGGAGG - Intronic
1150971114 17:70029427-70029449 ACATTCCAGCAGGTGGCAGGGGG + Intergenic
1151450569 17:74196049-74196071 GCTGGCCCACAGCTGGAAGGAGG + Intergenic
1152071501 17:78136137-78136159 ACATTCCCACTGCTGATATGGGG - Intronic
1152137358 17:78512379-78512401 CCCTTCCCACCGCTTGAAGGTGG + Intronic
1153059877 18:983973-983995 ACATTCTCAGAACTGGAAGAAGG - Intergenic
1153906004 18:9661791-9661813 TCATTCTCACAGCTGCCAGGAGG - Intergenic
1155536689 18:26825893-26825915 AAGTTCCCACAGCTGGTAAGTGG + Intergenic
1156017900 18:32566989-32567011 ACATCCAGAAAGCTGGAAGGTGG + Intergenic
1156404779 18:36773489-36773511 ACATGCCCACAGCAGGGATGGGG + Intronic
1156492921 18:37506896-37506918 ACTTTCCGGGAGCTGGAAGGGGG + Intronic
1157281047 18:46346566-46346588 AAAGTCCCGCAGCTGGTAGGTGG - Intronic
1159569341 18:70094414-70094436 AAATGCCCACAGGAGGAAGGGGG - Intronic
1160437742 18:78864849-78864871 ACTCTGCCACAGCTGGAAGTTGG - Intergenic
1161471719 19:4460551-4460573 AAAGTCACACAGCTGGAAAGTGG + Intergenic
1163324640 19:16595251-16595273 ACAGTCACAGAGCTGGAAAGAGG - Intronic
1164591517 19:29510206-29510228 GCATCCCCACAGCTGGCATGAGG + Intergenic
1165408132 19:35642985-35643007 AGCTTCCCACAGCTGGACTGGGG + Exonic
1166778581 19:45327583-45327605 AAAGTCACACAGCTGGAAGGGGG + Intergenic
1167203994 19:48087501-48087523 ACATTCCTACAGATGAAAAGAGG + Intronic
1167979766 19:53264592-53264614 ACATTTACACAGCTGGGAGATGG + Intergenic
925912508 2:8582943-8582965 GCAGTCCCACAGAGGGAAGGTGG - Intergenic
926483154 2:13424927-13424949 AAATGCCCACATCTGAAAGGTGG - Intergenic
926852476 2:17214846-17214868 ACAGTCACACAGCTGGAACCTGG + Intergenic
927036929 2:19187744-19187766 AGCTTCCCACAGCTGGAATGGGG - Intergenic
927837663 2:26413453-26413475 ACATTCCCACCCATGGAATGTGG + Intronic
928006980 2:27571353-27571375 ACCTTCCCACAGCCGGAAGGTGG + Intergenic
929711164 2:44268001-44268023 ACATTTCCCCAGCTGTAAGATGG + Intergenic
931838924 2:66128543-66128565 ATCTTCCCACAGGTGGAAGCTGG + Intergenic
932362346 2:71119227-71119249 ACATCACCACACCTGGATGGTGG + Intronic
933131967 2:78682827-78682849 ACATTCCTACAGATGAAAAGAGG + Intergenic
933953043 2:87347547-87347569 ATATACCCACAGCTCGGAGGAGG - Intergenic
935129089 2:100247895-100247917 ACTTTCTCACTGGTGGAAGGAGG - Intergenic
935627860 2:105185835-105185857 TCAAGCCCCCAGCTGGAAGGAGG - Intergenic
935926538 2:108075734-108075756 ACATTCCCACAGATAGTAAGTGG + Intergenic
936845210 2:116822575-116822597 ACAATACTGCAGCTGGAAGGGGG - Intergenic
936879344 2:117231722-117231744 ACATTCCTACAGATGAAAAGAGG - Intergenic
937064895 2:119010532-119010554 ACAGTTACACAGCTGGTAGGAGG + Intergenic
937209353 2:120258441-120258463 ACATTCACAGGGCTGGAAGAAGG + Intronic
937461509 2:122092060-122092082 ACATTCCTACAGATGAAAAGAGG - Intergenic
938152312 2:128897956-128897978 ACATATCCACAGCTGGACTGAGG + Intergenic
939475010 2:142675580-142675602 ACATTCCCACTGCCGGAACCAGG + Intergenic
939641483 2:144644854-144644876 ACAGTGCCACAGCTTGAATGGGG - Intergenic
939673648 2:145044662-145044684 ACATTCCTAAAGCTAGAAGAAGG + Intergenic
940011572 2:149060262-149060284 ACTTGCCCACAGTTGGAAAGTGG - Intronic
940986291 2:160055474-160055496 TCACTCCCACATGTGGAAGGAGG + Intronic
943531399 2:189085875-189085897 AAAGTCACACAGCTGGAAGATGG - Intronic
944479890 2:200145655-200145677 ACATGGCCAAAGCAGGAAGGAGG + Intergenic
946145033 2:217724205-217724227 ATACTCACTCAGCTGGAAGGCGG + Intronic
946819883 2:223618716-223618738 CAAATCCCACAGCTGGAATGTGG + Intergenic
947466803 2:230358084-230358106 CCATTTCCTCAGCTGGAAGTAGG - Intronic
947819219 2:233059127-233059149 AGGTTCCCACAGCTTGAATGTGG + Intergenic
948423340 2:237873907-237873929 AGAGTCCCACAGCTGGGATGAGG - Intronic
1172046205 20:32082098-32082120 ACAGTCACACAGCTGGTAAGTGG - Intronic
1172152349 20:32799266-32799288 CCATTCCCGCAGCCCGAAGGCGG + Exonic
1172205414 20:33159802-33159824 ACTTCTACACAGCTGGAAGGAGG + Intergenic
1173175896 20:40764695-40764717 ACATGCACACAGCTAGAAAGTGG + Intergenic
1173483525 20:43422734-43422756 AGTTTCACACAGCTAGAAGGAGG + Intergenic
1173570621 20:44073426-44073448 ACTTTCCCATGGCTGGCAGGCGG - Intergenic
1174534301 20:51238861-51238883 ACAGTCACACAGCAGGAATGCGG + Intergenic
1175620576 20:60443681-60443703 CACTTCCCACTGCTGGAAGGTGG + Intergenic
1175814204 20:61875090-61875112 ACAGCCCCAAACCTGGAAGGAGG - Intronic
1176337054 21:5609016-5609038 TCATGCCCACAGATGAAAGGTGG - Intergenic
1176372091 21:6068398-6068420 ACATTCCCACATGGCGAAGGTGG + Intergenic
1176390703 21:6211932-6211954 TCATGCCCACAGATGAAAGGTGG + Intergenic
1176470716 21:7104242-7104264 TCATGCCCACAGATGAAAGGTGG - Intergenic
1176494277 21:7486020-7486042 TCATGCCCACAGATGAAAGGTGG - Intergenic
1176506365 21:7652363-7652385 TCATGCCCACAGATGAAAGGTGG + Intergenic
1177194309 21:17886533-17886555 AAATTCACACAGCTGGCAAGAGG + Intergenic
1178265331 21:31137732-31137754 TCCTTCCCATGGCTGGAAGGTGG - Intronic
1179751428 21:43470141-43470163 ACATTCCCACATGGCGAAGGTGG - Intergenic
1180151396 21:45950105-45950127 GAATTCCCACAGGTGGGAGGTGG + Intergenic
1181779226 22:25180909-25180931 AAATACCCCCAGCTGGAACGTGG + Intronic
1181946568 22:26522239-26522261 ACAGTCGCACAGTTGGAAAGTGG + Intergenic
1182373356 22:29828002-29828024 ACAATCCCACAGGGGGAAGATGG + Intronic
1182901734 22:33904129-33904151 ACATCCCCGGAGCTGGTAGGAGG - Intronic
1183262937 22:36807664-36807686 CCATTCCCACACCTGGAAAGTGG - Intronic
1183493740 22:38130063-38130085 ACATTTCCACACCTGGAGGCCGG + Intronic
1183667114 22:39252510-39252532 AGGGTCCCACAGCTGGGAGGGGG - Intergenic
1184226527 22:43132003-43132025 ACATTCCCATATAAGGAAGGAGG + Intergenic
1184455117 22:44605736-44605758 ACACTTACTCAGCTGGAAGGAGG + Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
952993756 3:38856399-38856421 ACATTCCTACAGATGAAAAGAGG + Intronic
954194410 3:48987991-48988013 AAATTCCCACAGCTGACAGCAGG + Intergenic
954937404 3:54339183-54339205 ACATTCACAGAGCTTGAGGGAGG - Intronic
955403214 3:58608581-58608603 AAAGTCCCACAGCTGGCAAGTGG + Intronic
955794473 3:62621349-62621371 ACATTCCCATTCCTTGAAGGTGG - Intronic
956085096 3:65599521-65599543 ACAGTCACACAGCTGGAAAATGG - Intronic
958556172 3:95679743-95679765 ACATACCCAAAGCTGTAAGCTGG + Intergenic
961201236 3:125047456-125047478 ACAGTCCTACAGCTGGCAAGTGG + Intronic
961654576 3:128433980-128434002 ACATTCCTGCAGCTGGAATCAGG + Intergenic
961844842 3:129753073-129753095 ACATTCCCAGAGTTGGAGGAAGG - Intronic
962745806 3:138396595-138396617 ACTTTCCCTCAGCAGGAAGGAGG + Intronic
964141070 3:153400267-153400289 ACATTCCCTCAGCTGGAATAAGG - Intergenic
964460765 3:156924083-156924105 ACATTCCCACACCATGAATGAGG + Intronic
965291307 3:166885334-166885356 ACATTCCTACAGGAGTAAGGTGG - Intergenic
965618436 3:170618755-170618777 ACATTCCCACAGGAGAAAGCAGG - Intronic
965643249 3:170853917-170853939 ACATTTCCATAGCTACAAGGAGG - Intronic
966703152 3:182878608-182878630 ACAGTCTCACTGCTGGAAAGTGG - Intronic
967853463 3:194099198-194099220 ACACTCACACAGCTGGCAAGAGG - Intergenic
968438486 4:608827-608849 ACATTCCCAGAGACAGAAGGTGG - Intergenic
971095780 4:23400197-23400219 ACATGGCCACTGCTGGAGGGCGG + Intergenic
971171777 4:24241027-24241049 CCATTCCTACAGCTGGAGGTGGG - Intergenic
972487767 4:39558620-39558642 ACAATCCCACAGCTGGAAAAAGG + Intronic
977345583 4:95812250-95812272 CCTTTCCCACAGTGGGAAGGTGG - Intergenic
978134217 4:105236976-105236998 ACATTATCACAGCTTGCAGGTGG - Exonic
978165623 4:105603313-105603335 AAAGTCACACAGCTGGAATGTGG + Intronic
979047271 4:115884020-115884042 ACCTTCTCACAGTTTGAAGGTGG - Intergenic
979195444 4:117915728-117915750 ACATTCCTACAGATGAAAAGAGG - Intergenic
979434762 4:120674721-120674743 ACATTCCTACAGATGAAAAGAGG + Intergenic
980969779 4:139557136-139557158 CCATTACCACAGCAGCAAGGAGG - Intronic
982044265 4:151426676-151426698 ACATTACAACAGCTGAAAGATGG - Intronic
983116962 4:163830533-163830555 ACCTTTCCAAATCTGGAAGGAGG - Intronic
983394079 4:167170609-167170631 AAAGTCACACAGCTGGAAAGTGG + Intronic
985101938 4:186467090-186467112 TCATTCCCACAGCTGCTGGGAGG + Intronic
985615459 5:917534-917556 ACATTACTCCAGGTGGAAGGTGG + Exonic
986204477 5:5610699-5610721 ACATTCCTACAGGAGGCAGGAGG + Intergenic
986204490 5:5610771-5610793 ACATTCCTACAGGAGGCAGGAGG + Intergenic
986204502 5:5610843-5610865 ACATTCCTACAGGAGGCAGGAGG + Intergenic
986204515 5:5610915-5610937 ACATTCCTACAGGAGGCAGGAGG + Intergenic
986750039 5:10779104-10779126 ACATTCTCACAGCTGGTCAGTGG + Intergenic
986831558 5:11585106-11585128 ACATTTCCATAGCTGGAGGGTGG + Intronic
987856384 5:23424775-23424797 GCATTCCCATAGCTGGTTGGAGG - Intergenic
988025576 5:25683628-25683650 ACATTTCAATCGCTGGAAGGTGG + Intergenic
988823726 5:34914275-34914297 ACAGTCCCACAGCTGGTAAGTGG - Intronic
989008202 5:36839251-36839273 TCATTCTCACAGCTAGTAGGTGG + Intergenic
989398097 5:40980113-40980135 ACATTTCCACATCAGGAATGTGG - Intronic
989640684 5:43580205-43580227 ACGCCCCCACAGATGGAAGGAGG + Intergenic
991452556 5:66768371-66768393 ACATTGTCACAGGAGGAAGGAGG + Intronic
992485650 5:77191722-77191744 ATATTTCCACAGATCGAAGGTGG + Intergenic
993372331 5:87108311-87108333 AGGTTCCCATAGCTGGAAAGTGG - Intergenic
993434351 5:87873095-87873117 TCATTCTCACAGCTGGAAACTGG + Intergenic
994097092 5:95857255-95857277 ACAGGCCCTCAGCTGGAATGTGG + Intronic
994112265 5:96020121-96020143 AAAGTCACACAGCTGGAAAGTGG + Intergenic
994114878 5:96050751-96050773 TCAATCCCACAGCTGCAAGAGGG - Intergenic
996709231 5:126527423-126527445 ACATGCACACAGCTGGGAGCTGG - Intergenic
997717434 5:136052691-136052713 AGGGTCCCACAGCTGGAAAGTGG + Intronic
998391672 5:141790869-141790891 AAGCTCCCACAGCTGGAAAGTGG + Intergenic
999135330 5:149315043-149315065 ACATTCCCACAGCTAATAAGTGG + Intronic
1000227830 5:159284620-159284642 AAATTCACACAGCTAGAAAGTGG - Intronic
1001180383 5:169514589-169514611 TCATCTCCACAGCTGGAGGGAGG - Intergenic
1002607298 5:180390777-180390799 ACATGTCCACAGCTGGATGGTGG + Intergenic
1003093473 6:3123618-3123640 ACATCCCCACAGGGGGAAAGGGG - Intronic
1003218132 6:4134185-4134207 ACATACACACAGGTGGAAGGAGG + Intronic
1004242327 6:13936029-13936051 ACATGGCCAGAGCAGGAAGGAGG + Intronic
1004321119 6:14632458-14632480 AAATACCCAGAGCTGGATGGTGG + Intergenic
1004715661 6:18214210-18214232 GCATACCCAGAGCTGGACGGGGG + Intronic
1005785562 6:29242093-29242115 ACATGCCCACAGGAGGAAGGGGG - Intergenic
1006192365 6:32217435-32217457 AAAGTCACACAGCTGGCAGGTGG - Intronic
1006395974 6:33788221-33788243 CTCTTCCCACAGCTGGAAGAAGG + Intronic
1008929419 6:56922679-56922701 CCATTCATGCAGCTGGAAGGAGG - Intronic
1012144897 6:95669201-95669223 AAATTCTCACAGCTTAAAGGAGG - Intergenic
1012292443 6:97473981-97474003 AGATTCCCACAGCTGGCTAGCGG - Intergenic
1012302905 6:97612329-97612351 ACATTCACTCACCTGGAAGGGGG - Intergenic
1012320859 6:97843877-97843899 AAATTCTTACTGCTGGAAGGAGG - Intergenic
1013112546 6:107075859-107075881 ACATTCCTACAGCAGGTGGGAGG + Intronic
1014103985 6:117542700-117542722 ACATTTCCCCAGATGGCAGGCGG - Intronic
1014421056 6:121245803-121245825 ACATTCCCACAGATGAAAAGAGG + Intronic
1014486666 6:122007577-122007599 ACATTCCCTTTGCTGGCAGGTGG - Intergenic
1015713701 6:136168563-136168585 ACATTCTGGCAGCTGTAAGGAGG + Intronic
1015770623 6:136764474-136764496 TCATTCCCATGACTGGAAGGTGG - Intronic
1016498217 6:144689090-144689112 GCATTCCTACAGATGGAAAGAGG - Intronic
1016803188 6:148187124-148187146 ACATGTCCACACCTGGCAGGAGG + Intergenic
1017363390 6:153603649-153603671 ACATTCTCCCAGCTGCTAGGAGG - Intergenic
1017375274 6:153761171-153761193 ACATTCCCACAGATGAAAAGAGG + Intergenic
1021619911 7:22541251-22541273 AAAGTCCCACAGCTGGTATGTGG - Intronic
1024579716 7:50792561-50792583 ACATTTCCACGGCTGGCGGGCGG + Intronic
1024965929 7:55021862-55021884 ACTTTCCCACAGCTGGTGGGAGG + Intronic
1026340837 7:69432648-69432670 ACTTTCCATCAGTTGGAAGGAGG + Intergenic
1027797840 7:82716080-82716102 CCATTCCTTCAGGTGGAAGGAGG - Intergenic
1030150088 7:106395682-106395704 ACAGTCACACAGCTGGAAAGTGG + Intergenic
1030799087 7:113827208-113827230 TCATCCCCACATGTGGAAGGAGG - Intergenic
1033217705 7:139505524-139505546 ACACTCCCAGAGCTAGCAGGTGG - Intergenic
1033870046 7:145742116-145742138 AGTTTGCTACAGCTGGAAGGGGG - Intergenic
1035595188 8:852059-852081 CAATTCTCACAGCTGGCAGGAGG - Intergenic
1037474651 8:19245154-19245176 GAATTCCTGCAGCTGGAAGGTGG - Intergenic
1038005948 8:23430698-23430720 CTATGCCCAGAGCTGGAAGGCGG + Exonic
1040764790 8:50894365-50894387 ACATTCCAACTGCTTGAATGAGG - Intergenic
1042213585 8:66406101-66406123 ACATTTCTAAAGCTGGAAAGGGG - Intergenic
1042692365 8:71515258-71515280 GCATTCCCACAGCTGGTCAGTGG + Intronic
1044117477 8:88352163-88352185 ACATTCAAACAGCTGGTAGTAGG + Intergenic
1045352959 8:101359365-101359387 TCATTCCCATAACAGGAAGGAGG - Intergenic
1047646442 8:126875231-126875253 CCTTTCCCACAGCAGGAACGGGG + Intergenic
1048888765 8:138930142-138930164 AAGTTCCAACAGCTGGAAAGTGG + Intergenic
1049050819 8:140193764-140193786 ACAATCGCACAGCTTGGAGGTGG - Intronic
1049696191 8:143985410-143985432 ACCTTGCCACTGCTGGAAGGAGG + Exonic
1049826502 8:144672082-144672104 AAATTCCCACATGTGGGAGGGGG - Intergenic
1050121249 9:2310136-2310158 ACAGGCCCACAGCTGAATGGGGG - Intergenic
1050157585 9:2683860-2683882 ATAGTCCCAAAGCTGCAAGGGGG + Intergenic
1051140599 9:13974982-13975004 ACAAGACCACAGCTGTAAGGTGG - Intergenic
1052957281 9:34263161-34263183 ACATTCCTTCAGCTGCAAAGTGG + Exonic
1053421234 9:37980099-37980121 AAATTCCCACAGCTGGGGGGAGG - Intronic
1053729546 9:41039403-41039425 AAATTCCCACAGCTAGTAAGTGG + Intergenic
1054698961 9:68392659-68392681 AAATTCCCACAGCTAGTAAGTGG - Intronic
1054813496 9:69453376-69453398 AAATTCACACAGCTTGCAGGAGG + Intronic
1055800883 9:80034146-80034168 TGATTCCCAATGCTGGAAGGAGG - Intergenic
1056316542 9:85395864-85395886 ACATGGCCTCAGATGGAAGGTGG + Intergenic
1057991644 9:99776605-99776627 ACTTTCCCACAACTGGCAGGTGG + Intergenic
1058353847 9:104059149-104059171 ACATGGACACAGTTGGAAGGGGG + Intergenic
1059531877 9:115042937-115042959 CCATTCCTAGAACTGGAAGGAGG + Intronic
1059743925 9:117181985-117182007 ACCATTTCACAGCTGGAAGGTGG - Intronic
1059922645 9:119175952-119175974 ACATTACCTCAGCTTGCAGGTGG - Intronic
1059957745 9:119535861-119535883 ACATTTCCAGTGCTGGATGGTGG - Intergenic
1060977962 9:127776524-127776546 ACAGTCCCACAGCTGGGGGCAGG - Intronic
1060987645 9:127828814-127828836 ACATGCCCACTGCGGGAGGGAGG - Intronic
1061958215 9:133974557-133974579 CCATTTCCACAGTAGGAAGGTGG - Intronic
1203424598 Un_GL000195v1:25890-25912 TCATGCCCACAGATGAAAGGTGG + Intergenic
1187411971 X:19059296-19059318 AAATTCACACAGCTGGAAAGTGG - Intronic
1189564061 X:42221331-42221353 AAACTCACACAGCTGGAAGGTGG + Intergenic
1189825702 X:44914635-44914657 ACAGTCTCACAGCTGGTAAGTGG - Intronic
1190577811 X:51859072-51859094 AAAGTCACACAGCTAGAAGGTGG - Intronic
1192123311 X:68476977-68476999 GCCTTCCCACCGCTGGCAGGGGG + Intergenic
1193265611 X:79464635-79464657 ACATTCCTACAGATGAAAAGTGG + Intergenic
1194471652 X:94304661-94304683 CCATTCCCAGGACTGGAAGGTGG + Intergenic
1195002444 X:100655114-100655136 AGAGTCCAAGAGCTGGAAGGGGG - Intronic
1195221793 X:102751470-102751492 AGATTCCCACAGCAGGAAGGTGG + Exonic
1195919041 X:109964207-109964229 ACATTCCAACCTGTGGAAGGGGG + Intergenic
1197290932 X:124656565-124656587 ACATTCTCACAGCTTGTAGGTGG + Intronic
1197397907 X:125950163-125950185 TAATTCCCACTGCTGGAAGTGGG + Intergenic
1197971613 X:132120581-132120603 CCATCCCCACAGCTGAAAGGAGG - Intronic