ID: 1136414533

View in Genome Browser
Species Human (GRCh38)
Location 16:30095544-30095566
Sequence CCCGGAGAGGCTGCTGGCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414533_1136414543 13 Left 1136414533 16:30095544-30095566 CCAGAGCCAGCAGCCTCTCCGGG 0: 1
1: 0
2: 2
3: 31
4: 283
Right 1136414543 16:30095580-30095602 TCGGTTTTGACTCAGTGAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 74
1136414533_1136414539 -6 Left 1136414533 16:30095544-30095566 CCAGAGCCAGCAGCCTCTCCGGG 0: 1
1: 0
2: 2
3: 31
4: 283
Right 1136414539 16:30095561-30095583 TCCGGGGACCAGAGGCGTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 87
1136414533_1136414544 20 Left 1136414533 16:30095544-30095566 CCAGAGCCAGCAGCCTCTCCGGG 0: 1
1: 0
2: 2
3: 31
4: 283
Right 1136414544 16:30095587-30095609 TGACTCAGTGAGGAGGCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 236
1136414533_1136414542 10 Left 1136414533 16:30095544-30095566 CCAGAGCCAGCAGCCTCTCCGGG 0: 1
1: 0
2: 2
3: 31
4: 283
Right 1136414542 16:30095577-30095599 GTCTCGGTTTTGACTCAGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414533 Original CRISPR CCCGGAGAGGCTGCTGGCTC TGG (reversed) Exonic
900165614 1:1243243-1243265 CCAGGAGTGGCTGCTGGGGCTGG + Intronic
900399527 1:2467339-2467361 CCAGCAGAGGCTGCTGGGCCCGG + Intronic
900625393 1:3606207-3606229 CCAGGAGAGGCTGCTGGTCCTGG - Intronic
901049406 1:6418925-6418947 ACCGGAGCGGATGCGGGCTCTGG + Exonic
901326027 1:8365719-8365741 CCCGTAGGAGCTGATGGCTCCGG - Intronic
902769497 1:18637412-18637434 CGCGGAGAGGCGGCAGGCTGAGG + Intronic
902884253 1:19393491-19393513 CACGGGGAAGCTGCTGGCCCCGG + Intronic
903124519 1:21238546-21238568 CACGGAGCAGCTGCTGGCCCAGG + Intronic
903862077 1:26370640-26370662 CCCCGAAGGGCTGCTGGCTGTGG + Intronic
905110025 1:35588342-35588364 GGCTGAGAGGCTGCTGGCTTTGG - Exonic
905694487 1:39964933-39964955 CCATTAGAGGCTGCTGCCTCTGG + Intronic
907663297 1:56413298-56413320 CCCAGAGAGGATGGTGGCTGGGG + Intergenic
907665734 1:56432619-56432641 CCTGGAAAAGCTGCTGGCTTAGG + Intergenic
910582478 1:88843829-88843851 CCAGGAGATGCTGATGCCTCTGG + Intergenic
915303014 1:154962109-154962131 TCCGCAGAGGGGGCTGGCTCCGG - Intronic
916172386 1:162010747-162010769 TCGGGGGAGGGTGCTGGCTCTGG + Intronic
916963229 1:169909972-169909994 CCAGGGGCTGCTGCTGGCTCCGG - Intergenic
917622477 1:176810677-176810699 CCAGGTGAGGCTGCTGCCACTGG - Intronic
917906165 1:179588792-179588814 CCCGAAGCGGGTGCTGGCCCAGG - Intergenic
919923038 1:202177580-202177602 CCCCAAGGGGCTGCTGGCCCAGG - Intergenic
920224221 1:204426366-204426388 CCCTGGCAGGCTCCTGGCTCTGG + Intronic
922157647 1:223052603-223052625 GCAGGCGAGGCCGCTGGCTCTGG + Intergenic
922499123 1:226083748-226083770 CCCGGCGAGGCTGAGGCCTCAGG - Intergenic
923503431 1:234585209-234585231 CCCGCAGAGGTTCCTGGCTGCGG - Intergenic
1064645436 10:17454553-17454575 CTCGGAGCTGCTGCGGGCTCCGG + Intergenic
1065855383 10:29826105-29826127 CCCAGAGAGGCTCCTGGGTTAGG - Intergenic
1066282363 10:33930271-33930293 CGTGGTGAGGGTGCTGGCTCAGG + Intergenic
1067372702 10:45699928-45699950 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067387075 10:45826196-45826218 CCCGCAGCAGCTGCTGGCCCAGG + Exonic
1067419053 10:46131055-46131077 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067504404 10:46837644-46837666 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067590182 10:47502349-47502371 CCCGCAGCAGCTGCTGGCCCAGG + Exonic
1067876187 10:50009883-50009905 CCCGCAGCAGCTGCTGGCCCAGG - Exonic
1068602059 10:58966877-58966899 CTCGGAGAGTCTGATGGCACTGG - Intergenic
1072804838 10:98417777-98417799 CCCAGAGAGGCCTCTGGCGCTGG - Intronic
1073051143 10:100668160-100668182 CCTGGAGATGCTGCCGGCTCAGG - Intergenic
1073062249 10:100739795-100739817 CCCGATGAGGCCGCGGGCTCCGG + Intronic
1076816773 10:132918911-132918933 CCTGGAGAGGCTCCTGTCTCAGG - Intronic
1076838201 10:133031876-133031898 CCCCACGAGGCTCCTGGCTCCGG + Intergenic
1077218252 11:1404090-1404112 AGTGGAGAGGGTGCTGGCTCTGG - Intronic
1077377211 11:2210687-2210709 CCAGCCGAGGCTGCTGGCCCTGG + Intergenic
1077546057 11:3170537-3170559 TCCGGAGAAGCTGCTGGCTGGGG + Intergenic
1078577975 11:12517484-12517506 CCCAGCCAGGCTGCTAGCTCGGG - Intronic
1080927675 11:36774998-36775020 CAGTGAGAGGATGCTGGCTCTGG + Intergenic
1081771326 11:45652022-45652044 CCTGGAGACGCTGGTGGCTGTGG - Exonic
1082184773 11:49165510-49165532 CAGGGAGGGGCTGCTGACTCAGG + Intronic
1083668864 11:64289437-64289459 ACAGGAGAGGTAGCTGGCTCCGG - Intronic
1083749850 11:64754942-64754964 CCCAGAGAGGGGGCCGGCTCAGG - Intronic
1083793294 11:64999782-64999804 CCCACTGGGGCTGCTGGCTCTGG - Intergenic
1084222754 11:67694399-67694421 CCTGGAGTGGCAGCTGGGTCAGG + Intergenic
1084598468 11:70131147-70131169 GCTGCAGAGGCTGCTGCCTCAGG + Intronic
1084732185 11:71080782-71080804 CACGGAGCAGCTGGTGGCTCAGG - Intronic
1084758327 11:71252590-71252612 CCCGGCGCGGGAGCTGGCTCCGG + Intergenic
1084797634 11:71519056-71519078 CCCGAGGAGGCTGCAGGCCCGGG - Intronic
1084888513 11:72225074-72225096 CGCGGAGGAGCTGCTGGCCCGGG + Exonic
1084973087 11:72781820-72781842 CCCGGCTAGGCTGGGGGCTCGGG + Intronic
1085353487 11:75815573-75815595 CGTGGAGAGCTTGCTGGCTCCGG + Intronic
1085666187 11:78417554-78417576 CCCGGAGGGGCGGCAGGCTGGGG - Intronic
1086681567 11:89679849-89679871 CAGGGAGGGGCTGCTGACTCAGG - Intergenic
1088725481 11:112630590-112630612 CCTGGAGAGGCTGTTGTCACAGG - Intergenic
1089690503 11:120184065-120184087 CCGGGAGAGGATGGGGGCTCCGG + Intronic
1089732327 11:120527104-120527126 CCAGGACTGGGTGCTGGCTCTGG - Intronic
1090359807 11:126164401-126164423 CTAGGAGAGGCTGTTGGCCCTGG - Intergenic
1091284454 11:134400263-134400285 CCCGGAGGAGCTTCTGGCTCGGG - Intronic
1091837352 12:3595173-3595195 CCTGGGGAGGCTGCTGGGGCAGG + Intergenic
1092428266 12:8390530-8390552 CGCCGAGAGGCCGCTCGCTCCGG - Intergenic
1096152940 12:49325863-49325885 CCCCCAGAGGCTACAGGCTCTGG + Exonic
1096195631 12:49647299-49647321 GCGGGAGAAGCAGCTGGCTCAGG - Exonic
1098951940 12:76648627-76648649 CCCGCATGGGCAGCTGGCTCTGG - Intergenic
1100346159 12:93733633-93733655 CCTGGGGAGGCTGCCTGCTCAGG + Intronic
1100863182 12:98829173-98829195 ACTGGAGAGGCAGATGGCTCAGG - Exonic
1101955527 12:109209021-109209043 GCCCCAGAGGCTGCTGGGTCTGG + Intronic
1102025795 12:109713873-109713895 CGCGGAGAGGCTGCGCGCGCCGG + Intergenic
1102961604 12:117097056-117097078 CTCGGAGAGGCTGCTGTTCCTGG - Intronic
1103699705 12:122842733-122842755 TCCCGAGAGGCTGCTGGCCCAGG - Intronic
1104978960 12:132564453-132564475 CCTGGTGAGCCTCCTGGCTCTGG + Intronic
1105250766 13:18697373-18697395 CCTCGAGAAGCTGCTGTCTCTGG - Intergenic
1107770844 13:43786619-43786641 CCCAGGGAGGCTGCGGGCCCCGG + Intronic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1108615490 13:52128618-52128640 CCAGGAGAGGCTGCAGACACCGG + Intronic
1112506767 13:99980586-99980608 CCCTGAGCTGCTGCCGGCTCAGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118321023 14:64753508-64753530 GCGGGAGAGGCTGCTGGCTGAGG - Intronic
1118923179 14:70168316-70168338 CGAGCAGAGGCTGGTGGCTCAGG - Exonic
1119198688 14:72736964-72736986 CCCAGGGAGGCGGCTGGCTTGGG - Intronic
1119620100 14:76125482-76125504 CCTGTAGAGGCTGCCGGCTTTGG + Intergenic
1119667679 14:76496836-76496858 CCCTGGGAGCCTGCTGGCTGCGG + Intronic
1122215320 14:100199748-100199770 CCCAGTGATGCTGCTGGCCCCGG + Intergenic
1122769749 14:104092702-104092724 CTCAGAGAGGCCGCGGGCTCGGG - Exonic
1122983504 14:105201992-105202014 CCCGGAGAGGAACCTGGCTCAGG - Intergenic
1124645864 15:31437165-31437187 CCAGTAGTGGCTGCTGGCTGGGG + Intergenic
1124971025 15:34489837-34489859 CCAGGAGAGGGGGCTGCCTCTGG + Intergenic
1127267191 15:57371866-57371888 CCAGGAGAGGCTGCTGGCTGTGG + Intergenic
1127774440 15:62254246-62254268 GCAGGAGAGGCTGCTGGAGCTGG - Intergenic
1128124873 15:65185033-65185055 CCCCGACAGGCTGAGGGCTCAGG + Intronic
1129329787 15:74821118-74821140 CCCGCAGAGCCTGCAGGATCCGG - Exonic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1130281707 15:82524524-82524546 GCTGGAGAGGCTGCTGGAGCTGG + Intergenic
1130866352 15:87936230-87936252 GCTGGGGAGGCTCCTGGCTCAGG + Intronic
1130894127 15:88157533-88157555 CAGGGAAGGGCTGCTGGCTCTGG - Intronic
1131092206 15:89631593-89631615 CGCGGATCTGCTGCTGGCTCTGG + Exonic
1132516094 16:366689-366711 CAGGGAGAGGCTCCTGACTCAGG + Intergenic
1132540917 16:509309-509331 CTCGCGGAGGCCGCTGGCTCGGG + Intronic
1133470511 16:6070580-6070602 CCCGAAGAAGCAGCTGGCTATGG + Intronic
1136074683 16:27808824-27808846 CCCGCAGAGGCTGCTCGCTCTGG - Intronic
1136414533 16:30095544-30095566 CCCGGAGAGGCTGCTGGCTCTGG - Exonic
1136458456 16:30395491-30395513 CCCGGAGCCGCTGGCGGCTCGGG + Exonic
1138553633 16:57760116-57760138 ACTGAAGAGGCTGCTGGCTGTGG + Intronic
1139472369 16:67185042-67185064 CCCGCAGCTGCTGCTGGCTGAGG - Exonic
1141138150 16:81480046-81480068 CCCAGAGACGCTGATGGCTTTGG + Intronic
1141569507 16:84925627-84925649 CCAGGTGAGGCTGCTGCTTCTGG - Intergenic
1142001746 16:87668214-87668236 CCCTGCGCGGCTGCTGGATCTGG + Intronic
1142022917 16:87795224-87795246 CACGGAGAGGCTGAGGGTTCCGG + Intergenic
1142027550 16:87822709-87822731 CCCGGAGAGGTTGCACGCTCTGG - Intergenic
1142058387 16:88014733-88014755 GTCGGGGAGGCTGGTGGCTCAGG + Intronic
1142115265 16:88353023-88353045 CCCGGTGAGACTGCAGGGTCTGG + Intergenic
1142438979 16:90082207-90082229 CTGGGAGAGGCTGCGGCCTCGGG + Intronic
1142549798 17:731990-732012 CCCGGAGCGGCTGCAGCCGCTGG + Intergenic
1142855035 17:2724479-2724501 CCTGGGGAGGCGGCTGGCGCGGG + Intergenic
1143244129 17:5468694-5468716 CCAGGGGCGGCTGCTGCCTCCGG + Exonic
1143749989 17:9021255-9021277 CCCGGAGAGGGGGCTGGGCCGGG - Intergenic
1143860837 17:9889617-9889639 CTCGGACAGGCTGCTGCCCCGGG - Exonic
1145043176 17:19592048-19592070 ACAGGAGAAGCAGCTGGCTCAGG + Intergenic
1145822436 17:27849743-27849765 CCAGGTGACGCTGCTGGCCCAGG - Intronic
1146305170 17:31724955-31724977 ACCTGAGGGGCTGGTGGCTCAGG - Intergenic
1146756048 17:35432832-35432854 TCTGGGGAGTCTGCTGGCTCGGG - Intronic
1147015629 17:37489669-37489691 CTAGGGGAGGCTGCTGCCTCGGG + Intergenic
1147479091 17:40741939-40741961 CCCTGAGGGGCTGATGGCTGAGG + Intergenic
1147622743 17:41878723-41878745 GTGGGAGAGGCTGCTGTCTCAGG + Intronic
1150340587 17:64363458-64363480 CCTGGAGAGGCCCTTGGCTCAGG + Intronic
1151666712 17:75549494-75549516 TCCGCAGGGGCTGCTGGGTCAGG - Intronic
1152174866 17:78781410-78781432 CGCGTTGAGGCTGCTGGCCCAGG - Intronic
1152368069 17:79868948-79868970 TCCTGGGAGGCTGCTGGATCCGG + Intergenic
1152751020 17:82062441-82062463 CCTGGATGGGCTGCTGTCTCCGG - Intronic
1152879413 17:82806791-82806813 GCCGGAGTGGATGCTGGCTCGGG - Intronic
1153304140 18:3617058-3617080 CCTGGAGAGACTGCAAGCTCAGG + Intronic
1153932210 18:9887877-9887899 CGGGGAGAGGCTGGTGGCTGTGG + Exonic
1154438084 18:14361553-14361575 CCTCGAGAAGCTGCTGTCTCTGG + Intergenic
1158530542 18:58256246-58256268 CCAGGTGAGGCTGCTGCCCCTGG + Intronic
1158978551 18:62736205-62736227 CCAGGAGAGGCTGATGGTGCTGG - Intronic
1159025796 18:63181249-63181271 CCCTGTGTGGCTGCTGGCCCTGG + Intronic
1159888938 18:73936530-73936552 ACCTGAGAGGGTCCTGGCTCAGG - Intergenic
1160034178 18:75285973-75285995 CCCGGAGCTGCTGCTGGTACTGG - Exonic
1160975253 19:1789819-1789841 CCTGGAGGGGCGGCGGGCTCGGG - Intronic
1161124086 19:2546300-2546322 CCTGGAGAGGCTGCAGGTGCAGG - Intronic
1161397871 19:4054349-4054371 CCCGGAGAGTCGCCCGGCTCGGG + Exonic
1161447036 19:4324212-4324234 CCAGGAGCTGCAGCTGGCTCAGG + Intronic
1161594383 19:5143795-5143817 GCCAGGGAGGCTGCGGGCTCTGG + Intronic
1162064850 19:8119141-8119163 CCAGGAGAGCCTGGAGGCTCCGG + Intronic
1162142314 19:8592189-8592211 CCCGGAGAGGCTGATATCTCTGG - Intronic
1163626259 19:18391664-18391686 GCTGATGAGGCTGCTGGCTCAGG - Exonic
1163793396 19:19321292-19321314 CCTTGAGAGGCTGGTGGCTTTGG - Intronic
1164558103 19:29268995-29269017 CCCAGAGAGCCTGCTGGATTTGG + Intergenic
1165385964 19:35510848-35510870 GCTGGAGAGACTGCCGGCTCTGG + Intronic
1165419831 19:35717390-35717412 GCCGGAGAGGCCGCGGTCTCGGG - Intergenic
1165477395 19:36039346-36039368 CGGGGAGAGCCTGCTGGCACGGG - Exonic
1165849410 19:38840509-38840531 CCAGGAGAGGGGGCTGCCTCTGG + Exonic
1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG + Exonic
1168689576 19:58368669-58368691 CCAGGAGAGGCTGCAGGCGACGG - Exonic
925041589 2:735329-735351 CCCGAAGGGGCTGGTGGCTCTGG + Intergenic
925285026 2:2710120-2710142 CCCGGCTCTGCTGCTGGCTCTGG + Intergenic
925359715 2:3268778-3268800 CTCGGAGAGGCTTCAAGCTCCGG + Intronic
926378688 2:12262213-12262235 CATGGAGAGGCAGATGGCTCAGG - Intergenic
926766339 2:16325705-16325727 AACAGAGAGGCTGCTGCCTCTGG + Intergenic
928385648 2:30865687-30865709 CCCAGTGAGGTTCCTGGCTCTGG + Intergenic
930695876 2:54411301-54411323 CAGGTAGAGGCTGCTGGCCCAGG + Intergenic
932616250 2:73233448-73233470 CCCGGAGAGTATGCTGGGGCGGG - Intronic
936155144 2:110042346-110042368 CCTGGGGAGTCTGCTGGCTGTGG + Intergenic
936189536 2:110329068-110329090 CCTGGGGAGTCTGCTGGCTGTGG - Intergenic
936530495 2:113273245-113273267 GCCGGAGAGGATGCTGGAGCAGG + Intronic
938296829 2:130183849-130183871 ACCGGAGAGGCCGCAGGCTGCGG - Intronic
940293335 2:152098694-152098716 CTGGGGGAGGCTGCGGGCTCCGG + Intronic
940378793 2:152989162-152989184 CAGGGAGATGCTGCTGGCTGTGG - Intergenic
942920912 2:181372776-181372798 CACAGAGAGGCAGCTGGCTAGGG - Intergenic
946692491 2:222319789-222319811 CGCGGAGCTGCAGCTGGCTCAGG + Intergenic
947952743 2:234161983-234162005 CTTGGAGAGGCTTCAGGCTCTGG - Intergenic
948570114 2:238912562-238912584 CCCGGAGAGGCGGCCGCCGCAGG - Intergenic
948581415 2:238989479-238989501 CCCCGAGAGGCTGCTAGTGCAGG + Intergenic
948890958 2:240906904-240906926 CCCGGGGCCGCTGCTGGCTGTGG + Intergenic
948890978 2:240906982-240907004 CCCGGGGCCGCTGCTGGCTGTGG + Intergenic
1170759763 20:19239364-19239386 CCTGGAGAGGCTGCTGGCAGTGG - Intronic
1170821422 20:19758380-19758402 CCCGGAGAGGCTCCGGGCACGGG + Intergenic
1171123051 20:22582205-22582227 CCGGGAGAGGGCGCCGGCTCTGG + Exonic
1171238698 20:23548076-23548098 CCCCTGGAGGCTGCTGGCTAGGG - Intergenic
1171977501 20:31604890-31604912 AACGGAGAAGCGGCTGGCTCTGG - Intergenic
1173338014 20:42128798-42128820 CCGGGTGAGGCTGCTGGTGCTGG - Exonic
1173488235 20:43457339-43457361 CCCGGAGAGGCTGATGTCGGCGG + Intergenic
1174178943 20:48662881-48662903 TCCGGGAAGGCTGCTGGCTGTGG - Intronic
1174715030 20:52748407-52748429 CCAGGAGAGGCTGATGGCCCTGG - Intergenic
1175319122 20:58073073-58073095 CCCAGAGGGTCAGCTGGCTCTGG - Intergenic
1175776665 20:61658264-61658286 CTCGGAGAGGATGGTGACTCGGG - Intronic
1175986022 20:62764538-62764560 CGAGGAGAGCCTGCTGCCTCGGG + Intergenic
1176035452 20:63034093-63034115 GCCTGGGAGGCTGCAGGCTCTGG + Intergenic
1176113352 20:63420703-63420725 CCCGGGTAGGCTGAGGGCTCTGG + Intronic
1176114950 20:63428156-63428178 CCCAGAGGGGCAGCTGGTTCGGG - Intronic
1179493501 21:41756668-41756690 CCTGGAAAAGCTGCTGGCTTCGG - Exonic
1179814173 21:43893247-43893269 CTAGCAGAGGCTGCTGGCTCAGG - Intronic
1179942527 21:44649262-44649284 CCAGGCGAGGCTGCTGGCCTGGG + Intronic
1179983345 21:44907679-44907701 CCTGTAGAGGCAGCAGGCTCGGG - Intronic
1180052128 21:45336022-45336044 CGTGGAGAGGAGGCTGGCTCGGG + Intergenic
1180077773 21:45471942-45471964 CCCGTGGTGGCCGCTGGCTCCGG - Intronic
1181028523 22:20138951-20138973 CCCTGAGAGGTTGCCGGGTCAGG + Intronic
1181162176 22:20965500-20965522 GCCGGCGAGGCTGCTGGCATCGG + Intronic
1181179508 22:21056923-21056945 TCTGGTGAGGCTGCTGGGTCAGG - Intronic
1181434373 22:22901629-22901651 CCAGGCGAGGCTGGTGGCTCAGG - Intergenic
1182487662 22:30649040-30649062 CCAGGAGAGGTAGCTGGCTGGGG - Intronic
1182693138 22:32177344-32177366 CACGGAGTTCCTGCTGGCTCTGG - Intergenic
1183026177 22:35067256-35067278 CCCGGAGAAGCTGCGGCCTCAGG + Exonic
1183091233 22:35523465-35523487 GTGGGAGAGGCTGCTGCCTCTGG - Intergenic
1183213520 22:36465254-36465276 ACCGGGGATGCCGCTGGCTCTGG - Intergenic
1185065733 22:48630921-48630943 CCCGGCGTGCGTGCTGGCTCTGG + Intronic
949133652 3:536162-536184 CCAGCAGAGGGAGCTGGCTCCGG + Intergenic
949869929 3:8579927-8579949 CCATGAGAGGCTGATGGGTCGGG - Intergenic
950467164 3:13162358-13162380 CTCGGAGGGGCTGCAGGCTCAGG - Intergenic
950467925 3:13166463-13166485 CCAGGAGACTCTGATGGCTCAGG - Intergenic
950487350 3:13281544-13281566 CCTGGAGGGTGTGCTGGCTCTGG - Intergenic
950904604 3:16526276-16526298 CCAGGAGAGGCAGGTGGCTCCGG + Intergenic
952736422 3:36695797-36695819 CCTGGATAGACTGCTGGCCCAGG + Intergenic
952975182 3:38687901-38687923 CCCTGAGATGCAGCTGGATCTGG - Intergenic
954681817 3:52350084-52350106 CCCGGAGAGGCTGGTGGGCCTGG + Exonic
955878771 3:63521969-63521991 CCTGGAGAGGCTGCCTGCTTTGG - Intronic
956468633 3:69542621-69542643 CCCGGAGAGGCGGCGGGCGGGGG - Intergenic
963127030 3:141825842-141825864 TCCAGAAAGGCTGCTGGCTTGGG - Intergenic
965155104 3:165041600-165041622 CACAGATAGGTTGCTGGCTCAGG + Intronic
966421280 3:179736854-179736876 CCCAGAGCGGCTGCTTGCTATGG + Intronic
967883165 3:194315714-194315736 CCGGGAGCGGCTTCTGGCCCAGG - Intergenic
968088857 3:195887093-195887115 CCGAGAGAGGCTGCTGCCTGTGG + Intronic
968756134 4:2417520-2417542 CCCGCCGAGGCTGCTGGCCACGG + Intronic
968797360 4:2716415-2716437 CCAGGAGACGCTGCTGGCCCAGG - Intronic
968946936 4:3669784-3669806 GCCGGCGGGGGTGCTGGCTCCGG + Intergenic
969869716 4:10097071-10097093 CCCTCAGATGCTGCTGGCCCCGG + Intronic
974623012 4:64385128-64385150 CTCATAGAGGCTGGTGGCTCTGG + Intronic
977572618 4:98645437-98645459 CCAGGTGATGCTGATGGCTCTGG - Intronic
981459444 4:144996133-144996155 CCAGGAGAGGCTCCTGGATGTGG + Intronic
984238913 4:177193809-177193831 CCCGGAGATGCTGGAGGCTGAGG - Intergenic
984931585 4:184852496-184852518 CCCTAAGAGGGTGCAGGCTCAGG + Intergenic
985588354 5:752188-752210 CCAGGAGGGCCTGCAGGCTCAGG + Intronic
985603026 5:844643-844665 CCAGGAGGGCCTGCAGGCTCAGG + Intronic
986050901 5:4089248-4089270 CCCTGAGAGACTGGTGACTCTGG + Intergenic
986758225 5:10857250-10857272 CCCGGACACGCTGCAAGCTCCGG + Intergenic
986794045 5:11191853-11191875 CCATGAGTGGCAGCTGGCTCTGG + Intronic
989133551 5:38130831-38130853 CCAGGAGAGGCTGCTAGGTCAGG - Intergenic
993905796 5:93621498-93621520 CCCGGAGAGGCGGAGGCCTCGGG - Intronic
997013292 5:129904247-129904269 TCCGGAGAGGAGGCCGGCTCTGG + Intergenic
997206564 5:132053711-132053733 CCTGGAGGGGCTGCTGGCAGTGG + Intergenic
997475719 5:134141266-134141288 CCCTTAGGGGCTGCTGGCTCAGG + Intronic
998422993 5:142004678-142004700 GCCAGAGAGCCTGCTGTCTCAGG + Intronic
999341687 5:150778762-150778784 CCAGGACGCGCTGCTGGCTCTGG - Exonic
999538185 5:152541719-152541741 CCCGAAGAGGCAGCTGATTCTGG + Intergenic
1002202466 5:177537854-177537876 CCCGGTGAGTCTCCAGGCTCGGG - Exonic
1002298942 5:178246888-178246910 CCTGGTGGGGCTGCAGGCTCGGG + Intronic
1002570567 5:180137294-180137316 CCGGGAGGGCCTGCTGCCTCTGG - Intronic
1002582266 5:180216000-180216022 CCCAGCCAGGCTGTTGGCTCTGG - Intergenic
1003596922 6:7481933-7481955 CCAGGAGAGGGGGCTGCCTCTGG + Intergenic
1007609922 6:43142657-43142679 CCCAGAGAGGATGATGGGTCAGG + Intronic
1008106332 6:47444044-47444066 CCCGGACGGGCGGCTGGCTGGGG + Intergenic
1008410649 6:51174699-51174721 CCTGAAGAGGCTGCAGGCTCTGG + Intergenic
1011416211 6:87122616-87122638 CCTGGAGATGCTGCTGGCGCTGG - Intergenic
1014778999 6:125541862-125541884 CCTGGAGCAGATGCTGGCTCAGG + Intergenic
1018744935 6:166754665-166754687 CCTGGAGAGGCTGCTCCCCCAGG - Intronic
1018765129 6:166926897-166926919 CCAGGAGGGGCAGCTGGCCCGGG - Intronic
1019019073 6:168902578-168902600 CACGGAGAGCCTGGAGGCTCAGG + Intergenic
1019216155 6:170445116-170445138 TCCAGAGGGGCTGCTGTCTCAGG - Intergenic
1019279117 7:191504-191526 GCTGGCGAGGCTGCTGGCCCAGG + Intergenic
1019391236 7:787743-787765 CCAGGTGAGGCTGCTGCCACTGG - Intergenic
1019528196 7:1490422-1490444 CCCTGAAAGGGTGTTGGCTCCGG + Intronic
1019729906 7:2623964-2623986 GCCGGGCAGGCTGCTGGGTCTGG - Intergenic
1020016485 7:4834801-4834823 CCAGGAGCAGCTGCTGGCGCCGG + Exonic
1020070795 7:5225770-5225792 CCTGGGGCAGCTGCTGGCTCCGG + Intronic
1020426285 7:8069532-8069554 CCCGGTGGGGCTCCCGGCTCAGG - Intronic
1021340650 7:19458783-19458805 CCAGGAGAGGCTCCTGGGTGGGG - Intergenic
1023239360 7:38127382-38127404 CCTGGAGAGGCTGATGCATCTGG + Intergenic
1025284981 7:57653746-57653768 GCCGCGGAGGCTGCTGGATCCGG + Intergenic
1026272169 7:68845927-68845949 CCCGCAGAGGCTACTGGCATAGG - Intergenic
1026996410 7:74619678-74619700 CCCTGAGTGGCTGCTGGCACAGG - Intergenic
1029279118 7:99425361-99425383 CCTGGAGAGGCAGCTGTTTCTGG - Exonic
1029689380 7:102170879-102170901 TCTGGAGAGGCTCCTGGTTCGGG - Intronic
1030631083 7:111896588-111896610 CCTTAACAGGCTGCTGGCTCTGG - Intronic
1033253456 7:139778797-139778819 CCTGGAGAGGCTCCCGGCTGGGG - Intronic
1033857549 7:145583105-145583127 CCCGGAGAGGCTGAGGGGTTCGG + Intergenic
1033980794 7:147162956-147162978 CCTGGAGAAGCTGCTGGTCCAGG - Intronic
1034439219 7:151077999-151078021 CCTTGAGAGGATCCTGGCTCGGG - Exonic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1035179181 7:157077005-157077027 AATGGAGAGGATGCTGGCTCTGG - Intergenic
1035302806 7:157908062-157908084 CCTGGTGAGGCTGCAGGTTCTGG + Intronic
1036080386 8:5548915-5548937 CCCGGAGAGGTTGCTACCTCAGG + Intergenic
1036676652 8:10839648-10839670 CCCGGAGTGGCTGGGAGCTCGGG - Intronic
1037911008 8:22743557-22743579 TCCGGAGGGGCTTCAGGCTCAGG - Intronic
1037961649 8:23102581-23102603 CCCGGGGAGGGAGCAGGCTCAGG + Exonic
1037969877 8:23164340-23164362 CCCGGGGAGGGAGCAGGCTCAGG - Intergenic
1040630482 8:49204273-49204295 TCCGGGGAGGCTTCTGGGTCGGG - Intergenic
1041713270 8:60911816-60911838 TCTGCAGGGGCTGCTGGCTCTGG - Intergenic
1043908860 8:85837137-85837159 TGCGGAAAGGCTGCTGTCTCTGG - Intergenic
1044242455 8:89902717-89902739 CCCGGCGAGGCTGCCCGCTCGGG - Exonic
1048329650 8:133463204-133463226 CCGGGTGATGCTGCTGGCCCGGG + Intronic
1048334793 8:133494519-133494541 CCAGGAGAGGCTGCAAGGTCTGG - Intronic
1048439246 8:134447807-134447829 CCTGAAGAGGCACCTGGCTCTGG + Intergenic
1048950763 8:139495201-139495223 CTTGGAGAGGCTGCTGATTCAGG - Intergenic
1049541440 8:143210938-143210960 CCCGGAAAGGCTAGTGGGTCTGG - Intergenic
1049578367 8:143399975-143399997 CCCGGAGAGGCTTCTGGAGCAGG + Intergenic
1049654814 8:143792836-143792858 TCCGGGGAGGCTGCAGGCCCAGG + Exonic
1049672522 8:143876304-143876326 CCGGGCGCGCCTGCTGGCTCAGG - Intronic
1049687147 8:143943558-143943580 CCCGCACAGGCTGCAGGCTGAGG + Intronic
1056601423 9:88050141-88050163 CCGTAAGAGGCTGCGGGCTCTGG + Intergenic
1057307720 9:93921779-93921801 CCCTGAGAGGCTGCCGGGGCTGG - Intergenic
1057481297 9:95447391-95447413 CCAGGTGGGGCTGCTGTCTCGGG + Exonic
1057870098 9:98710306-98710328 CACGGAGTTCCTGCTGGCTCTGG - Intergenic
1061479890 9:130892436-130892458 CCGGGAGTGGCTGCAGGCCCGGG - Intergenic
1061669926 9:132182907-132182929 CCCAGAGAGGCTGCTGAAGCTGG - Intronic
1062087882 9:134657996-134658018 CACGGAGATGCTGCTGGCTATGG + Intronic
1062174633 9:135154351-135154373 CCGGCAGTGGTTGCTGGCTCAGG + Intergenic
1062353417 9:136150092-136150114 CCCGGAGAGCCTGGTGGCAGTGG - Intergenic
1187827302 X:23344799-23344821 TTCTGAGAGGCTGCGGGCTCTGG + Intronic
1188236797 X:27741350-27741372 CCCTGAGGGTCTGGTGGCTCTGG - Intronic
1190440669 X:50471472-50471494 CTCGGGGAGGCTGCAGGCTGCGG - Intergenic
1198404653 X:136300405-136300427 CCCGGAGTGGCCTCGGGCTCTGG - Intergenic
1198871864 X:141184639-141184661 AGAGGAGAGGATGCTGGCTCAGG - Intergenic