ID: 1136414842

View in Genome Browser
Species Human (GRCh38)
Location 16:30096568-30096590
Sequence GGCCTCACGGGATTGATGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414842_1136414853 7 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414842_1136414854 8 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1136414842_1136414851 6 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414842_1136414847 -9 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414842_1136414849 5 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414842_1136414860 24 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414842_1136414855 14 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
1136414842_1136414857 20 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414857 16:30096611-30096633 TGTACCGGGGGCTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1136414842_1136414858 21 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414858 16:30096612-30096634 GTACCGGGGGCTGAGGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414842 Original CRISPR GGCCTCACGGGATTGATGCG GGG (reversed) Intronic
904011058 1:27390961-27390983 GGCCTCATGGGGTTGTTGAGTGG - Intergenic
906463737 1:46057981-46058003 GGCCTCCAGGGCTTGATGGGAGG - Intronic
908111524 1:60903391-60903413 TACCTCATGGGCTTGATGCGAGG - Intronic
913335925 1:117708940-117708962 TGCCTCACGGGGTTGTTGCGAGG + Intergenic
920230001 1:204463934-204463956 GGCTTCATGGGATTGGTGCTGGG - Intronic
920559981 1:206932054-206932076 GACCTCACGGGGCTGATGTGAGG - Intronic
923551019 1:234963372-234963394 GGCCTCCTGGGATTGCAGCGCGG - Intergenic
1065507151 10:26439915-26439937 GGCCTCACTGGAATAATGGGTGG + Intronic
1069104779 10:64370064-64370086 GGCCTCATGGGGTTGAAGCTGGG - Intergenic
1070330982 10:75416987-75417009 GGCCTTATAGGATTGTTGCGAGG - Intergenic
1072139173 10:92574369-92574391 GCCCTCACTGGATTTATGAGCGG - Intergenic
1074556396 10:114494973-114494995 TGCCTTACAGGATTGATGAGGGG - Intronic
1081832800 11:46128242-46128264 GGCCTCACTGGATTGTTTGGAGG + Intergenic
1083952658 11:65965492-65965514 GGCCTGACGGCACTGAGGCGGGG + Intronic
1084145132 11:67261263-67261285 GGCCTCACTGGATTGTTTTGAGG - Intergenic
1104440190 12:128787899-128787921 GGCCACACTGGATTCATGTGGGG - Intergenic
1125722222 15:41850828-41850850 GGCTTCAGGGGAAGGATGCGGGG - Intronic
1136414842 16:30096568-30096590 GGCCTCACGGGATTGATGCGGGG - Intronic
1141134405 16:81456305-81456327 CGCCTCACGGGGCTGATGAGAGG - Intronic
1151768794 17:76146290-76146312 GACCTCACGGGCTTGCTGTGAGG + Intronic
1152124354 17:78437573-78437595 GGCCCCAAGGGATGGATGCCAGG + Intronic
1152486685 17:80599223-80599245 GGCCTCACCGCATGGCTGCGGGG - Intronic
1162328837 19:10014486-10014508 TGCCTCACGGGTGTGATGTGAGG - Intronic
1163377698 19:16943873-16943895 GGCCTCACTGGAGTGATAGGAGG - Intronic
942323737 2:174757908-174757930 CCCCTCACGGGATTGTTGTGAGG - Intronic
1169422950 20:5474329-5474351 GACCTCACGTGACTGCTGCGTGG + Intergenic
1169426478 20:5501146-5501168 GACCTCACGTGACTGCTGCGTGG - Intergenic
1169540460 20:6593971-6593993 CTCCTCAAGGGATTGATGCTTGG + Intergenic
1183714098 22:39523644-39523666 TGCCTCACGGGTGTGCTGCGGGG - Intergenic
949398095 3:3636488-3636510 GACCTCACAGGATTGTTACGAGG + Intergenic
951195339 3:19817373-19817395 GGCCTCAGGGGATCGAGGCCTGG + Intergenic
961373602 3:126448077-126448099 CACCTCACAGGATTGTTGCGAGG + Intronic
965268386 3:166579015-166579037 TACCTCACAGGATTGATGTGAGG + Intergenic
967330904 3:188288378-188288400 GACCTCACGGGACTGGTGTGAGG - Intronic
976600583 4:86934834-86934856 GCCCTCCCGGGATTGGTGGGAGG - Intronic
977437779 4:97021922-97021944 TGCCTTACAGGATTGATGTGAGG + Intergenic
1001868714 5:175131349-175131371 GGCCTCAAGGGAGTGAGGAGGGG - Intergenic
1014205868 6:118654773-118654795 TGCCTCACAGGATTGCTGTGGGG + Intronic
1016885346 6:148954744-148954766 AGCCTCACGTGTTTGATGCTGGG + Intronic
1018903435 6:168062508-168062530 GGCCTCACGGGCTTTGTGCCTGG - Intronic
1019096578 6:169586236-169586258 GACCTCACGGGATTTATGACAGG - Intronic
1020112031 7:5452617-5452639 GGCCTCCCCGGGCTGATGCGTGG - Intronic
1026442419 7:70456038-70456060 TGCCTCACAGGATTGCTGTGAGG + Intronic
1034618174 7:152436260-152436282 GGCCTGACGGGCCTGACGCGCGG - Intergenic
1037766321 8:21774548-21774570 GACCTCATTGGATTGCTGCGAGG - Intronic
1045413132 8:101939820-101939842 GGCCTCATGGAATTGTTGGGAGG - Intronic
1046012884 8:108571807-108571829 GGCCTCTTGGGATTGAGGAGTGG - Intergenic
1049035632 8:140073954-140073976 TGCCTCACAGGATTGCTGGGAGG - Intronic
1050552251 9:6758388-6758410 GGCCGCAGGGGAGGGATGCGGGG + Intronic
1050593630 9:7184364-7184386 GGCCTCACAGCCTTGATGCAGGG - Intergenic
1052835363 9:33246191-33246213 GGCCTCCTGGGAATGATGGGTGG + Intronic
1054937084 9:70699587-70699609 AGCCTCACAGGATTGGTGTGAGG - Intronic
1061597738 9:131643073-131643095 GGCATCACGGGATAGTTGTGGGG + Intronic
1062267332 9:135693201-135693223 GGCCTCACGGTCTTGGTGCCTGG - Intergenic
1199661132 X:150052223-150052245 TGCCTCACAGGATTGTTGTGAGG - Intergenic
1200234463 X:154461624-154461646 GGGCTCACGGTGTTGATGCAGGG - Exonic