ID: 1136414844

View in Genome Browser
Species Human (GRCh38)
Location 16:30096570-30096592
Sequence ACGGCCTCACGGGATTGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414844_1136414855 12 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
1136414844_1136414854 6 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1136414844_1136414861 30 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414844_1136414849 3 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414844_1136414853 5 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414844_1136414858 19 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414858 16:30096612-30096634 GTACCGGGGGCTGAGGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136414844_1136414857 18 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414857 16:30096611-30096633 TGTACCGGGGGCTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1136414844_1136414860 22 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414844_1136414851 4 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414844 Original CRISPR ACGGCCTCACGGGATTGATG CGG (reversed) Intronic
904472905 1:30746814-30746836 CCTGCCTCACAGGATTGCTGAGG + Intronic
912707907 1:111928520-111928542 ACGGCATCACGCAATTGGTGTGG + Intronic
916449801 1:164909532-164909554 AAGGCCTCACTGCATTAATGAGG + Intergenic
1068332172 10:55585168-55585190 ACAGCCTCACGGGATTACTGGGG + Intronic
1074556398 10:114494975-114494997 TCTGCCTTACAGGATTGATGAGG - Intronic
1075710885 10:124530024-124530046 ACGGCCTCATGGGATGCATGCGG - Intronic
1080072520 11:28107499-28107521 ACTGCCTAACGGGATTGCCGAGG - Intronic
1082778988 11:57271441-57271463 CCAGCCTCAGGGGATTGCTGGGG + Intergenic
1082822549 11:57553971-57553993 ACTACCTCACGGGCTTGTTGGGG + Intronic
1083929638 11:65833661-65833683 ACGGCGGCACGGGGTTGTTGTGG + Exonic
1085033947 11:73289084-73289106 AAGGCCTCAGGGGATTGGGGAGG + Intronic
1090637092 11:128695948-128695970 ATGGCCTCAGGGTCTTGATGTGG + Intronic
1093595184 12:20950795-20950817 ACGGCCCAACAGGACTGATGAGG - Intergenic
1100373772 12:93993535-93993557 ACGGCTTCATAGGATTGTTGTGG + Intergenic
1102497627 12:113330356-113330378 ACCGCCTCACAGGACAGATGGGG - Intronic
1107790468 13:43997108-43997130 AAGGCAGCAGGGGATTGATGAGG + Intergenic
1107888772 13:44896078-44896100 ACACCCTGAGGGGATTGATGGGG - Intergenic
1108323125 13:49305680-49305702 CCTGCCTCACAGGATTGTTGTGG - Intergenic
1109453538 13:62551265-62551287 ACTGCCTCTCAGGGTTGATGAGG - Intergenic
1119405009 14:74393113-74393135 CCTGCTTCACGGGGTTGATGGGG - Intergenic
1123701057 15:22915083-22915105 AAGGGCTCACAGGGTTGATGAGG - Intronic
1131468480 15:92674706-92674728 ACTGGCTCACGTGATTGTTGGGG - Intronic
1132116515 15:99140181-99140203 ATGGCCTTGCGGGATTGGTGAGG + Intronic
1134384027 16:13755241-13755263 ACTGCCCCAAGGGATGGATGTGG - Intergenic
1136414844 16:30096570-30096592 ACGGCCTCACGGGATTGATGCGG - Intronic
1142109065 16:88321668-88321690 AAGGCCTCACCTGATTGGTGTGG + Intergenic
1147357470 17:39909107-39909129 ACTGCCTCACAGGATTGTTTGGG - Intronic
1152658923 17:81533494-81533516 ACGCCCTCACGGTAGTAATGTGG + Intronic
1160540898 18:79621868-79621890 ACGGCGGCACGGGATCCATGTGG + Intergenic
1161871434 19:6873398-6873420 ACTGGCTCACGGGATTGTAGGGG - Intergenic
1165074475 19:33273304-33273326 AGGGCCTCACAGAATTCATGGGG + Intergenic
928110862 2:28507603-28507625 ACTTCCTCATGGGATTGCTGTGG - Intronic
948198217 2:236110968-236110990 ACGTCCTCACGTGATAGAAGAGG + Intronic
1175813315 20:61870393-61870415 ACGGTCTCTCGGGCTGGATGGGG - Intronic
1178146358 21:29744843-29744865 CCTACCTCATGGGATTGATGTGG - Intronic
1182879369 22:33720320-33720342 ACGGGGTAACGGGAGTGATGGGG + Intronic
1184923358 22:47620991-47621013 CGGGCCTCACCGGGTTGATGTGG + Intergenic
956195369 3:66649088-66649110 AAGGACTTACGGGGTTGATGTGG + Intergenic
969644045 4:8416205-8416227 CAGGCCTCAGGGAATTGATGAGG - Intronic
975725099 4:77284174-77284196 ACTGCCTCATGGGCTTGCTGAGG + Intronic
1001868716 5:175131351-175131373 AGGGCCTCAAGGGAGTGAGGAGG - Intergenic
1003758084 6:9144949-9144971 AAGGCCTCACTGGGTTGAGGAGG + Intergenic
1014205866 6:118654771-118654793 ACTGCCTCACAGGATTGCTGTGG + Intronic
1015509549 6:134024189-134024211 CCTGCCTCACTGGAGTGATGTGG + Intronic
1035144197 7:156796993-156797015 CCTGCCTCATGGGATTGCTGTGG - Intronic
1039150772 8:34502752-34502774 ACTGCCTGACAGGATTAATGTGG - Intergenic
1045951433 8:107855730-107855752 GCGGCCTCAAGGTCTTGATGGGG + Intergenic
1047355051 8:124112392-124112414 ACAGCTCCACGGGATTGCTGAGG + Intronic
1061597736 9:131643071-131643093 ATGGCATCACGGGATAGTTGTGG + Intronic
1197003527 X:121469034-121469056 AGGGCATCACGGCATTCATGAGG + Intergenic