ID: 1136414837

View in Genome Browser
Species Human (GRCh38)
Location 16:30096552-30096574
Sequence TGCGGGGATTGAGCGGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 175}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414837_1136414841 -9 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414841 16:30096566-30096588 ATCCCCGCATCAATCCCGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1136414837_1136414853 23 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414837_1136414849 21 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414837_1136414855 30 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
1136414837_1136414851 22 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414837_1136414847 7 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414837_1136414854 24 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414837 Original CRISPR TGCGGGGATTGAGCGGGGCA CGG (reversed) Intronic
901312164 1:8277827-8277849 TGGGGGCATTGAGCTGGGTAAGG - Intergenic
905237004 1:36557179-36557201 TGCGGGCCTGGAGCTGGGCAGGG + Intergenic
905815165 1:40944414-40944436 AGCGGGGGTGGAGTGGGGCAGGG - Intergenic
906510697 1:46409077-46409099 TGCAGGGATTGAGGGGTGTAAGG - Intronic
908910042 1:69062519-69062541 TGCGGGGATAGGTGGGGGCAAGG + Intergenic
910961232 1:92765783-92765805 TGGGGGGAAAGGGCGGGGCATGG + Intronic
914440361 1:147700280-147700302 TGAGGAGATTGAGGTGGGCAGGG - Intergenic
915463540 1:156082905-156082927 AGCGGAGAGTGAGCGCGGCAGGG - Intronic
917456818 1:175192832-175192854 CGCGGGGGTGGAGCGGGGCGGGG - Intronic
920194013 1:204214049-204214071 TGCGGGGGTGGAGCGGGGGCTGG - Exonic
922866593 1:228866015-228866037 TGCAGGGATGGTGGGGGGCAGGG + Intergenic
1064144941 10:12819844-12819866 GGCAGGGATGGAGTGGGGCAGGG + Intronic
1064409561 10:15093171-15093193 GGCGGGGGCTGAGTGGGGCAGGG + Intergenic
1067142461 10:43668589-43668611 TGAGGGGAGTGAGCAGGGCCTGG + Intergenic
1067660897 10:48235603-48235625 GGCAGGGCTTGAGTGGGGCATGG - Intronic
1068582378 10:58756360-58756382 TGTGGGGGTGGAGAGGGGCATGG + Intronic
1068637393 10:59362667-59362689 TGCGGGGACAGAGCTGGGCGGGG + Intronic
1070570520 10:77637154-77637176 GGCGGGGATGGAGGGAGGCACGG + Intronic
1074461418 10:113641319-113641341 TGTTGGGATGGAGTGGGGCAGGG - Intronic
1074565976 10:114578245-114578267 TGCTGGGTTTGAGAGAGGCATGG - Intronic
1075217696 10:120552954-120552976 TGCTGTGCTTGAGAGGGGCATGG + Intronic
1076356531 10:129857602-129857624 TGCGGGAATGAAGCGGGACATGG - Intronic
1076497046 10:130904191-130904213 TGCTGAGAGTGAGTGGGGCAGGG + Intergenic
1076804645 10:132849379-132849401 TGGGGGGATTGCCCTGGGCATGG + Intronic
1076828437 10:132982266-132982288 TGTGGGGATTGTGGGGGGCCTGG + Intergenic
1076882290 10:133245414-133245436 TGCAGGGACAGAGCTGGGCAGGG + Intergenic
1076919706 10:133445304-133445326 CGCGGGGGTGGAGCGTGGCATGG + Intergenic
1077281275 11:1747350-1747372 AGCGGGGGTTGAGGGGGGCGGGG - Intronic
1078066153 11:8080886-8080908 TGCGCGGATTTGGCGGGGCAGGG - Intronic
1078348858 11:10575989-10576011 TGGGGGTAAGGAGCGGGGCACGG - Exonic
1079856686 11:25613154-25613176 TGGAGGGATAGAGCAGGGCATGG - Intergenic
1079947475 11:26762073-26762095 TGTGGGTATTGAGCGGGGTTGGG + Intergenic
1080276306 11:30506856-30506878 TGCAGGAATTCTGCGGGGCAGGG + Intronic
1081994160 11:47352866-47352888 TGCGGGGGGTGAGGGGGGAAGGG - Intergenic
1082978859 11:59102355-59102377 TACAGGGATAGGGCGGGGCAAGG - Intergenic
1085312888 11:75526310-75526332 TGCGGGGATTGCGGGGGTCACGG + Intergenic
1089198839 11:116711246-116711268 GGCAGGGATAGAGCTGGGCAGGG - Intergenic
1089607773 11:119651638-119651660 TGGGGGGATTGGGGTGGGCATGG - Intronic
1099682886 12:85850187-85850209 TGAGGGGAGAGAGAGGGGCAAGG - Intergenic
1100080261 12:90840704-90840726 TTGGGGGCTTGAGAGGGGCAGGG + Intergenic
1100809296 12:98322890-98322912 TGTGGGCATTGAGTGGGGGATGG - Intergenic
1101245612 12:102881455-102881477 TGCGGGTATGGAGTGGGACAAGG + Intronic
1103771820 12:123332832-123332854 TACTGGGATTGGGCCGGGCACGG + Intronic
1104006773 12:124898541-124898563 TGCGGAGATGGAGGGGTGCAGGG + Intergenic
1115912516 14:38272209-38272231 TGTTGGGATTGAGCAGAGCAGGG - Intergenic
1117799343 14:59427289-59427311 TGCAGGGATTGAGGGTGGCATGG - Intergenic
1118386603 14:65260815-65260837 TGCGGGGATTGACAGTGTCATGG + Intergenic
1119410208 14:74425842-74425864 AGCGGGGAGTGAGCTGGGGAGGG - Intronic
1121773146 14:96570271-96570293 TATGGGGATTGAGAGGGGCACGG - Intergenic
1122464106 14:101918581-101918603 TGAGGGGGATGAGGGGGGCAAGG - Intronic
1124184245 15:27509007-27509029 TGAGGGAATTCAGCCGGGCACGG - Intronic
1124253563 15:28122852-28122874 TGCAGGCTGTGAGCGGGGCATGG - Intronic
1125089590 15:35774777-35774799 TGCAGGGATGGAGGAGGGCATGG - Intergenic
1127017817 15:54708378-54708400 TGCAGGGATTGTGGGGGGCGAGG + Intergenic
1128152427 15:65371711-65371733 GGCAGGGATTGAGGGTGGCAGGG + Intronic
1128345723 15:66851306-66851328 TGCCGGGAGTGAGCGGGGCCAGG + Intergenic
1129540389 15:76342997-76343019 TCCGGGGACAGCGCGGGGCACGG - Intergenic
1131160364 15:90101577-90101599 TGCGGCGAGTGAGCCAGGCAGGG + Intronic
1132870368 16:2113115-2113137 GGAGGGGATGGGGCGGGGCAGGG - Intronic
1135411659 16:22239518-22239540 TACGGGGATTGGGCTGGGCGTGG + Intronic
1136414837 16:30096552-30096574 TGCGGGGATTGAGCGGGGCACGG - Intronic
1140252260 16:73304525-73304547 TGCGGGGAGAGAGTGGGGGATGG - Intergenic
1140417852 16:74789289-74789311 TGGGGAGACTGAGCTGGGCAGGG - Intergenic
1142076133 16:88119293-88119315 TGCGGGGATGAAGCGAGGGAGGG - Intergenic
1142285966 16:89171685-89171707 GGCGGGGAGGGGGCGGGGCAAGG - Intergenic
1143206094 17:5140037-5140059 TGCTGGGATGGGGCTGGGCATGG - Intronic
1143852912 17:9826068-9826090 AGCTGGGATCGAGCAGGGCAGGG + Exonic
1144097738 17:11917082-11917104 AGCGGGGATGGAGTGGGGAAGGG + Intronic
1146316297 17:31809764-31809786 TGCTGGGATTAGGCTGGGCATGG - Intergenic
1146927388 17:36754369-36754391 GGCAGGGTTTGAGCAGGGCAGGG + Intergenic
1151331374 17:73411178-73411200 TCCTGGGATTGAGAGGGCCAAGG + Intronic
1151939349 17:77282856-77282878 TGTGGGGATCGCGCGGTGCATGG + Intronic
1152089686 17:78239718-78239740 TGCGGGGCTGGAGAGGAGCATGG - Intronic
1152581425 17:81166939-81166961 TGCAGGGTTGGGGCGGGGCAGGG + Intergenic
1152655402 17:81517152-81517174 AGCGGGGGTGGGGCGGGGCAGGG - Intronic
1154137718 18:11795131-11795153 TGCTGGGATTAGGCTGGGCAGGG - Intronic
1155297429 18:24397932-24397954 GGCGGGGAGTGGGCGGGGAACGG - Intergenic
1159467485 18:68803607-68803629 TGCTGGGAATGAGCGAGGCAGGG + Intronic
1160998334 19:1895573-1895595 TGCGGGGAGGGAGCAGGGCCAGG + Intergenic
1161529108 19:4776505-4776527 TGCCTGGATTGGGCTGGGCACGG - Intergenic
1161587036 19:5111186-5111208 TGCGGTGAGTGAGAGGGACAGGG - Intronic
1161712242 19:5855387-5855409 TACTGGCATTGAGCGGGGTAAGG - Intergenic
1161964288 19:7539877-7539899 TGCCGGGGGTGAGGGGGGCACGG - Intronic
1162104829 19:8364063-8364085 TGCGGGGAGTGCTGGGGGCAGGG - Intronic
1162958539 19:14113087-14113109 TGCGGGGGTGGAGAGGGGAAAGG + Intronic
1163376055 19:16931247-16931269 TGCGGGGACAGAGCTGGGCTGGG - Intronic
1163830469 19:19545013-19545035 GGCCGGGAGTGGGCGGGGCAAGG - Exonic
1165375794 19:35440798-35440820 TGAGGGGATTGAGGATGGCATGG - Intergenic
1165391203 19:35539973-35539995 TGCGGGGATGGAGAGGGGGCTGG - Intronic
1165453810 19:35899742-35899764 AGTGGGGATTGCGCGGGGCGGGG + Intronic
1165797665 19:38528247-38528269 GGCTGGGAGTGAGAGGGGCAGGG + Intronic
1166281647 19:41798175-41798197 TGGGGGGACTCAGCAGGGCAAGG + Intronic
1167503127 19:49858307-49858329 TGCAGGGACTGAGCGGGGCAGGG + Intronic
1167601792 19:50459087-50459109 TGCGGGGAGAGGGCGGGGCGGGG - Intronic
1167696359 19:51017596-51017618 GGCGGGGATTGAACGCGGCGGGG + Intronic
925521769 2:4754431-4754453 TGTGGGGGTTGAGGGGGGAAGGG + Intergenic
926298625 2:11586519-11586541 TGGGGGGATTCAGCAGGGCTTGG + Intronic
928240709 2:29583167-29583189 TGCTGGGTTTGGGCTGGGCATGG - Intronic
929383671 2:41380904-41380926 TACGGGCATTGAGCGGGGTAAGG - Intergenic
931628964 2:64282613-64282635 TGTGGGGATTGAGGAGAGCAGGG + Intergenic
932471601 2:71962911-71962933 TTTAGGGATTGAGCCGGGCAGGG + Intergenic
934943339 2:98518467-98518489 TGCTGGGACTGAGTGGGGCCTGG + Intronic
935373698 2:102374091-102374113 GGCAGGGGTTGAGCGGGGAATGG - Intronic
940107473 2:150115573-150115595 TACTGGCATTGAGCGGGGTAAGG - Intergenic
941808612 2:169734124-169734146 TGCTGGGAGCGAGCGGGGCCGGG + Intronic
943521221 2:188951270-188951292 GGAGGGGATTGGGAGGGGCAGGG - Intergenic
944382839 2:199131559-199131581 TGAGGAGATTGAGAGAGGCATGG - Intergenic
946029395 2:216692832-216692854 TGCAGGGTTTGAGTGGCGCAGGG - Intronic
946239469 2:218344995-218345017 TGCGGGGAGTGGGCTGGGCTGGG - Exonic
946690548 2:222305766-222305788 TGCGGGAAGTGTGCGGGGCTGGG + Intergenic
948753093 2:240143775-240143797 GGTGGGGACTGTGCGGGGCAGGG - Intronic
949036338 2:241817223-241817245 GGCTGGGAGTGAGCAGGGCAGGG + Exonic
1170435240 20:16319811-16319833 TTAGGGGATTGAGCAGGGGAAGG + Intronic
1171437232 20:25133136-25133158 CCCGGGGACTGAGTGGGGCAAGG - Intergenic
1173387354 20:42601079-42601101 TGTGGGGATGGAGCTGAGCATGG - Intronic
1174387889 20:50197936-50197958 TGCAGGGGTGGAGCGGGGGAGGG + Intergenic
1175375443 20:58520640-58520662 TGAGGGGTTTGAGCTGGGCTGGG - Intergenic
1176015043 20:62926569-62926591 TGCGGGGCTAGAGCGGAGCCCGG + Intronic
1177801394 21:25832215-25832237 TGAGTGGATTGAGAGGGACAGGG - Intergenic
1180084426 21:45501613-45501635 ACCGGGGATTGTGCAGGGCAAGG - Intronic
1181307861 22:21927155-21927177 TCCGGGGTCTGAGCAGGGCAAGG + Intronic
1184282993 22:43449580-43449602 TGCGGGGATGGGGCCGAGCAGGG - Intronic
1184674764 22:46035787-46035809 GGCGGGGCTTGGGCGGGGCCTGG - Intergenic
1184885667 22:47343343-47343365 GGAGGGGATTGAGTAGGGCAGGG - Intergenic
1184885772 22:47343711-47343733 TGCAGGGACTGAGTAGGGCAGGG - Intergenic
1184920272 22:47600840-47600862 TGCAGAGACTGAGAGGGGCAGGG - Intergenic
949986903 3:9548534-9548556 AGCGAGGCTTGAGCTGGGCAGGG - Intronic
952074634 3:29681495-29681517 TGGGGGGATTGTGTGGGGGATGG - Intronic
952926853 3:38326606-38326628 TGTGGGGAGTGAGGGAGGCAGGG - Intergenic
953704985 3:45224830-45224852 TGCGGGGAAGGAGTCGGGCAGGG + Exonic
959513428 3:107240160-107240182 TGGGGGGGTTGAGGGGGGGAGGG - Intergenic
961073526 3:123961093-123961115 TGTGGGGATGGAGAGGGACAGGG - Intronic
961310042 3:125990727-125990749 TGTGGGGATGGAGAGGGACAGGG + Intergenic
964175243 3:153820181-153820203 GGTGGGGATTGAGTGGGGCTTGG - Intergenic
968640450 4:1712062-1712084 GGCGGGGGTTGTGCGGGGCCGGG - Intronic
968955281 4:3715925-3715947 TGAGGGGATTGTGCCAGGCATGG - Intergenic
975599658 4:76086061-76086083 TGCGGGGAGGGAGCGGGGGGGGG - Intronic
992217825 5:74543209-74543231 TGCAGGGATTTAGCGGCGTAGGG - Intergenic
996937354 5:128965012-128965034 TGCTGGGATTGGGCGGCGCGGGG - Intronic
997678679 5:135734111-135734133 TACTGGCATTGAGCGGGGTAAGG + Intergenic
998101532 5:139439149-139439171 TGCGGGCCCTGGGCGGGGCACGG + Intronic
1003078045 6:2999764-2999786 GGCGGGGAGTGGGCGGGGCTCGG + Intronic
1006324971 6:33346792-33346814 TACTGGCATTGAGCGGGGTAAGG - Intergenic
1012967990 6:105696096-105696118 TGAGTGGAATGAGTGGGGCAGGG + Intergenic
1015702875 6:136055257-136055279 TGTGGGGAGTGAGAAGGGCAGGG + Intronic
1017051472 6:150397868-150397890 TGGGGAGATTGATGGGGGCAGGG + Intronic
1019261038 7:82176-82198 TGCAGGGATTGTGGGGGGAAAGG - Intergenic
1019542359 7:1557269-1557291 TGCGGGCATGGAGCGGGACTTGG - Intronic
1019746192 7:2701570-2701592 TGCGGGGAGCGCGAGGGGCAGGG + Intronic
1021640210 7:22729143-22729165 TGTGGAGAATGAGCTGGGCAGGG - Intronic
1023016388 7:35971746-35971768 GGCGGGGAGGGAGCGGGGCGCGG - Intergenic
1023740382 7:43275742-43275764 TGCAGGGAGTGAGTGGGGGAGGG - Intronic
1023997717 7:45172116-45172138 AGTGGGGACTGGGCGGGGCAGGG + Intronic
1024893159 7:54226235-54226257 TGGGTGGATTGGGAGGGGCATGG + Intergenic
1024900759 7:54316152-54316174 TGGGTGGATTGGGAGGGGCATGG - Intergenic
1025211168 7:57020328-57020350 AGCGGGGCTGGGGCGGGGCAGGG - Intergenic
1025660787 7:63556519-63556541 AGCGGGGCTGGGGCGGGGCAGGG + Intergenic
1026635155 7:72075668-72075690 TGCAGGGATGGAGCTGAGCAGGG - Intronic
1026878175 7:73891688-73891710 TGAGGGGATTAGGCGGGACAAGG - Intergenic
1027328468 7:77066116-77066138 TCAGGGGCTGGAGCGGGGCAGGG - Intergenic
1029746796 7:102520065-102520087 TCAGGGGCTGGAGCGGGGCAGGG + Intergenic
1029764729 7:102619025-102619047 TCAGGGGCTGGAGCGGGGCAGGG + Intronic
1034706078 7:153146154-153146176 TGCTGAAATTGAGTGGGGCAGGG + Intergenic
1034995007 7:155571588-155571610 TGCGGGGATAAAGTGGGGAAAGG - Intergenic
1037305243 8:17497304-17497326 GGCGGGGAAGGAGCGGGGCGAGG + Intronic
1038808040 8:30812585-30812607 TGCTGGGCTTGGGCGGGGCGCGG - Exonic
1043837851 8:85065936-85065958 TGTTGGCATTGAGCGGGGTAAGG - Intergenic
1048135588 8:131743688-131743710 TACTGGCATTGAGCGGGGTAAGG - Intergenic
1049526105 8:143127688-143127710 GGCGGGGAATGAGAGGGGAATGG + Intergenic
1053180266 9:35962392-35962414 GGCAGGGATGGGGCGGGGCAGGG - Intergenic
1057483237 9:95462070-95462092 TGAGGAGACTGAGCAGGGCAGGG + Intronic
1060172880 9:121476241-121476263 TCCTGGGATAGAGCAGGGCATGG - Intergenic
1060296496 9:122347032-122347054 GGCGGGGAGTGAGCGGGCCGCGG + Intergenic
1060799449 9:126534451-126534473 GGCGGGGATGGAGCGGGAGAAGG + Intergenic
1061519919 9:131111902-131111924 TGAGGGGAGAGAGAGGGGCAGGG - Intronic
1061626476 9:131843531-131843553 TGCAAGGGTTTAGCGGGGCAGGG - Intergenic
1062652941 9:137587616-137587638 GGCAGGGCTTCAGCGGGGCAGGG + Intronic
1186911126 X:14167607-14167629 TAGGGGGAATGGGCGGGGCAGGG - Intergenic
1186946002 X:14568400-14568422 TGCTGGGACTCAGCCGGGCATGG + Intronic
1187019982 X:15370919-15370941 GGTGGGGACTGAGCGTGGCAGGG + Intronic
1190226989 X:48553888-48553910 TGCTGGGATTAGGCTGGGCATGG + Intronic
1190833415 X:54079345-54079367 TGCGAGGATTGCGTGAGGCAAGG + Intronic
1199415726 X:147580849-147580871 TGGGGGGAGGGAGCGAGGCAAGG + Intergenic
1200021524 X:153214754-153214776 TGAGGGGATTGGGCTGGGCAGGG - Intergenic
1200117673 X:153776486-153776508 GGCGGGGCTGGGGCGGGGCAGGG + Intronic