ID: 1136414834

View in Genome Browser
Species Human (GRCh38)
Location 16:30096545-30096567
Sequence ATTGAGCGGGGCACGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414834_1136414849 28 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414834_1136414853 30 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414834_1136414841 -2 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414841 16:30096566-30096588 ATCCCCGCATCAATCCCGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1136414834_1136414851 29 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414834_1136414847 14 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414834 Original CRISPR ATTGAGCGGGGCACGGGCGG CGG (reversed) Intronic