ID: 1136414843

View in Genome Browser
Species Human (GRCh38)
Location 16:30096569-30096591
Sequence CGGCCTCACGGGATTGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414843_1136414855 13 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
1136414843_1136414857 19 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414857 16:30096611-30096633 TGTACCGGGGGCTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1136414843_1136414851 5 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414843_1136414847 -10 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414843_1136414849 4 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414843_1136414853 6 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414843_1136414854 7 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1136414843_1136414860 23 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414843_1136414858 20 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414858 16:30096612-30096634 GTACCGGGGGCTGAGGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414843 Original CRISPR CGGCCTCACGGGATTGATGC GGG (reversed) Intronic
900031834 1:378208-378230 CTGCCTGCCTGGATTGATGCAGG - Intergenic
900052382 1:606399-606421 CTGCCTGCCTGGATTGATGCAGG - Intergenic
902038182 1:13472938-13472960 CTGCCTCAGGTGATTCATGCTGG - Intergenic
904903715 1:33878170-33878192 CGGCCTCACGGGATGGCTCCTGG - Intronic
920230002 1:204463935-204463957 GGGCTTCATGGGATTGGTGCTGG - Intronic
1069104780 10:64370065-64370087 AGGCCTCATGGGGTTGAAGCTGG - Intergenic
1074556397 10:114494974-114494996 CTGCCTTACAGGATTGATGAGGG - Intronic
1075710884 10:124530023-124530045 CGGCCTCATGGGATGCATGCGGG - Intronic
1082778989 11:57271442-57271464 CAGCCTCAGGGGATTGCTGGGGG + Intergenic
1084534211 11:69747161-69747183 GGGCCTCACGGGGCTGCTGCTGG + Intergenic
1094748652 12:33378427-33378449 CGGCTTCACAGGGATGATGCAGG - Intronic
1104944010 12:132407595-132407617 CGCCCTCACGGGAGGGGTGCAGG - Intergenic
1106891169 13:34247121-34247143 AGGCCTCCAGGGATTCATGCAGG + Intergenic
1108323124 13:49305679-49305701 CTGCCTCACAGGATTGTTGTGGG - Intergenic
1113784620 13:112995906-112995928 CGGCCACCGGGGAGTGATGCCGG + Intronic
1113793303 13:113041991-113042013 CAGCCTCACGGGATGGTCGCTGG + Intronic
1114399720 14:22398646-22398668 CTACCTCAGGGGATTGTTGCAGG + Intergenic
1122290085 14:100676071-100676093 CCGGCACACGGGGTTGATGCCGG + Intergenic
1129697773 15:77750224-77750246 CGGCCTCACGGGAAGGCAGCAGG - Intronic
1136414843 16:30096569-30096591 CGGCCTCACGGGATTGATGCGGG - Intronic
1141126322 16:81403648-81403670 CGGCCTCAGGGGTTTGGTGACGG - Intergenic
1152541669 17:80979776-80979798 CGGCCCCCCGGGAGTGATGGTGG - Intergenic
1152947823 17:83207506-83207528 CTGCCTGCCTGGATTGATGCAGG + Intergenic
1172021299 20:31916153-31916175 CTTCCTCACGGGATGGCTGCTGG + Intronic
1179509379 21:41862354-41862376 AGGCCTCAGGGGATTCGTGCAGG - Intronic
1181493366 22:23274530-23274552 CGGCCTCAGGGGTCTCATGCAGG + Intronic
1183714099 22:39523645-39523667 CTGCCTCACGGGTGTGCTGCGGG - Intergenic
969672161 4:8595787-8595809 AGGCCTCACGGGATTAGGGCAGG + Intronic
990056966 5:51593885-51593907 CAGCCTCACTGGATTGTAGCTGG + Intergenic
1002741986 5:181440660-181440682 CTGCCTGCCTGGATTGATGCAGG + Intergenic
1014205867 6:118654772-118654794 CTGCCTCACAGGATTGCTGTGGG + Intronic
1016885345 6:148954743-148954765 AAGCCTCACGTGTTTGATGCTGG + Intronic
1018457140 6:163962619-163962641 CAACCTCACCGGATTGATTCTGG + Intergenic
1020356261 7:7278928-7278950 CAGCCTCACTGGATAGATACTGG + Intergenic
1021166397 7:17347799-17347821 CTGCCTCACTGGATTGCTGGAGG + Intergenic
1032157486 7:129480828-129480850 CAGCCTCAGGAGGTTGATGCAGG - Exonic
1035501014 8:91536-91558 CTGCCTGCCTGGATTGATGCAGG - Intergenic
1035622945 8:1048245-1048267 CAGCCTCACAGGACTGAGGCTGG - Intergenic
1039792666 8:40888024-40888046 CGGACTCACAGGATTCATGGAGG - Intronic
1043006061 8:74820112-74820134 CGTCCTCACTGCATTGAAGCTGG - Intronic
1045951434 8:107855731-107855753 CGGCCTCAAGGTCTTGATGGGGG + Intergenic
1050552250 9:6758387-6758409 CGGCCGCAGGGGAGGGATGCGGG + Intronic
1050593631 9:7184365-7184387 TGGCCTCACAGCCTTGATGCAGG - Intergenic
1058703659 9:107621390-107621412 CAGACTCACTGGATTCATGCTGG + Intergenic
1203607898 Un_KI270748v1:71876-71898 CTGCCTGCCTGGATTGATGCAGG + Intergenic
1192386160 X:70672963-70672985 CGGCTTCACGAGATTGATTCTGG + Intronic
1195151517 X:102075362-102075384 CAACCTCACAGGATTGAAGCAGG + Intergenic
1197313899 X:124940167-124940189 TGGCCACAAGTGATTGATGCAGG + Intronic
1200234464 X:154461625-154461647 GGGGCTCACGGTGTTGATGCAGG - Exonic