ID: 1136413449

View in Genome Browser
Species Human (GRCh38)
Location 16:30090428-30090450
Sequence CCCTGTCCTTGTCTGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 236}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136413440_1136413449 10 Left 1136413440 16:30090395-30090417 CCCTGATGCTGGTCAATGGGCTG 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG 0: 1
1: 0
2: 1
3: 19
4: 236
1136413434_1136413449 29 Left 1136413434 16:30090376-30090398 CCGAATCCTGGCCAGATTTCCCT 0: 1
1: 0
2: 2
3: 18
4: 218
Right 1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG 0: 1
1: 0
2: 1
3: 19
4: 236
1136413441_1136413449 9 Left 1136413441 16:30090396-30090418 CCTGATGCTGGTCAATGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 155
Right 1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG 0: 1
1: 0
2: 1
3: 19
4: 236
1136413433_1136413449 30 Left 1136413433 16:30090375-30090397 CCCGAATCCTGGCCAGATTTCCC 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG 0: 1
1: 0
2: 1
3: 19
4: 236
1136413437_1136413449 18 Left 1136413437 16:30090387-30090409 CCAGATTTCCCTGATGCTGGTCA 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG 0: 1
1: 0
2: 1
3: 19
4: 236
1136413435_1136413449 23 Left 1136413435 16:30090382-30090404 CCTGGCCAGATTTCCCTGATGCT 0: 1
1: 0
2: 2
3: 11
4: 223
Right 1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG 0: 1
1: 0
2: 1
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136413449 Original CRISPR CCCTGTCCTTGTCTGGATGC TGG Intronic
900218801 1:1496072-1496094 CCCTGGCCATGGCTGGAAGCAGG - Exonic
903827910 1:26158604-26158626 ACCTGTCTTGGTCTGGGTGCTGG - Intergenic
905223871 1:36466883-36466905 CACTGTCCCTGTCTGGGTCCGGG + Exonic
905337842 1:37257665-37257687 GCCTGTGCCTGTCTGGAGGCTGG + Intergenic
906196551 1:43933792-43933814 CCCGGGCCTTGTCTGGGGGCCGG - Exonic
906580348 1:46930566-46930588 CCCTGGCCTTGTCTTGATAGAGG - Intronic
906685854 1:47762775-47762797 CCCTGTCTTCATCTGGCTGCTGG + Exonic
907297207 1:53462892-53462914 CCCTCTCTTTGTGTGGAGGCTGG - Intronic
908779290 1:67674727-67674749 CCCTCTGCTTGCCAGGATGCTGG - Intergenic
914352339 1:146851491-146851513 CCCTGTTCTTGTCTTAAAGCAGG + Intergenic
917615372 1:176738152-176738174 CTTTGTCCCTGTCTGGATGAGGG - Intronic
921302608 1:213765135-213765157 CCCTGTTTAAGTCTGGATGCAGG + Intergenic
921902388 1:220463951-220463973 CCCTTCACTTGTCTGGATGCAGG + Intergenic
924200949 1:241657863-241657885 CCCTGTCTTGATCTGGATGGTGG - Intronic
1062849773 10:735388-735410 CTCTGTCCGGGTCTGGGTGCTGG - Intergenic
1063374876 10:5548340-5548362 CCCAGGCCTCGTCTGGATCCGGG + Intergenic
1064602382 10:17007028-17007050 CCTTGACCTTGTTTGTATGCTGG + Intronic
1065815839 10:29481717-29481739 CCCTGTCCTTTTCTGTAGGGTGG + Exonic
1065957090 10:30703511-30703533 CCCTGTCCTTTTCTGTAGGGTGG - Intergenic
1067249484 10:44574979-44575001 CCCTGTCGCTGTCTGGGAGCTGG - Intergenic
1075281826 10:121145306-121145328 ACCTGTCCTTGAATGGATCCTGG - Intergenic
1075422405 10:122311737-122311759 CCCTGTTCTGGTCTGGGTGCTGG - Intronic
1075966662 10:126617701-126617723 CCATGTCCTTGTCTGTGTCCTGG + Intronic
1076335808 10:129705844-129705866 CCCTGGCCTTGTATGAATGAGGG - Intronic
1076515748 10:131043538-131043560 CCGTGTCTTTGTCAGGCTGCAGG + Intergenic
1076587464 10:131559440-131559462 TCCAGTCTTTGTCAGGATGCCGG + Intergenic
1076698938 10:132260315-132260337 CCGTGTCCTTGTCTCCAAGCCGG - Intronic
1077021698 11:419917-419939 CCCTGTCCATGTCAGGGTGAGGG - Intronic
1077140280 11:1021166-1021188 CCCTGCCCCTGCCTGCATGCAGG - Intronic
1077240643 11:1508729-1508751 CCCTGTCCTGCTGTGGACGCTGG + Intergenic
1077389718 11:2294640-2294662 CCCTGTCATTGTCAGCAGGCTGG - Intergenic
1077394879 11:2315877-2315899 CCCGGCCCTGGGCTGGATGCTGG + Intronic
1079353954 11:19714764-19714786 GCCAGGGCTTGTCTGGATGCAGG - Intronic
1083233211 11:61336234-61336256 CCCTGGCCCTGGCTGGATGCAGG + Intronic
1084769679 11:71334509-71334531 CCCTGTCCTTGGCTGGGGGATGG + Intergenic
1085409262 11:76281828-76281850 CCCTGGCCCTCTCTGGATGCTGG + Intergenic
1085605248 11:77891674-77891696 CCCTGACCTGCTCTGGAAGCGGG + Exonic
1085788226 11:79473530-79473552 TCCAGACCTTGTGTGGATGCTGG + Intergenic
1088075652 11:105845410-105845432 CCCTCTCCTTGTCTCCAGGCAGG - Intronic
1089294717 11:117460779-117460801 CTCTGCCCTTCTCTGGATCCCGG + Intronic
1090725365 11:129520939-129520961 CCCTTTGCTGGTGTGGATGCAGG + Intergenic
1090937212 11:131353883-131353905 CCCTTTCCTGGTCTGGGTCCAGG + Intergenic
1091597164 12:1885909-1885931 CCCTGCTCTTGTCTGGATGGTGG - Intronic
1091816679 12:3444140-3444162 CCAAGTCCTTGTCTGGGTTCTGG - Intronic
1092050119 12:5463133-5463155 CCCTTTACTAGTCTGGAGGCAGG - Intronic
1092384552 12:8026234-8026256 CCCTGTCCTTGTCTAAAGGCAGG + Intergenic
1096199095 12:49668521-49668543 GCCGGGCCTTGTCTGGAGGCAGG + Exonic
1096801032 12:54110604-54110626 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1097310903 12:58117898-58117920 GCGTGGCCTCGTCTGGATGCTGG + Intergenic
1103965708 12:124638047-124638069 CCGTGTCCTTGTCTGGACCATGG + Intergenic
1108306867 13:49145782-49145804 TACTGTCCTTGCCTGGATGTCGG - Exonic
1113899022 13:113785757-113785779 CCCTGTCCTCTTCTCGATGAAGG + Intronic
1114914777 14:27249620-27249642 TCCTTTCTTTGTCTGGATGGTGG - Intergenic
1115454878 14:33590766-33590788 CCCTGGCTTTCTCTGGATCCAGG + Intronic
1117889235 14:60399806-60399828 CCCCTTCCTTGTCTGGGGGCTGG + Intronic
1119662592 14:76462523-76462545 CCCTCTCTGTGTCTGGTTGCAGG + Exonic
1121113889 14:91330551-91330573 GCATGTCCTTGTCCGGAGGCGGG - Intronic
1121655607 14:95593442-95593464 CCCTGTGCTGGGCTGGCTGCTGG + Intergenic
1121767939 14:96503129-96503151 CACTGACCTTGTCTGAATGTAGG + Intronic
1122166885 14:99832353-99832375 CCATGTCTTTGTATGGATGGAGG + Intronic
1122837842 14:104438786-104438808 CCCTGTCAATGCCTGGATCCTGG + Intergenic
1122879721 14:104685302-104685324 GCCTGTCTGTGTCTGGCTGCAGG - Intergenic
1123054967 14:105565000-105565022 GCCTGTGCTTGTCTGGCTGTGGG + Intergenic
1123079409 14:105684579-105684601 GCCTGTGCTTGTCTGGCTGTGGG + Intergenic
1123888049 15:24747670-24747692 CATTCCCCTTGTCTGGATGCTGG - Intergenic
1125499443 15:40230045-40230067 CCTTGCCCTGGGCTGGATGCTGG - Intergenic
1128111865 15:65081591-65081613 CCCTGTCCATCTCAGGATGTCGG - Intergenic
1128674994 15:69602131-69602153 CCCTGTCTTGGTCTGGAGGAGGG + Intergenic
1128863182 15:71092091-71092113 CCCTCTCCTTTTCTGGAAGTTGG + Intergenic
1133022831 16:2974376-2974398 TTCTGTCCTTGTCATGATGCTGG - Exonic
1134208115 16:12253946-12253968 CCCTGGCCTTATGTGGATGCTGG + Intronic
1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG + Intronic
1137463950 16:48691234-48691256 GCCTGTCCTTGACTGGAGACAGG + Intergenic
1138584294 16:57960362-57960384 CCCCGTCCTAGTCTGGGTGGGGG + Intronic
1139657527 16:68397930-68397952 CCCTGGCCTTGCCTGTCTGCAGG - Intronic
1139981690 16:70864028-70864050 CCCTGTTCTTGTCTTAAAGCAGG - Intronic
1140682862 16:77402343-77402365 TCCTGTCCTCTTCTGGAAGCAGG + Intronic
1142030282 16:87835155-87835177 CCCTGTCCAAGTATGGATTCAGG - Intronic
1142526464 17:545288-545310 CCCTCTCCTTGTCTAGCAGCAGG + Intronic
1143755687 17:9065639-9065661 CCCAGGCCTGGTCTGGAGGCTGG - Intronic
1144807684 17:17978559-17978581 CCTTGTTGTTGACTGGATGCCGG - Intronic
1145890551 17:28412041-28412063 CCCTGTACTTCTCTGAATTCTGG - Intergenic
1146313290 17:31787752-31787774 CCCTTCCCCTGTGTGGATGCAGG + Intergenic
1146501743 17:33370558-33370580 CCCTGGCCGTCTCTGGAAGCAGG + Intronic
1146637888 17:34519537-34519559 CCCTGTCCTGGCCTGGATGGGGG - Intergenic
1147382786 17:40065552-40065574 CCCTGTCCTTGTCTCAGAGCTGG + Intronic
1147441971 17:40452974-40452996 CCTCGTCCTTGTCTGTATTCAGG - Exonic
1147991034 17:44333622-44333644 CCCTGCCCTTCTCTGGGTTCTGG + Intergenic
1148045197 17:44739432-44739454 CCCTGGGCTTGTCTGGAGGATGG - Intronic
1148755382 17:49970306-49970328 GCCTGACCTTGACTGGAAGCTGG + Intronic
1149333747 17:55612828-55612850 CCCTTCCCTTGTCTGCAGGCTGG - Intergenic
1149637008 17:58179093-58179115 CCCTCTCCTGTTCTGAATGCAGG + Intergenic
1150302198 17:64055962-64055984 AGCTGCCCTTGTCTGGATGTGGG - Intronic
1150585280 17:66512005-66512027 CTCTCTCATTGTCTGGCTGCCGG - Intronic
1150772898 17:68056572-68056594 CCATGTCTTTATCTGGATGGTGG - Intergenic
1150850909 17:68702902-68702924 CCATTTCATTGTCTTGATGCTGG + Intergenic
1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG + Intronic
1151503903 17:74513424-74513446 CTCTCTTCTTGTCTGGATGGTGG - Intergenic
1152008969 17:77699084-77699106 CCCTGGCCTTGGCAGGATCCAGG + Intergenic
1152800231 17:82327402-82327424 CCCCGACCTGCTCTGGATGCTGG + Intronic
1153645296 18:7190515-7190537 CCATGTCCTTCTCTGGTTGCTGG + Intergenic
1155226840 18:23736836-23736858 ACCTGTCATTGTGTGGACGCTGG + Intronic
1155354474 18:24937959-24937981 GCCTGTCCTTGTCTGGAGAGTGG + Intergenic
1156022635 18:32617353-32617375 CCCTGTCCTTGGCTTGCTGATGG + Intergenic
1157144195 18:45144511-45144533 CCCTGTGCTTCTCTGAATGTTGG + Intergenic
1159487737 18:69086720-69086742 TCCTGTCCTTGTTTTGATACTGG - Intergenic
1160972025 19:1773716-1773738 CACAGTCCCAGTCTGGATGCAGG + Intronic
1161082170 19:2316727-2316749 CCATGTCCTTGTCTGGGTCCAGG + Intronic
1161337224 19:3721209-3721231 CCCCTTTCTTTTCTGGATGCTGG + Intronic
1162520938 19:11178952-11178974 CCCTGTCCCTGACTAGCTGCTGG - Intronic
1163094121 19:15043254-15043276 CCCTGCCCCTGTGTGGAGGCAGG - Intergenic
1164447162 19:28327806-28327828 CCTTGTCCTTGTCTGGATCTAGG + Intergenic
1165981673 19:39729426-39729448 CCCTGTCCCTGTCTTCATGCAGG - Intergenic
1167491844 19:49797301-49797323 CTCTGTACTTATCTGGATGCTGG - Intronic
925033730 2:671312-671334 CCCTGACCTTGTCCAGAGGCTGG - Intronic
925143197 2:1564043-1564065 GCCTGTCCATGTCTGCACGCGGG + Intergenic
925893191 2:8452503-8452525 CCCTGTGCTTGTCTGCAGGTGGG + Intergenic
925905895 2:8539600-8539622 CTCTGTCCTTGCCTGGGTCCAGG - Intergenic
926128089 2:10284217-10284239 CCCTGTTCATCTCTGGATCCCGG - Intergenic
927385188 2:22524432-22524454 GCCTGGCCTTGTCTGGATCTAGG + Intergenic
927729947 2:25462366-25462388 CCCTGACCTTGTCCTGAGGCTGG + Intronic
929429270 2:41872868-41872890 CCCTGTCCTTGACTGTCAGCTGG - Intergenic
931769238 2:65483312-65483334 CCATGTCCTTCTCTGGCAGCAGG - Intergenic
932232458 2:70094124-70094146 TCCTGTCCTCTTCTGGATGGAGG + Intergenic
932486035 2:72084981-72085003 CCCTGTTCCTGTCTGGCTCCAGG + Intergenic
932535650 2:72592197-72592219 CACTTTCCTTTCCTGGATGCTGG - Intronic
934580162 2:95431362-95431384 ACCTGGCCCTGTCTGGATTCTGG + Intergenic
934599285 2:95645354-95645376 ACCTGGCCCTGTCTGGATTCTGG - Intergenic
934779439 2:96960433-96960455 CCCTTGCCTTGCCAGGATGCTGG - Exonic
934852112 2:97707947-97707969 CCCTGTGCTGGGCTGGATGTGGG + Intergenic
934961921 2:98683203-98683225 CGCTGTCCTGGACTGGATCCTGG + Intronic
937114742 2:119397217-119397239 CCCTGGGCATCTCTGGATGCTGG - Intergenic
937576503 2:123428926-123428948 CTCTGTCAGTTTCTGGATGCTGG - Intergenic
937969046 2:127535816-127535838 CCCTTACCTTGTCAGGATGGGGG - Exonic
938187186 2:129242411-129242433 TCCAGTCCTGCTCTGGATGCCGG + Intergenic
938236524 2:129710543-129710565 GCCTTTCCTTGTGTAGATGCAGG - Intergenic
939590156 2:144054639-144054661 CCCTGACCTGGCCTGGATGATGG + Intronic
940152019 2:150613130-150613152 CCCTGTACTAGACTGGATGTTGG - Intergenic
940575340 2:155496412-155496434 CTCTGTCCTTTTCTGTATTCTGG + Intergenic
942110985 2:172682546-172682568 TCCTGTCCTCCTCTGCATGCAGG + Intergenic
942443993 2:176066439-176066461 CGCTGTCCTTTTCTGGATAATGG - Intergenic
944595140 2:201254472-201254494 CCCTTTCCTTGACTGGCAGCTGG - Intronic
947246411 2:228053579-228053601 CCCTACCTTTCTCTGGATGCTGG + Intronic
948423402 2:237874123-237874145 CCCTGTCCGGGTCTGGCTGCAGG - Intronic
1168837629 20:888283-888305 CCCTGTCCTAGTCTGGTGCCAGG + Intronic
1170961618 20:21030283-21030305 CCCTTCACTTGTCAGGATGCAGG - Intergenic
1171795625 20:29564066-29564088 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1171852804 20:30320395-30320417 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1171878656 20:30600326-30600348 ACTTGGCCTTGTCTGGATGGTGG - Intergenic
1172031601 20:31985860-31985882 GTCTGTCTGTGTCTGGATGCTGG - Intronic
1172031611 20:31985947-31985969 GTCTGTCTGTGTCTGGATGCTGG - Intronic
1172715840 20:36962927-36962949 TCCTGGCCTTGTGTGTATGCGGG + Intergenic
1176117232 20:63438374-63438396 CCCTTGCCTTGTGTGGGTGCTGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176371863 21:6067144-6067166 CCCTGCACTTGTTTGGGTGCTGG + Intergenic
1176841809 21:13848489-13848511 CTTTGTCCTTCTCTGGATGAGGG + Intergenic
1178267702 21:31159222-31159244 TCCTCTCCTTGTCTGTATGTTGG - Intronic
1179751656 21:43471395-43471417 CCCTGCACTTGTTTGGGTGCTGG - Intergenic
1180068064 21:45422654-45422676 CCCTTTCCTTGGCAGGGTGCTGG - Intronic
1180945318 22:19689254-19689276 CCCTCAGCTTGGCTGGATGCAGG + Intergenic
1181683631 22:24513874-24513896 CCCTGTCCTTGTTTGGAGCATGG + Intronic
1182041470 22:27241911-27241933 CCCTGGCCTTGGCTCGGTGCCGG - Intergenic
1182168746 22:28204924-28204946 CCCTGTCCTTGTCTTAAAGCTGG + Intronic
1182327589 22:29525402-29525424 CCATGTCCTTATCTGGGTGGTGG - Intronic
1183032913 22:35118788-35118810 CCCTGTCCATGGATGGATTCAGG - Intergenic
1185158423 22:49208090-49208112 ACCTGTCCCTGTGTGGCTGCTGG - Intergenic
950151320 3:10689712-10689734 CCCTGGCCTCGTTTGGTTGCCGG + Intronic
952157092 3:30655217-30655239 ACTTGTGCTTGTCTGAATGCAGG + Intronic
952838105 3:37621417-37621439 CCCTGGCCCTGCCTGGATGCCGG + Intronic
952850990 3:37729122-37729144 ACCACTCCTTGTGTGGATGCTGG - Intronic
953474586 3:43194706-43194728 CCCTGTCCTTTGCAGGAAGCCGG + Intergenic
954554725 3:51508863-51508885 CCTGGTCCTTTTTTGGATGCAGG + Intergenic
954710081 3:52501314-52501336 CCCTGTCCTTGCCTGTGTCCAGG + Intronic
959884641 3:111485353-111485375 CTCTGTCCTTGTTAGAATGCAGG - Intronic
959945180 3:112118475-112118497 GCCTGTTCATGTCTGGAGGCAGG + Intronic
960122151 3:113957841-113957863 CCCTGTGCTTACCTGGATGTAGG - Intronic
961602633 3:128073129-128073151 CCAAGTCCCTGTCTGGCTGCTGG + Intronic
965127918 3:164653572-164653594 CCCTTCCCATTTCTGGATGCAGG - Intergenic
967420295 3:189264959-189264981 CCCTGTGCTTATCTTCATGCTGG - Intronic
967894626 3:194385969-194385991 CCAGGTCCTTGTCTGGATGCCGG + Intergenic
968568581 4:1327772-1327794 CCCTGTCGTGGTCTGGGTCCTGG + Intronic
968925245 4:3543541-3543563 TCCTGTGCTTGTGTGGATCCAGG + Intergenic
969366881 4:6700810-6700832 CCCTCTCCTTCTCTGGCCGCTGG + Intergenic
969530640 4:7728506-7728528 CCTTGGGCTTCTCTGGATGCCGG - Intronic
971097965 4:23429499-23429521 CCATGTTCTTTTCTGGAGGCTGG + Intergenic
973176409 4:47211777-47211799 CCCTTTCCTTTTCTGGCTTCCGG + Intronic
976042341 4:80902199-80902221 CCCTTTCCTTCTCTGGGTCCAGG + Intronic
982092013 4:151888389-151888411 CCCTCACCTTGTCTGGCAGCAGG - Intergenic
984367044 4:178812878-178812900 CGCTCCCCTTGTCTGAATGCTGG - Intergenic
986265078 5:6184094-6184116 CCTGTTCCTTGTCTGGCTGCAGG - Intergenic
986528218 5:8703863-8703885 CCCTTTCCCTGTCTGGTTCCGGG - Intergenic
998177792 5:139912411-139912433 CCCTGGCCTGGTCTGGGTACTGG + Intronic
998223946 5:140311845-140311867 CCCTGTGCTCGTCTGGCTCCTGG - Intergenic
1000966210 5:167660094-167660116 TCAGGTCCTTTTCTGGATGCTGG + Intronic
1003406561 6:5831367-5831389 CCCAGTCCTGGGCTGGCTGCAGG + Intergenic
1004967012 6:20863577-20863599 CACTGTAAATGTCTGGATGCTGG + Intronic
1005406894 6:25498983-25499005 CCCTGACCTTGTTAGGAGGCTGG - Intronic
1006286061 6:33095361-33095383 GTCTGTGTTTGTCTGGATGCAGG - Intergenic
1006291610 6:33142123-33142145 GTCTGTGTTTGTCTGGATGCAGG - Intergenic
1006854441 6:37123419-37123441 CCCTGTCCTCCTCTGGCTTCTGG - Intergenic
1012545129 6:100410859-100410881 CACTGTCTTTGTCTGGTTCCAGG - Intronic
1013727793 6:113121178-113121200 CCCTGTCTGTGGCAGGATGCTGG + Intergenic
1016811319 6:148263824-148263846 TCCTGCCCCTGTCTGGATGGTGG + Intergenic
1018872276 6:167792288-167792310 CCCTGTGCTTGACAGGCTGCGGG + Intronic
1018941359 6:168310477-168310499 CCCTGGGCTTTTCTGGATGGGGG - Intronic
1019198786 6:170297145-170297167 CCCTGGGCCTGTCTGGCTGCAGG + Intronic
1020764133 7:12299875-12299897 GCCTCTCCTTGTCTGGATCAAGG - Intergenic
1022520869 7:31006168-31006190 CCCTGCCCTTTTCTGGGTGAAGG - Intergenic
1024029666 7:45448356-45448378 CCCTTTCCTTGTCTGGATCTGGG + Intergenic
1026989064 7:74573001-74573023 CCCTGCCCTTTTCTGGCTGGTGG + Intronic
1029645023 7:101849088-101849110 CCCTGTCCTTCTCTGAAGGGTGG + Intronic
1030628828 7:111873185-111873207 CCCTGTGCTTATCTGGACTCTGG - Intronic
1032054918 7:128676369-128676391 CCCAGTCCTTGTCTCGAGCCTGG + Intronic
1033330295 7:140411858-140411880 TCCTGTCCTTCTCCAGATGCAGG + Exonic
1034053224 7:148005542-148005564 CCCCTTCCTTGACTGGATGCAGG - Intronic
1034532302 7:151703597-151703619 TCCTTTCCTTCTCTGGGTGCTGG - Intronic
1035363079 7:158326206-158326228 GCCTTGCCTTGTTTGGATGCAGG - Intronic
1035846814 8:2874434-2874456 CACTCCCCTTGGCTGGATGCTGG + Intergenic
1037858401 8:22387971-22387993 GCCTGTTCATGTCTGGAGGCAGG + Intronic
1038136510 8:24791788-24791810 CTCTGTCTTTGTCTGGAGGTTGG + Intergenic
1039687675 8:39823198-39823220 ACTTGTCCTACTCTGGATGCAGG + Intronic
1041595810 8:59650196-59650218 GCTTTTCCTTGACTGGATGCTGG + Intergenic
1041804848 8:61838821-61838843 GCCTTTCCTTGTCTGGATCTAGG - Intergenic
1045023704 8:98065489-98065511 CCCAGTGCTTGGCTAGATGCTGG + Intronic
1047249442 8:123170645-123170667 CCCTAGCTTTGTCTGGGTGCTGG - Intergenic
1047884948 8:129239454-129239476 GCCTGTCCTGGGCTGAATGCAGG - Intergenic
1049093611 8:140534991-140535013 CCCAGTCCTTGGCTGGAGCCTGG + Intronic
1049549316 8:143249514-143249536 GCCTTTCCTTGTCTCGATGAAGG - Intronic
1049776210 8:144406529-144406551 CCCTGTCTTTGTCTATATTCTGG + Intronic
1050302033 9:4269021-4269043 CTCTTTCCCTGACTGGATGCTGG + Intronic
1051972846 9:22911906-22911928 GCCTTTCCTTGTCTGGATCTAGG - Intergenic
1052432601 9:28386339-28386361 CCCTGTCTTTGTGTGGGGGCGGG + Intronic
1053288092 9:36862765-36862787 CCCTGTGCCAGTCTGTATGCTGG + Intronic
1053790600 9:41683675-41683697 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1054154560 9:61631126-61631148 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1054178945 9:61895374-61895396 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1054474337 9:65562202-65562224 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1054658592 9:67685457-67685479 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1055420857 9:76140054-76140076 GCCTGTCCTTGACTGAATGGTGG + Intronic
1056485423 9:87052075-87052097 CCCTGCCCTTGTCAGAATGCAGG - Intergenic
1057026747 9:91739904-91739926 ACATGTCCCTGTCTGGAGGCGGG + Intronic
1057127946 9:92633995-92634017 CCCTGCCCCTGGCTGTATGCGGG - Intronic
1058113365 9:101056163-101056185 CCCAGTGCTTGTGTGGATGGAGG + Intronic
1058755640 9:108080553-108080575 CCTGGTCCTTGTCTTGATGTTGG + Intergenic
1062101490 9:134730863-134730885 CGCTGTATTTGTCTGGATCCTGG - Intronic
1062156803 9:135053755-135053777 CCCTCTCTCTGTCTGAATGCTGG + Intergenic
1062651855 9:137581882-137581904 CTCTGTCCTTGTCTTGCGGCAGG - Intergenic
1186268545 X:7859152-7859174 CCCTGTCTTTATTGGGATGCAGG - Intergenic
1187373893 X:18733563-18733585 CCCTGTGTTGCTCTGGATGCAGG + Intronic
1195310078 X:103624270-103624292 CTCTGAGCTTGTCTGGATTCTGG + Intronic
1195311674 X:103638268-103638290 CTCTGAGCTTGTCTGGATTCTGG + Intergenic
1195741499 X:108069289-108069311 CTCTTACCTTGTCTGGATCCTGG - Intronic
1197753473 X:129980627-129980649 CCCCGCCCTTGCCTGGGTGCTGG - Intergenic
1199672429 X:150158593-150158615 CCCCATCCTTGTATGGATCCAGG + Intergenic
1199981515 X:152923186-152923208 CCCTCTCCCCTTCTGGATGCAGG - Intronic
1200832342 Y:7699346-7699368 CCCTTTCCTTTTCTGGCTCCAGG - Intergenic
1202114564 Y:21458365-21458387 CCCTTTCCTTTTCTGGCTCCAGG + Intergenic