ID: 1136414839

View in Genome Browser
Species Human (GRCh38)
Location 16:30096558-30096580
Sequence GATTGATGCGGGGATTGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414839_1136414854 18 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1136414839_1136414853 17 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414839_1136414851 16 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414839_1136414857 30 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414857 16:30096611-30096633 TGTACCGGGGGCTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1136414839_1136414847 1 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414839_1136414855 24 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
1136414839_1136414849 15 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414839 Original CRISPR GATTGATGCGGGGATTGAGC GGG (reversed) Intronic