ID: 1136414838

View in Genome Browser
Species Human (GRCh38)
Location 16:30096557-30096579
Sequence ATTGATGCGGGGATTGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414838_1136414847 2 Left 1136414838 16:30096557-30096579 CCCCGCTCAATCCCCGCATCAAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414838_1136414855 25 Left 1136414838 16:30096557-30096579 CCCCGCTCAATCCCCGCATCAAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
1136414838_1136414849 16 Left 1136414838 16:30096557-30096579 CCCCGCTCAATCCCCGCATCAAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414838_1136414853 18 Left 1136414838 16:30096557-30096579 CCCCGCTCAATCCCCGCATCAAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414838_1136414851 17 Left 1136414838 16:30096557-30096579 CCCCGCTCAATCCCCGCATCAAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414838_1136414854 19 Left 1136414838 16:30096557-30096579 CCCCGCTCAATCCCCGCATCAAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414838 Original CRISPR ATTGATGCGGGGATTGAGCG GGG (reversed) Intronic
902620856 1:17650117-17650139 ATGGATACCGGGACTGAGCGTGG + Intronic
910389135 1:86719596-86719618 ATTGATGCAGGGACTGAGTTTGG + Exonic
911100097 1:94088666-94088688 ATTGGTGCTGGGAATGAGTGTGG + Intronic
911138554 1:94470480-94470502 ATTGAGGGGGAGATTGAGGGAGG - Intronic
1071289626 10:84179449-84179471 ACTGATGCTGGGATTCAGCAAGG + Intronic
1071498034 10:86182062-86182084 ATTGATGCAGGGGTCGAGTGCGG - Intronic
1071967765 10:90869991-90870013 ATTGAGGGAGGGATTGAGGGAGG + Intergenic
1077945367 11:6891637-6891659 ATAGATGAGGGGATTAAGCATGG + Exonic
1082862047 11:57866368-57866390 ATAGATGAAGGGATTGAGCATGG + Intergenic
1090150846 11:124382477-124382499 GTAGATGAGGGGATTGAGCATGG + Exonic
1104772648 12:131373082-131373104 ATTGATGGGTGGATGGAGGGAGG - Intergenic
1110225077 13:73111074-73111096 CTTGATGCGGGGATTAACAGAGG + Intergenic
1112969758 13:105245972-105245994 ATTGTTGCAGGTATGGAGCGAGG - Intergenic
1118444996 14:65842760-65842782 ATGGATGTAGGGATTGTGCGTGG - Intergenic
1124342099 15:28896147-28896169 TTTGATGCGGGGGTTGGGGGTGG + Intronic
1128736044 15:70054566-70054588 CTTGATGCGGGGCGTGGGCGAGG + Exonic
1131993470 15:98112528-98112550 TTGGATGCAGAGATTGAGCGTGG - Intergenic
1134249166 16:12562273-12562295 TTTGATGCTGGGATAGAGCGTGG - Intronic
1134925080 16:18152300-18152322 ATTGCTGCGGGGGTGGAGTGAGG - Intergenic
1136414838 16:30096557-30096579 ATTGATGCGGGGATTGAGCGGGG - Intronic
1141898262 16:86972510-86972532 ATGGATGCAGGGATGGAGGGAGG + Intergenic
1143900391 17:10170153-10170175 AATGATGGGGGGATGGAGGGGGG - Intronic
1144421010 17:15098458-15098480 CTTGATGCGGAGAATGAGGGAGG - Intergenic
1144641121 17:16937391-16937413 ATTGAAGCTGGGGTTGAGCCTGG + Intronic
1150717836 17:67586986-67587008 ATTGATGCGGGGCATGAGAGGGG + Intronic
1152202772 17:78956716-78956738 CTGGATGCTGGGAGTGAGCGAGG + Intergenic
1156578310 18:38345862-38345884 ATTGATGCTGGTATTGGGCCTGG - Intergenic
1158881018 18:61779715-61779737 ATTGAAGCTGGGATGGAGCTGGG - Intergenic
1163433126 19:17280231-17280253 GTTGATGCGGGGATTGAACAGGG - Intronic
1163662727 19:18588502-18588524 CTTGAAGCGGGTACTGAGCGTGG - Intronic
935384848 2:102489199-102489221 ATTGATGTGGGGAGTGAAGGAGG + Intronic
936863951 2:117055998-117056020 AACGACGCGGGGATTGACCGAGG - Intergenic
938225598 2:129613614-129613636 ATTGATGCAGGGATTCTGTGAGG + Intergenic
1170224558 20:13977478-13977500 ATTGATGGGGGGATAGATCTTGG + Intronic
1171355351 20:24541104-24541126 ATTAATGGGGTGATTGAGCAAGG - Intronic
1177685962 21:24437862-24437884 GTTAATGCTGGGATTGAGTGAGG + Intergenic
949198237 3:1339224-1339246 ATTGAGGAGGGCATTGAGTGGGG - Intronic
949336195 3:2978264-2978286 ATTGAAGAGGGGATAGATCGTGG + Intronic
951166523 3:19489446-19489468 ATTGATACGGGAATTGATCTGGG + Intronic
953104288 3:39860759-39860781 ATTGATGTGGGGAGTGGCCGTGG - Intronic
962390861 3:134971460-134971482 ATGGATGGGTGGATGGAGCGAGG + Intronic
990371385 5:55122522-55122544 ATTGATGGAGGGAATGGGCGAGG - Intronic
992674520 5:79092337-79092359 ATAGTTGTGGGGATTGAGGGAGG - Intronic
997377619 5:133408559-133408581 ACTGAGGCGGGGGTGGAGCGGGG + Intronic
999243570 5:150141000-150141022 ATTGCTGCGGGGGTTGATGGGGG + Intronic
1023740385 7:43275747-43275769 ATTGTTGCAGGGAGTGAGTGGGG - Intronic
1029579828 7:101428435-101428457 AATGATGCGGGTATTCAGGGAGG + Intronic
1055204742 9:73714523-73714545 ATTGATTCTGGGATTGAGACAGG - Intergenic
1058959120 9:109976276-109976298 ATTGTTGTGGGGATTAAGTGAGG - Intronic
1062425572 9:136504632-136504654 AGAGTTGCGGGGATTGACCGTGG + Intronic
1194208709 X:91042318-91042340 TTTGATGTAGGGATTGAGTGCGG - Intergenic