ID: 1136414835

View in Genome Browser
Species Human (GRCh38)
Location 16:30096548-30096570
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414835_1136414841 -5 Left 1136414835 16:30096548-30096570 CCGCCCGTGCCCCGCTCAATCCC 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1136414841 16:30096566-30096588 ATCCCCGCATCAATCCCGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1136414835_1136414854 28 Left 1136414835 16:30096548-30096570 CCGCCCGTGCCCCGCTCAATCCC 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1136414835_1136414851 26 Left 1136414835 16:30096548-30096570 CCGCCCGTGCCCCGCTCAATCCC 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414835_1136414849 25 Left 1136414835 16:30096548-30096570 CCGCCCGTGCCCCGCTCAATCCC 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414835_1136414847 11 Left 1136414835 16:30096548-30096570 CCGCCCGTGCCCCGCTCAATCCC 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414835_1136414853 27 Left 1136414835 16:30096548-30096570 CCGCCCGTGCCCCGCTCAATCCC 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414835 Original CRISPR GGGATTGAGCGGGGCACGGG CGG (reversed) Intronic