ID: 1136414836

View in Genome Browser
Species Human (GRCh38)
Location 16:30096551-30096573
Sequence GCGGGGATTGAGCGGGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414836_1136414854 25 Left 1136414836 16:30096551-30096573 CCCGTGCCCCGCTCAATCCCCGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1136414836_1136414853 24 Left 1136414836 16:30096551-30096573 CCCGTGCCCCGCTCAATCCCCGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414836_1136414851 23 Left 1136414836 16:30096551-30096573 CCCGTGCCCCGCTCAATCCCCGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414836_1136414841 -8 Left 1136414836 16:30096551-30096573 CCCGTGCCCCGCTCAATCCCCGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1136414841 16:30096566-30096588 ATCCCCGCATCAATCCCGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1136414836_1136414847 8 Left 1136414836 16:30096551-30096573 CCCGTGCCCCGCTCAATCCCCGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414836_1136414849 22 Left 1136414836 16:30096551-30096573 CCCGTGCCCCGCTCAATCCCCGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414836 Original CRISPR GCGGGGATTGAGCGGGGCAC GGG (reversed) Intronic
902770559 1:18643197-18643219 GGGTGGATTGCGAGGGGCACTGG + Intronic
903233811 1:21937135-21937157 GCGGTGAGTGTGCGGGGCAGAGG - Exonic
905173900 1:36124854-36124876 CCGGGGAGGGAACGGGGCACAGG + Intronic
905308268 1:37033576-37033598 GCGGGGAGTGAGGTGGGCAGAGG + Intronic
906480904 1:46198347-46198369 GCGGGGCCCGAGCGGGGCCCGGG - Intronic
906517502 1:46448306-46448328 GCGGGGCGGGAGCGGGGCGCGGG - Intergenic
917717902 1:177756633-177756655 GGGGGCATTGAGCAGGGAACAGG - Intergenic
917972729 1:180219208-180219230 ACGGGGATTGAGAGGGGAGCGGG + Intergenic
918282704 1:183022806-183022828 GAGGGGCTGGAGCGGGGCCCCGG + Intergenic
920364757 1:205442235-205442257 GCGGGGAAGGAGGGAGGCACAGG + Intronic
1063365320 10:5486998-5487020 GAGGGGAGTGAGCAGGGGACGGG - Intergenic
1069886732 10:71628322-71628344 GCAGGGATGGGGCTGGGCACAGG + Intronic
1073134676 10:101213930-101213952 CCGGGGATTGAGCTGGGGGCCGG + Intergenic
1073564171 10:104521134-104521156 GCGTTCATTGAGGGGGGCACTGG + Intergenic
1076335446 10:129703651-129703673 GCGAGGATGGAGTGGAGCACAGG - Intronic
1077017242 11:402738-402760 GCCGGGGGTGAGCGGGGCCCGGG - Intronic
1078348857 11:10575988-10576010 GGGGGTAAGGAGCGGGGCACGGG - Exonic
1080820436 11:35800716-35800738 GATGGGATAGAGAGGGGCACAGG + Intronic
1084112604 11:67023556-67023578 GCGCGGAGTGCGCGGGGCTCTGG - Intronic
1084438871 11:69159286-69159308 GTGGGCATGGAGTGGGGCACTGG + Intergenic
1084946924 11:72643265-72643287 CCGGGGATTCAGCGGGTCACCGG + Intronic
1085312889 11:75526311-75526333 GCGGGGATTGCGGGGGTCACGGG + Intergenic
1085321283 11:75575566-75575588 GCGGGGATGCAGCAGGACACAGG - Intergenic
1091056607 11:132424989-132425011 TGGGGCATTGAGCAGGGCACTGG + Intronic
1101612119 12:106302296-106302318 GCGGGGGCTGAGCGGGGCTCTGG - Intronic
1102961936 12:117098945-117098967 CCGGGGAGGGAGCGGGGCCCAGG - Intronic
1104058191 12:125246076-125246098 GTGGGGATTGATCTGGGCCCTGG + Intronic
1105349424 13:19602187-19602209 GCGGGGAGTGTGCGGGGCGGAGG + Intergenic
1105349430 13:19602201-19602223 GGGCGGAGGGAGCGGGGCACGGG + Intergenic
1105916561 13:24922626-24922648 GCGAGGAGGGAGCGGGGCGCCGG - Intronic
1106145836 13:27049106-27049128 GCGGGGATTGTCCTGGGCACAGG - Intergenic
1109673266 13:65637977-65637999 GTGGTGATGGAGCGGGGCCCAGG - Intergenic
1119173794 14:72554596-72554618 GCGGGCATTAAGTGGGTCACAGG + Intronic
1121342463 14:93113878-93113900 GCGGGGCTTGCACGGGGCAAAGG + Intronic
1122466735 14:101938837-101938859 CTGGGGATGGAGCTGGGCACTGG - Intergenic
1122506239 14:102233594-102233616 GAGGGGTTTGAGGGAGGCACAGG + Intronic
1122719427 14:103714048-103714070 GCTGGGATGGAGCGGGCCCCTGG - Intronic
1125591635 15:40857833-40857855 GGGAGGAGTGAGCGGGCCACGGG + Exonic
1125768347 15:42149724-42149746 GCTGGGATTGAGTGAGGCTCTGG - Exonic
1130085976 15:80779002-80779024 CCGGGGCGCGAGCGGGGCACGGG + Intergenic
1130994071 15:88894623-88894645 GCAGCGATTGAGAGGGGCCCTGG - Intronic
1132843328 16:1989233-1989255 GAGGGGACTCAGCGGGACACAGG + Intergenic
1132883140 16:2171100-2171122 GGGGGGCTTGATCGGGGCCCAGG - Intronic
1135055949 16:19232163-19232185 GCGGGAATTGACCAGGGCATAGG + Intronic
1136068192 16:27772484-27772506 GCGGGGAGTGAGCAGAGCACAGG + Intronic
1136414836 16:30096551-30096573 GCGGGGATTGAGCGGGGCACGGG - Intronic
1141595536 16:85094869-85094891 CCGGGGAAGGAGCAGGGCACAGG + Intergenic
1142033223 16:87848720-87848742 GTGGGGAATAAGCGGGGCCCTGG - Intronic
1142285965 16:89171684-89171706 GCGGGGAGGGGGCGGGGCAAGGG - Intergenic
1143248552 17:5505311-5505333 CAGGGGATTGAGTGGAGCACGGG - Intronic
1144097739 17:11917083-11917105 GCGGGGATGGAGTGGGGAAGGGG + Intronic
1146516544 17:33494122-33494144 CTGGTGATTGAGAGGGGCACTGG - Intronic
1147133203 17:38420629-38420651 GGGGGGTTGGAGAGGGGCACTGG + Intergenic
1148440322 17:47708768-47708790 GCGGGGAGGGGGAGGGGCACTGG - Exonic
1149445124 17:56707545-56707567 GAGGGGATGGTGCGGGGCAGAGG + Intergenic
1151318716 17:73339561-73339583 GCGGGGAGTGGAAGGGGCACAGG + Intronic
1152655401 17:81517151-81517173 GCGGGGGTGGGGCGGGGCAGGGG - Intronic
1152675319 17:81637094-81637116 GAGCGTATTGAGCGAGGCACCGG - Exonic
1152862383 17:82703742-82703764 GTGGGGGTTGAGCGGGGGTCAGG - Intergenic
1152864880 17:82716652-82716674 GCGAGGATTGGGCGGGGGGCGGG - Intergenic
1155297428 18:24397931-24397953 GCGGGGAGTGGGCGGGGAACGGG - Intergenic
1160381071 18:78456616-78456638 GCAAGGAGTGAGCTGGGCACTGG - Intergenic
1163146225 19:15380471-15380493 GCGGGGACTAAGCTGGGGACAGG + Intronic
1163160036 19:15458771-15458793 GCGGGGGGTGGGGGGGGCACGGG - Intronic
1165453811 19:35899743-35899765 GTGGGGATTGCGCGGGGCGGGGG + Intronic
1165860187 19:38905344-38905366 GCGGGGCTGAAGCAGGGCACGGG - Exonic
1166007561 19:39917771-39917793 GCTGGGATTGCGGGGGACACAGG - Intronic
1167071762 19:47226260-47226282 GCGGGGACTGAGGGCGGCGCTGG - Intronic
1167503128 19:49858308-49858330 GCAGGGACTGAGCGGGGCAGGGG + Intronic
925981740 2:9182607-9182629 GCAGGGCTGGAGCCGGGCACGGG - Intergenic
926305342 2:11633996-11634018 GGGGGGACTGTGCGGGGCACCGG + Intronic
928093871 2:28392538-28392560 CCGGGGGGTGAGCGGGGGACTGG + Intronic
929383670 2:41380903-41380925 ACGGGCATTGAGCGGGGTAAGGG - Intergenic
929775763 2:44929661-44929683 GCGGGGACCGAGGGGAGCACTGG - Intergenic
947398798 2:229713414-229713436 CCGGGGCGTGAGCAGGGCACCGG - Intronic
948050994 2:234979245-234979267 GCTGGGATTGGGAGGGGCAAAGG - Intronic
948753092 2:240143774-240143796 GTGGGGACTGTGCGGGGCAGGGG - Intronic
949057490 2:241936525-241936547 GCGGGGCGTGCGCGGGGCCCTGG - Intergenic
1168765927 20:381535-381557 GAGGGGCTTGTGGGGGGCACTGG + Intronic
1170160566 20:13305939-13305961 CAGGGGAATGAGTGGGGCACTGG + Intergenic
1171437230 20:25133135-25133157 CCGGGGACTGAGTGGGGCAAGGG - Intergenic
1172446109 20:34994290-34994312 GCGGGGGTTGCGAGGGGCGCTGG + Exonic
1172684864 20:36745960-36745982 GCGGGGAAGGAGCAGGGCAAAGG + Intronic
1175274584 20:57759413-57759435 CCGGGGATTGAGCAGATCACTGG + Intergenic
1175358566 20:58389340-58389362 GCGGGGACCGGTCGGGGCACGGG - Exonic
1175899834 20:62355582-62355604 CCGGGGTTGGGGCGGGGCACAGG + Intronic
1176015044 20:62926570-62926592 GCGGGGCTAGAGCGGAGCCCGGG + Intronic
1179627117 21:42654809-42654831 ACGGGGATCAAGCCGGGCACAGG - Intronic
1179827279 21:43973279-43973301 GCGGTGACTGACCGGGGCCCTGG + Intronic
1180875188 22:19171848-19171870 CCGGGTACTGAGCGGGGCCCGGG + Intergenic
1183197161 22:36361349-36361371 GCGGGCATGGAGGGGGGCTCAGG + Intronic
1184561780 22:45268160-45268182 GCGGGGAGGGAGAGGGGGACAGG - Intergenic
1184674763 22:46035786-46035808 GCGGGGCTTGGGCGGGGCCTGGG - Intergenic
1185285881 22:49999717-49999739 GCGGGGGGTGGGCGGGGCGCGGG + Intronic
949247650 3:1943826-1943848 GGGGGGATGGAGGGGGGCTCAGG + Intergenic
952172785 3:30827297-30827319 GCAGGGCTTGAACTGGGCACAGG - Intronic
954684114 3:52361358-52361380 GCTGGGCATGAGCGTGGCACAGG + Intronic
959905163 3:111703219-111703241 GCAGGGATGGTGCTGGGCACAGG + Intronic
961506099 3:127371459-127371481 GGGGGGACTGAGGGGGGTACTGG - Intergenic
964175242 3:153820180-153820202 GTGGGGATTGAGTGGGGCTTGGG - Intergenic
968514314 4:1009911-1009933 GCGGGCAGTGGGAGGGGCACGGG - Intergenic
968640449 4:1712061-1712083 GCGGGGGTTGTGCGGGGCCGGGG - Intronic
969218760 4:5745809-5745831 CCAGGGATTGTGCTGGGCACTGG + Intronic
969295866 4:6270341-6270363 GGGGGGATGGCGCGGGGCGCGGG - Intronic
974039446 4:56845225-56845247 GAGGGGATGGAGAGGGGCAGAGG - Intergenic
985790051 5:1921604-1921626 GCGCGGATTGGGAGGGGAACAGG - Intergenic
996692431 5:126354944-126354966 GCTGGGAAAGATCGGGGCACTGG + Intergenic
998101533 5:139439150-139439172 GCGGGCCCTGGGCGGGGCACGGG + Intronic
1003072895 6:2958598-2958620 GCGGGGGCTCAGCGGGGCGCTGG - Intronic
1003078046 6:2999765-2999787 GCGGGGAGTGGGCGGGGCTCGGG + Intronic
1003311334 6:4972090-4972112 GAGGGACTTGAGCAGGGCACAGG + Intergenic
1005848335 6:29800348-29800370 CGGGGGATTGATCGGGGCAGAGG + Intergenic
1010083261 6:71887335-71887357 GCGGGGCTTGAGCAGGGAAGAGG + Intronic
1019529245 7:1495355-1495377 GCAGGGGTTGTGCGGGGCCCCGG + Intronic
1019537509 7:1537002-1537024 CTGGGGTTGGAGCGGGGCACAGG + Intronic
1022629380 7:32070916-32070938 CCAGGGAGTGAGCGGGGCGCTGG - Intronic
1026850383 7:73719761-73719783 GCGGGGTCTGGGCGGGGCCCGGG - Intergenic
1034957741 7:155344986-155345008 GCGGGGACTGAGTGGCGCCCTGG + Intergenic
1036470658 8:9049732-9049754 GCGGGGGTTGTGGGAGGCACAGG - Intronic
1037305244 8:17497305-17497327 GCGGGGAAGGAGCGGGGCGAGGG + Intronic
1038808039 8:30812584-30812606 GCTGGGCTTGGGCGGGGCGCGGG - Exonic
1040620993 8:49092792-49092814 GCGGGGGATGGGGGGGGCACAGG - Intergenic
1041762878 8:61385807-61385829 GAGGGGATTGAGGGGTGCTCTGG + Intronic
1049741854 8:144244775-144244797 GCGGGGATGGAGGGGCCCACGGG + Intronic
1058456613 9:105143576-105143598 GTGGGTATTGAGAGGGGCACTGG - Intergenic
1060203123 9:121663748-121663770 GCTGGGACTGAGCTGGGCCCTGG + Intronic
1060799450 9:126534452-126534474 GCGGGGATGGAGCGGGAGAAGGG + Intergenic
1061320198 9:129823681-129823703 TGGGGGATGGAGCGGGGCCCGGG - Intronic
1062652942 9:137587617-137587639 GCAGGGCTTCAGCGGGGCAGGGG + Intronic
1190100966 X:47522874-47522896 GCAGGGCTTGAGGAGGGCACCGG - Intergenic
1190155948 X:47992594-47992616 GTGGGGACAGAGAGGGGCACGGG - Intronic
1191218966 X:57965356-57965378 GTGGGGACTGAGAGGAGCACAGG + Intergenic
1197148490 X:123193929-123193951 GCGGGCATTCAGAGGGGCGCTGG + Intronic
1198276385 X:135098637-135098659 GCGGGGCCTGCGCGGGGCCCGGG - Intergenic
1198310125 X:135422106-135422128 GCGGGGCCTGCGCGGGGCCCGGG + Intergenic
1200021523 X:153214753-153214775 GAGGGGATTGGGCTGGGCAGGGG - Intergenic