ID: 1136414840

View in Genome Browser
Species Human (GRCh38)
Location 16:30096559-30096581
Sequence GGATTGATGCGGGGATTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 150}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414840_1136414857 29 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414857 16:30096611-30096633 TGTACCGGGGGCTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1136414840_1136414858 30 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414858 16:30096612-30096634 GTACCGGGGGCTGAGGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136414840_1136414854 17 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1136414840_1136414847 0 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414840_1136414849 14 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414840_1136414853 16 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414840_1136414855 23 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
1136414840_1136414851 15 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414840 Original CRISPR GGATTGATGCGGGGATTGAG CGG (reversed) Intronic
900535681 1:3176034-3176056 GGATGGATGAGGGGATGGATGGG - Intronic
900535716 1:3176198-3176220 GGATAGATGAGGGGATAGATGGG - Intronic
900535797 1:3176636-3176658 GGATAGATGAGGGGATAGATGGG - Intronic
901378318 1:8855571-8855593 GGGATGGGGCGGGGATTGAGTGG + Intergenic
901928743 1:12583544-12583566 GGATGGATGGGTGGATGGAGTGG - Intronic
902872787 1:19324517-19324539 GGATCGAGGCGGCGATGGAGAGG - Intronic
903341706 1:22658905-22658927 GGATGGATGCAGGGATGGAGGGG + Intronic
903697329 1:25217630-25217652 GGATTGTTGTTGGGATTAAGTGG - Intergenic
906130274 1:43451597-43451619 GGACAGATGTGGGGATTGAAAGG + Exonic
907339833 1:53727011-53727033 GGATTGCTAGGGGGATTAAGAGG - Intronic
908628848 1:66078944-66078966 GAATTGATGAGTGGATTGTGGGG - Intronic
910823686 1:91381985-91382007 GGGCTGATGCGGGGAGGGAGTGG - Intronic
912238621 1:107880926-107880948 GGATTGTTGTGAGGATTGAATGG - Intronic
912422002 1:109548845-109548867 GGCTGGAGGCGGGGACTGAGTGG + Intronic
916147411 1:161751865-161751887 GGATGAATGAGGGGTTTGAGTGG + Exonic
924943109 1:248825885-248825907 GGCTTGTTGCGGGGAGGGAGGGG - Exonic
1063073271 10:2688903-2688925 GGATGGATGAGTGGATTGATGGG - Intergenic
1065555538 10:26912049-26912071 GGAATTATGAGGGGAATGAGTGG - Intergenic
1067957417 10:50807502-50807524 GGCTTGATGAGGGGCTTGGGAGG - Intronic
1068708988 10:60111110-60111132 GGATTGATGGGTGGATAGATAGG + Intronic
1071876446 10:89848472-89848494 TGACTTATGCGGGGTTTGAGTGG + Intergenic
1076899588 10:133331181-133331203 GGTTTGCTGTGGGGATTTAGTGG - Intronic
1077238927 11:1500608-1500630 GGATGGATGTGGGGTCTGAGAGG - Intronic
1077304283 11:1861929-1861951 GGATTGATGAGTGGATGGATGGG + Intronic
1077357934 11:2127243-2127265 GGATGGATGGGGGGATGGATGGG + Intergenic
1079237675 11:18701481-18701503 GGATGGATGTGGCGATGGAGTGG - Intronic
1081535608 11:43993830-43993852 GGATTGCTGCAGCGATTGGGCGG + Intergenic
1081615436 11:44587967-44587989 GGGTGGATGCAGGGATGGAGGGG - Intronic
1083100915 11:60305085-60305107 GGATTGATGCAGGGATTATCTGG - Intronic
1085645194 11:78218259-78218281 GGGGTGATGCAGGGACTGAGGGG - Exonic
1086982152 11:93209813-93209835 GGAGTGATGCTGTGACTGAGAGG - Intergenic
1090373158 11:126270825-126270847 GGATGGAAGCGGGGAATCAGTGG + Intronic
1091670140 12:2446703-2446725 GGATTGATGGGTGGATGGACAGG + Intronic
1092100627 12:5880913-5880935 GGATGGATGAGTGGATTGAGGGG + Intronic
1096675174 12:53222099-53222121 GGCTTGAAGCAGGGATGGAGAGG + Intronic
1097265689 12:57743309-57743331 GGATGGAGGTGGGGAGTGAGGGG + Intronic
1097758410 12:63433128-63433150 TGATTGATTCAGGGATTCAGAGG + Intergenic
1098074523 12:66714874-66714896 GGATGGATGGGTGGATTGAATGG - Intronic
1098154976 12:67588508-67588530 GTATTGATGGGAGGATAGAGAGG + Intergenic
1101506823 12:105354776-105354798 GGATTCATCCAGGGATGGAGAGG + Intronic
1101792461 12:107940266-107940288 GGAGTGAGGCTGGGATTGAGGGG - Intergenic
1103004396 12:117409512-117409534 GGATAGATGGGTGGATGGAGGGG + Intronic
1103027807 12:117587932-117587954 GCATTGATGCAGGGATAGGGAGG - Intronic
1105545278 13:21346595-21346617 GGAATGAAGCGGGGAGTGAAGGG - Intergenic
1113142215 13:107166737-107166759 GGATAGAGTCGGGGAATGAGGGG - Exonic
1115742442 14:36402854-36402876 GGATTGTTGCTGGCATTTAGTGG - Intergenic
1119901916 14:78268096-78268118 TGTTTAATGAGGGGATTGAGGGG + Intronic
1121948126 14:98142811-98142833 GGAGTGATGCGGGGAGCGGGAGG - Intergenic
1124680722 15:31728369-31728391 GGATTGAGGTGGGGACAGAGAGG - Intronic
1127548141 15:60009201-60009223 GGGGTGAGGCGGGGATGGAGTGG - Intronic
1130628382 15:85539498-85539520 GGCTTGCTGGGGGGATTGATGGG + Intronic
1133116170 16:3579115-3579137 GGATGGATGCGGAGCCTGAGAGG + Intergenic
1133770991 16:8867200-8867222 GGAAGGATGGAGGGATTGAGTGG - Intronic
1133798636 16:9066915-9066937 GGTTTTATGCGGTGATGGAGAGG - Intergenic
1136046567 16:27619840-27619862 AGGTTGATGTGGGGATGGAGGGG - Intronic
1136414840 16:30096559-30096581 GGATTGATGCGGGGATTGAGCGG - Intronic
1137388963 16:48065684-48065706 GGAATGATGCTGAGATTGTGGGG + Intergenic
1137751233 16:50862585-50862607 GGATGGAAGCAGGGATGGAGAGG + Intergenic
1141913507 16:87077098-87077120 GGATTGCTGCTTGGATTCAGGGG - Intergenic
1143900393 17:10170155-10170177 TGAATGATGGGGGGATGGAGGGG - Intronic
1146504710 17:33394940-33394962 GGATGGATGCGTGGATGGATGGG - Intronic
1146925269 17:36740119-36740141 GGATTTATGGGAGGATTCAGGGG + Intergenic
1147249558 17:39144933-39144955 GGATTATTGTGGGGATTAAGGGG - Intronic
1150717834 17:67586984-67587006 GAATTGATGCGGGGCATGAGAGG + Intronic
1150866643 17:68857508-68857530 GTCTTGGTGCTGGGATTGAGAGG - Intergenic
1152394946 17:80026769-80026791 GGAGTCCTGCGGGGTTTGAGGGG + Intronic
1152473499 17:80503296-80503318 GGATAGATGGAGGGATGGAGGGG + Intergenic
1154427639 18:14284295-14284317 GGAGTGTTGGGGGGATTGTGGGG + Intergenic
1157896912 18:51478217-51478239 GGAATAATGCGGGTATGGAGGGG + Intergenic
1160822369 19:1064532-1064554 GGATTGATGGGTGGAGTTAGGGG + Intronic
1160926569 19:1549541-1549563 GGATGGATGCGTGGATGGATGGG - Intergenic
1161499052 19:4603248-4603270 GGATGGATGGGAGGATTGATGGG + Intergenic
1162168123 19:8768288-8768310 GGAGTGAGGGGGGGATGGAGGGG - Intergenic
1162203300 19:9036935-9036957 GGATTGATGAGTGGATGGATGGG + Intergenic
1163118759 19:15203181-15203203 GGAGAGATGCTGGGTTTGAGGGG + Intergenic
1165938581 19:39403766-39403788 GGATTGAGGCGGGGAAAGGGGGG - Intergenic
1167760659 19:51446109-51446131 GGATTCATCAGGGGAGTGAGGGG - Intergenic
925023198 2:587917-587939 GGCGTGATGCGGGGCTTGGGTGG - Intergenic
926400062 2:12487914-12487936 GGATTGATGTGGGGAGAGAAAGG - Intergenic
928027897 2:27754875-27754897 GGCTTGAAGGGGGGATAGAGAGG - Intergenic
934062052 2:88304138-88304160 GGATGGATGGGGGGATGGATAGG - Intergenic
934637916 2:96008008-96008030 GGATTGTTGTGGGGGTTGGGGGG + Intergenic
934795738 2:97097410-97097432 GGATTGTTGTGGGGGTTGGGGGG - Intergenic
937915846 2:127098350-127098372 GGATTGTTACGGGGAGTGAGTGG - Intronic
944596414 2:201265481-201265503 GGATTGATGGTGGGGTTGAATGG + Intronic
946149739 2:217756328-217756350 GAATTGATGCGGGGGGTGAGTGG - Intronic
947545082 2:231004827-231004849 GGATTGTTGGGGGCATTGAGTGG + Intronic
947790968 2:232869150-232869172 GAAGTGATGGGGGGATTGAGGGG + Intronic
948375568 2:237518249-237518271 GGATTGATGCATGGATGGATGGG + Intronic
1169482082 20:5992404-5992426 GGATTGCTGGGAGGATTAAGTGG + Intronic
1170806249 20:19634740-19634762 GGATAGATGAGGTGATTGACTGG + Intronic
1174887495 20:54351964-54351986 GGATTGCTGCTGGTATTTAGTGG + Intergenic
1178819794 21:35964599-35964621 TGACTGATGTGTGGATTGAGGGG - Intronic
1179379138 21:40882121-40882143 ACATTGATTCAGGGATTGAGAGG + Intergenic
1180085955 21:45508003-45508025 GGATGGATGGGTGGATGGAGAGG + Intronic
1182282182 22:29224208-29224230 GGGTTGATGCAGGGAGCGAGAGG - Intronic
1183326770 22:37198781-37198803 GGGTTGCTGCGGGGACTGCGGGG - Intronic
1184731260 22:46372320-46372342 GGATAGATGGGGTGAGTGAGTGG - Intronic
949198239 3:1339226-1339248 GGATTGAGGAGGGCATTGAGTGG - Intronic
950474234 3:13205653-13205675 GGATGGATGAGTGGATGGAGGGG - Intergenic
954614344 3:51961893-51961915 GGCTTGAGGCAGGGGTTGAGGGG + Intronic
964175246 3:153820188-153820210 GGAGTGGGGTGGGGATTGAGTGG - Intergenic
968687641 4:1972198-1972220 GCATTGATGCGTGTATTGAATGG + Intronic
968923763 4:3536320-3536342 TGATTGATGAGGGGAGGGAGAGG - Intergenic
969219229 4:5748731-5748753 GGATGGATGGGTGGATTGATGGG - Intronic
972393519 4:38635586-38635608 GGATGGACTCGGGGAGTGAGAGG - Intergenic
974776619 4:66491191-66491213 GGGTTGTTGTGAGGATTGAGTGG + Intergenic
977859833 4:101943478-101943500 GGATTGGTGTGGGGATGGAAGGG + Intronic
978093042 4:104741251-104741273 GGGTTGTAGAGGGGATTGAGTGG - Intergenic
980134023 4:128843198-128843220 GGATTGTTGTGAGGATTAAGTGG + Intronic
982984335 4:162186555-162186577 GGGTTTATTCAGGGATTGAGTGG - Intergenic
987923570 5:24313187-24313209 GTGAGGATGCGGGGATTGAGAGG + Intergenic
988601277 5:32641504-32641526 GGATTGCTGTGTGAATTGAGTGG + Intergenic
988730847 5:33971277-33971299 GAATAGATGTGGGAATTGAGGGG + Intronic
996089361 5:119335868-119335890 GGATTGTTGCAGGGGGTGAGGGG + Intronic
998385955 5:141757242-141757264 GGATTGTTGTGTGGATTGAGTGG + Intergenic
999243568 5:150140998-150141020 GCATTGCTGCGGGGGTTGATGGG + Intronic
1001537301 5:172507160-172507182 GGACTGATGGGAGGTTTGAGGGG + Intergenic
1007779775 6:44246252-44246274 TGATTGACGCGGGGAAGGAGGGG + Intronic
1007784707 6:44272976-44272998 AGATGGATACGGGGATGGAGGGG - Intronic
1008040201 6:46789419-46789441 GGATTGTTGTGAGGATTGAATGG + Intergenic
1008787987 6:55193551-55193573 GGTTTGATGCTTGGAATGAGAGG - Intronic
1011697974 6:89930479-89930501 GGTTTGATGTGGGGATGGGGTGG - Exonic
1012928836 6:105295611-105295633 GGATAGAGGCAGGGATGGAGAGG - Intronic
1015922243 6:138278042-138278064 GGGTGGCTGCGGGGAATGAGAGG + Intronic
1016300320 6:142623370-142623392 GGTTTGATGCCAGAATTGAGTGG - Intergenic
1019103426 6:169650147-169650169 GGATGGATGGAGGGATGGAGAGG - Intronic
1019160566 6:170065476-170065498 GGATGGATGGGGGGATGGGGTGG - Intergenic
1026903524 7:74049884-74049906 GGATGGATGGATGGATTGAGTGG - Intronic
1028092154 7:86716370-86716392 GGATTGATTTGAGGATTAAGTGG - Intronic
1029589862 7:101500219-101500241 GGGTTGAAGCGGGGATTGCCGGG + Intronic
1029626949 7:101725851-101725873 GGAATGAGGCAGTGATTGAGCGG + Intergenic
1031922592 7:127612776-127612798 GGATTGATGCATGGATAGATGGG + Intronic
1034461027 7:151198176-151198198 GGATGGATGGGGAGATGGAGAGG + Intronic
1034577671 7:152015116-152015138 GGATTGATGAGGGGTTAGAGGGG - Intronic
1035626541 8:1075322-1075344 GGATTGAGGCGTGCATTGTGGGG + Intergenic
1036546198 8:9771822-9771844 GGAATGAAGCGGGGAGAGAGGGG + Intronic
1036558955 8:9885096-9885118 AGATTGCTGCTTGGATTGAGGGG - Intergenic
1038632289 8:29257418-29257440 GGATTGAAGTGCTGATTGAGTGG - Intronic
1040293612 8:46137995-46138017 GGATGGATGCAGGGATTCAGGGG - Intergenic
1041888114 8:62836353-62836375 GGTTAGATGTGGGGTTTGAGTGG - Intronic
1044765807 8:95572604-95572626 AGATGGATGGGGGGATGGAGTGG - Intergenic
1045101391 8:98848195-98848217 GGAGGGATGAGGGAATTGAGAGG - Intronic
1045484588 8:102621342-102621364 GGATTGAGGCAGGGATTTTGGGG - Intergenic
1045655251 8:104380208-104380230 GGATTTATGCAGGGAATAAGAGG + Intronic
1052956003 9:34253825-34253847 AGATTGATTTGGGGATTTAGAGG - Exonic
1053041291 9:34875100-34875122 GGAAGGATGTGGGGTTTGAGAGG - Intergenic
1053799475 9:41755343-41755365 TGATTGATGAGGGGAGGGAGAGG - Intergenic
1054145740 9:61559654-61559676 TGATTGATGAGGGGAGGGAGAGG + Intergenic
1054187884 9:61967404-61967426 TGATTGATGAGGGGAGGGAGAGG - Intergenic
1054465482 9:65490758-65490780 TGATTGATGAGGGGAGGGAGAGG + Intergenic
1054650630 9:67621177-67621199 TGATTGATGAGGGGAGGGAGAGG + Intergenic
1057622601 9:96649651-96649673 GGCTTGAAGAGGGGATAGAGAGG - Intronic
1061244705 9:129395474-129395496 GGATTGATGGGAGGATGGATGGG + Intergenic
1061973619 9:134057531-134057553 GGTTTGTTGTGGGGATTGTGGGG - Intronic
1062658104 9:137614529-137614551 GGATTGAGGTGGGGCATGAGGGG - Intronic
1188280840 X:28267298-28267320 GGATGGATGGGGGGATGGATGGG - Intergenic
1192591056 X:72359727-72359749 TGATTGCTGTGGGGATGGAGTGG + Intronic
1193277851 X:79611024-79611046 GGATTGATTATTGGATTGAGTGG - Intergenic
1193824163 X:86202229-86202251 GGATGGAGGAGGGGATTAAGTGG + Intronic
1200015659 X:153160735-153160757 GGATTGATTCGGGGAGTTGGAGG - Intergenic
1201861778 Y:18605973-18605995 GGATTGAGGTGGGGTTTTAGTGG - Intergenic
1201871545 Y:18714407-18714429 GGATTGAGGTGGGGTTTTAGTGG + Intergenic