ID: 1136414834

View in Genome Browser
Species Human (GRCh38)
Location 16:30096545-30096567
Sequence ATTGAGCGGGGCACGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414834_1136414853 30 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414834_1136414841 -2 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414841 16:30096566-30096588 ATCCCCGCATCAATCCCGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1136414834_1136414847 14 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414834_1136414851 29 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414834_1136414849 28 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414834 Original CRISPR ATTGAGCGGGGCACGGGCGG CGG (reversed) Intronic
900127705 1:1075768-1075790 AGAGAGCGGGGCGCGGGCTGGGG + Intergenic
900140661 1:1138168-1138190 AATGAGCAGGGGGCGGGCGGGGG + Intergenic
904767354 1:32860654-32860676 ATGGAGCTGGGCAAGGGAGGAGG + Intergenic
905442627 1:38005141-38005163 ATCGGGCGGGGCGGGGGCGGGGG - Intronic
909573137 1:77140334-77140356 AGTGAGCGGGGCAGGGGGGTTGG - Intronic
923407931 1:233681090-233681112 ATTGAGCGGGGTACTGGAGCTGG + Intergenic
1076421928 10:130338007-130338029 ATTGAGAAGGGAACGGGCTGGGG + Intergenic
1076833755 10:133009724-133009746 TGTGTGCGGGGCTCGGGCGGTGG - Intergenic
1076885852 10:133262001-133262023 AATGGGCGGGGCGCGGGCGGGGG + Intergenic
1081183874 11:40018461-40018483 ATTTAGCCGGGCATGGTCGGGGG + Intergenic
1081440652 11:43077148-43077170 ATTGGGCTGGGCACGGTGGGTGG - Intergenic
1082828556 11:57598372-57598394 ATGGTGCGGGGTGCGGGCGGTGG + Intronic
1088776407 11:113088501-113088523 GTTGAGTGGGGCAGGGGCAGCGG - Intronic
1101114154 12:101515900-101515922 AATTAGCTGGGCACGGGTGGTGG - Intergenic
1103844802 12:123893756-123893778 AATGGGCGGGGCAGGGGCGGGGG + Intronic
1113346704 13:109485322-109485344 AGAGAACGGGGCAGGGGCGGCGG - Intergenic
1118126039 14:62905493-62905515 ATTGAGGGGGGCAGGGGAGAAGG + Intronic
1123036554 14:105474209-105474231 TTGGGGCGGGGCGCGGGCGGGGG + Intronic
1124346214 15:28923222-28923244 AGTGGGCAGGGCAGGGGCGGTGG - Intronic
1124453737 15:29822130-29822152 AGCGAGCGGGGCACGGGCGGGGG + Exonic
1128649694 15:69401500-69401522 ATTAAGCGGGGCTGGGGAGGTGG - Intronic
1130543694 15:84839957-84839979 ATTGAGCGGGGCTCAAGCGCCGG + Exonic
1135074024 16:19377783-19377805 ATTGAGCAGGGCATGGGCGCAGG + Intergenic
1136143694 16:28302948-28302970 ATAGAGCAGGGCATGGGGGGGGG + Intronic
1136414834 16:30096545-30096567 ATTGAGCGGGGCACGGGCGGCGG - Intronic
1142265687 16:89063087-89063109 AGAGAGCGGGGCGCCGGCGGTGG - Intergenic
1142348859 16:89570813-89570835 GGTGAGCGGGGCACGGGAAGAGG + Intergenic
1142348865 16:89570834-89570856 GGTGAGCGGGGCACGGGAGCAGG + Intergenic
1142348884 16:89570895-89570917 GGTGAGCGGGGCACGGGAGGAGG + Intergenic
1142348912 16:89570976-89570998 GGTGAGCGGGGCACGGGAGGAGG + Intergenic
1142348919 16:89570997-89571019 GGTGAGCGGGGCACGGGAGGAGG + Intergenic
1142348933 16:89571038-89571060 GGTGAGCGGGGCACGGGAGGAGG + Intergenic
1142348940 16:89571059-89571081 GGTGAGCGGGGCACGGGAGGAGG + Intergenic
1142348974 16:89571159-89571181 GGTGAGCGGGGCACGGGAGGAGG + Intergenic
1142348980 16:89571180-89571202 GGTGAGCGGGGCACGGGAGCAGG + Intergenic
1142348993 16:89571221-89571243 GGTGAGCGGGGCACGGGAGGAGG + Intergenic
1142349000 16:89571242-89571264 GGTGAGCGGGGCACGGGAGGAGG + Intergenic
1143012446 17:3873348-3873370 AGTGAGGCGGGCACGGGCGACGG - Intronic
1146937191 17:36819195-36819217 ATAGAGCGAGGGACGGGAGGTGG + Intergenic
1147158870 17:38559341-38559363 AATGAGGGGGTCACGGGCGAGGG + Intronic
1148090276 17:45019139-45019161 ATTCTGCGGGGCGCGGGGGGCGG + Intergenic
1149272947 17:55001917-55001939 ATTGAGCCAGGCACGAGCGGTGG - Intronic
1151370470 17:73643959-73643981 AGTGGGCGGGGGAGGGGCGGCGG - Intronic
1152864876 17:82716646-82716668 ATTGGGCGGGGGGCGGGTGGGGG - Intergenic
1153565685 18:6414988-6415010 ACTGAGCGAGGCAGGTGCGGCGG - Intronic
1155007518 18:21741567-21741589 ACTCATCGGGGCCCGGGCGGTGG - Exonic
1160728702 19:630564-630586 AGTGAGAGGGGCAGGGGAGGCGG - Intronic
1160891989 19:1383942-1383964 GGTGAGCGCGGCACCGGCGGCGG + Exonic
1161094445 19:2381574-2381596 GTGGAGCGAGGCAGGGGCGGTGG - Intergenic
1161217493 19:3101626-3101648 AGTGAGCTGGGCAGGGGCGGGGG + Intronic
1162122252 19:8478395-8478417 ATGGAGCGTGGCATGGGTGGAGG + Intronic
1163824061 19:19513181-19513203 ATTTAGCTGGGCACGGGGGCGGG - Intronic
1167495801 19:49818195-49818217 TTTGTGCGGGGCACGCGCTGAGG - Intergenic
1168239297 19:55081325-55081347 GTAGAGCGGGGCGCGGGCCGCGG + Exonic
1168280192 19:55301663-55301685 GTTGAGGGGGGGACCGGCGGAGG + Intronic
926095595 2:10079571-10079593 CTGGAGCGGGGCGCCGGCGGTGG - Intronic
926422924 2:12716821-12716843 AATGAGGGGGGCCCGGGCGGGGG + Intergenic
937186206 2:120045806-120045828 ATTGAGGGGGGGACGGGGGAGGG - Intronic
937203739 2:120223056-120223078 CTTGGGCGGGGCCCGGGAGGCGG - Exonic
945054489 2:205856364-205856386 TTTGAGTGGGGCAGGCGCGGTGG - Intergenic
946029688 2:216694391-216694413 GTTACGCGGCGCACGGGCGGGGG - Intronic
947729690 2:232421015-232421037 AGGGAGCGCGGGACGGGCGGAGG - Intergenic
948477748 2:238231409-238231431 AGAGAGCGGGGCGCGGGCTGCGG - Exonic
1172951194 20:38724366-38724388 ATTGGGCTGCGCACGGGTGGGGG + Intergenic
1173187884 20:40855129-40855151 AGTGAGCGGGGGTGGGGCGGTGG - Intergenic
1173539209 20:43838675-43838697 ATGGAGCGGGGCTTGGGAGGAGG + Intergenic
1175358562 20:58389334-58389356 ACCGGTCGGGGCACGGGCGGGGG - Exonic
1178395995 21:32244239-32244261 ATTGCGCGGGGCCAGGGCTGGGG + Intergenic
1179668241 21:42927228-42927250 ATTGCGCTGGGCATGGGTGGAGG + Intergenic
1183665698 22:39244577-39244599 CTGGCGCGGGGCCCGGGCGGCGG + Exonic
1183731963 22:39623105-39623127 ATGGGACGGGACACGGGCGGAGG + Intronic
950043627 3:9935496-9935518 ATTGTAAGGGGCAAGGGCGGAGG + Intronic
950199512 3:11033342-11033364 ATTGAGAGTGGCAGGGGTGGAGG + Intronic
954080034 3:48208157-48208179 GTTGGGCTGGGCACGGGTGGAGG - Intergenic
959539493 3:107523529-107523551 CCTGAGAGGGGCACGGGCGCCGG + Intronic
961473676 3:127134204-127134226 ATTCAGTGGGGGACGGGAGGGGG - Intergenic
961550477 3:127668144-127668166 GTTGAGCGGGGCGGGGGCTGGGG - Intronic
963439798 3:145324148-145324170 ATTTAGCGGGGCAAGGGAGGAGG + Intergenic
964801712 3:160565303-160565325 ATCCCGCGGGGCCCGGGCGGGGG - Exonic
966296694 3:178432286-178432308 ATGGGGTGGGGCACGGGGGGTGG + Intronic
967037006 3:185655491-185655513 ATGGAGCGAGGCAGGGGCTGGGG + Intronic
971756986 4:30719118-30719140 GTTGCGGGGGGCAGGGGCGGCGG - Intergenic
973937109 4:55857453-55857475 AAAGGGCCGGGCACGGGCGGTGG - Intronic
982572451 4:157067349-157067371 TTTGAGCAGGGCACGTGCAGTGG + Intergenic
985732222 5:1555758-1555780 GTGGAGCGGGGCGCCGGCGGTGG + Intergenic
988538798 5:32090868-32090890 TTGGAGCGGGACACGGGCGAGGG - Exonic
997653955 5:135541919-135541941 ATTTAGCAGGGCAGGGGCCGAGG - Intergenic
998101539 5:139439156-139439178 CCTGGGCGGGGCACGGGCGGGGG + Intronic
998415906 5:141945874-141945896 AATGAGCAGGGCAAGGGCAGTGG + Intronic
1001485375 5:172115952-172115974 ATTGGGCGGGGCATGGGGGTTGG + Intronic
1002185911 5:177454748-177454770 ACTGCGCAGGGCGCGGGCGGGGG + Intronic
1002966344 6:1970412-1970434 CTGGAGCGGGGCGGGGGCGGGGG - Intronic
1003141726 6:3477484-3477506 ATGGAACGGGGCTCGGGGGGCGG + Intergenic
1003311335 6:4972096-4972118 CTTGAGCAGGGCACAGGCTGAGG + Intergenic
1003638396 6:7855675-7855697 ATTTAGCTGGGCATGGGCTGAGG - Intronic
1004069810 6:12288145-12288167 ATTGGGGAGGGCATGGGCGGTGG + Intergenic
1006634412 6:35452132-35452154 CTGGAGCGGGGCGGGGGCGGGGG - Intergenic
1006677860 6:35776940-35776962 ATCGGAAGGGGCACGGGCGGGGG - Intronic
1007161089 6:39792396-39792418 AGCGAGCGGAGCGCGGGCGGCGG + Intronic
1011050988 6:83149498-83149520 ATAGAGCAGGGCACAGGCAGTGG + Intronic
1014137527 6:117907157-117907179 GCAGAGCGGGGCGCGGGCGGGGG - Intergenic
1014137568 6:117907282-117907304 ACCGAGCGGGGCACAGGCTGAGG + Intergenic
1014947327 6:127514780-127514802 ATGGCGCGCGGCAGGGGCGGTGG - Intronic
1019090972 6:169533297-169533319 ATTGGGGGGGGCGGGGGCGGTGG + Intronic
1019179037 6:170175814-170175836 TTTCAGCAGGGCAGGGGCGGGGG - Intergenic
1023851331 7:44152044-44152066 ATTGAGAGGGGAACGGGCTGAGG - Intronic
1024930540 7:54663599-54663621 ACTGAGAGGGGCATGGGCGCTGG + Intergenic
1025742340 7:64207699-64207721 ATAGAGCGGGCCAGGCGCGGTGG + Intronic
1030330825 7:108268602-108268624 AATGAGCGGGGCGGGGGTGGGGG + Intronic
1032078892 7:128848995-128849017 GGTGAGCAGGGCACGGGCAGCGG - Intronic
1037891849 8:22627804-22627826 ATGGAGCGGGGCATGCTCGGTGG - Intronic
1038613799 8:29075327-29075349 ATGATGCGGGGCACGGGCTGAGG + Exonic
1040677217 8:49765215-49765237 AGCTAGCGGGGCAGGGGCGGCGG - Intergenic
1049564183 8:143329436-143329458 ATTGAGCGTGGCAGCGGAGGAGG - Exonic
1049678829 8:143906242-143906264 ATTCACCGCGGCATGGGCGGGGG - Intergenic
1049694795 8:143977878-143977900 CCTGAGCCGGGCAGGGGCGGGGG - Intronic
1057239774 9:93398658-93398680 AGGGAGCCGGGCACGGGCAGGGG + Intergenic
1058504821 9:105656464-105656486 TTTCCGCGGGGCAGGGGCGGTGG + Intergenic
1061320195 9:129823675-129823697 ATGGAGCGGGGCCCGGGGGCTGG - Intronic
1061479201 9:130888243-130888265 ACTGAGCTGGGAAAGGGCGGTGG - Intergenic
1062022468 9:134326099-134326121 AGGGAGCGGGGCGGGGGCGGGGG - Intronic
1062729281 9:138100161-138100183 ATTGAGCTGGGGATGGGAGGTGG + Intronic
1187547115 X:20266072-20266094 GGCGCGCGGGGCACGGGCGGCGG - Intronic
1190264013 X:48816746-48816768 ATGGGGAGGGGCACGGGAGGGGG + Intronic
1190526333 X:51332765-51332787 GCTGGGCGGGGCACGGGCGGAGG - Intronic
1192125602 X:68498569-68498591 AGTCAGAGGGGCAGGGGCGGCGG + Exonic
1195681621 X:107551305-107551327 ATTGAAGGGGGCATGGGAGGGGG + Intronic
1198107854 X:133477924-133477946 ATTGAGCTGGGCCTGGGTGGGGG + Intergenic