ID: 1136414846

View in Genome Browser
Species Human (GRCh38)
Location 16:30096581-30096603
Sequence CAACGGGAGAAACGGCCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 80}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414846_1136414864 28 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414846_1136414849 -8 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414846_1136414853 -6 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414846_1136414855 1 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
1136414846_1136414854 -5 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1136414846_1136414860 11 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414846_1136414857 7 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414857 16:30096611-30096633 TGTACCGGGGGCTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1136414846_1136414858 8 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414858 16:30096612-30096634 GTACCGGGGGCTGAGGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136414846_1136414861 19 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414846_1136414851 -7 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414846 Original CRISPR CAACGGGAGAAACGGCCTCA CGG (reversed) Intronic
900536493 1:3180439-3180461 CACCGGGAGAAACTGCGCCAAGG - Intronic
900623403 1:3597425-3597447 CAGCGGGAGACAGGGCGTCAGGG - Intronic
901902411 1:12376526-12376548 CAACGAGAAAAATTGCCTCATGG - Intronic
906687072 1:47769625-47769647 CAATGGGGGAAACTGTCTCATGG + Intronic
907387276 1:54134243-54134265 CATCGGGAGAAAAGGCTGCAGGG - Intronic
916298558 1:163247976-163247998 CCACGGGAGAAACAGAGTCAAGG - Intronic
916583028 1:166125283-166125305 CAACTGGAGAAACCGAGTCAGGG - Intronic
919077193 1:192828105-192828127 CATCGTGAGATACTGCCTCAAGG - Intergenic
920628371 1:207626473-207626495 CAAGGGCATAAAGGGCCTCATGG + Intronic
921159751 1:212464503-212464525 CAATGGGAGAAAAGTCTTCAAGG - Intergenic
922595017 1:226806940-226806962 CAACATGAGGAAAGGCCTCAGGG + Intergenic
923079122 1:230637078-230637100 GAACTGGAGAAGCAGCCTCAAGG + Intergenic
1069569699 10:69486873-69486895 AAAAGGGAGAAGCAGCCTCATGG - Intronic
1069927403 10:71860386-71860408 CAGCGGGTGACAGGGCCTCAGGG - Intergenic
1071694173 10:87854415-87854437 CAAAGTAAGAAATGGCCTCAAGG + Intergenic
1074944706 10:118270271-118270293 CAAAGTGAGAAATGGGCTCAGGG - Intergenic
1082836541 11:57654997-57655019 AACTGGGAGAAACTGCCTCAAGG + Intronic
1083228081 11:61297046-61297068 CAAGGTGAGATACGGCCTCAAGG - Intergenic
1084361427 11:68670538-68670560 CCACGGGAGACGCGGCCTCTGGG + Intergenic
1089540798 11:119188075-119188097 CACCTGGAGAAAGGGCCCCAGGG + Exonic
1090358721 11:126158144-126158166 CACAGGGAGAAAGGGCCTCTCGG + Intergenic
1096776447 12:53967222-53967244 CAACTGGAAAAATGGCCTCTGGG + Intergenic
1116439894 14:44939308-44939330 CAATGGGAGAAAGGCCCTGAAGG - Intronic
1117530135 14:56652881-56652903 CAACTGGAGGAACTGCCTCCAGG - Intronic
1117570640 14:57045525-57045547 CACCGGGAGAAAAGTTCTCAAGG - Intergenic
1118329971 14:64807615-64807637 GAAGGGGAGAAAAGGCCCCAAGG + Intronic
1118443265 14:65830641-65830663 GAACTGAAGAAACGGCCTCTAGG - Intergenic
1120223823 14:81767437-81767459 AAAAGGGAGAAGCAGCCTCAGGG - Intergenic
1121916085 14:97837943-97837965 CAAAGAGAGAAATGGCCACAGGG - Intergenic
1122695232 14:103549193-103549215 CACGGGCAGAAACAGCCTCATGG - Intergenic
1123931715 15:25175206-25175228 CAAGGGGAGAACAGGGCTCAGGG - Intergenic
1130070062 15:80639663-80639685 CAACAGGATAAAGTGCCTCATGG - Intergenic
1134439521 16:14290019-14290041 CAACGGGAGAAACTGAGGCACGG - Intergenic
1134565415 16:15247599-15247621 CAAGGGGAGAAACATGCTCAGGG + Intergenic
1134737081 16:16509099-16509121 CAAGGGGAGAAACATGCTCAGGG - Intergenic
1134930439 16:18203065-18203087 CAAGGGGAGAAACATGCTCAGGG + Intergenic
1135802642 16:25512251-25512273 CAACACAAGAAATGGCCTCAGGG - Intergenic
1136414846 16:30096581-30096603 CAACGGGAGAAACGGCCTCACGG - Intronic
1137072964 16:35923400-35923422 CAGCCTGAGAAATGGCCTCATGG - Intergenic
1139215735 16:65122960-65122982 CTACGGGAGAAAGGGCCTAATGG + Intronic
1143681922 17:8482043-8482065 CCACGGGAGGAACTGCCTGATGG + Intronic
1144165035 17:12602393-12602415 CAATGGGAGAAACGGGGTGAAGG + Intergenic
1155354005 18:24933497-24933519 CCACAGGAGCAATGGCCTCATGG + Intergenic
1161516275 19:4698314-4698336 CAAAGGGAGAAACGGCAGCAGGG + Intronic
1161730459 19:5957376-5957398 CCAAGGGAGAAGCAGCCTCATGG + Intronic
1167888347 19:52520205-52520227 CAACCTGAGATATGGCCTCATGG - Intergenic
932541868 2:72663922-72663944 TAACAGGGGAAACTGCCTCAGGG + Intronic
943633671 2:190281537-190281559 CAATGGGAGAAAGACCCTCAAGG - Intronic
946577176 2:221088340-221088362 CAACTGGAAACACAGCCTCAGGG - Intergenic
947966772 2:234288802-234288824 CAGCAGGAGAAACGGCCTGTGGG + Intergenic
1170570169 20:17628142-17628164 CAAGGGGAGAAAGGGGCCCAGGG - Intronic
1174168291 20:48600094-48600116 CACCTGGAGAAAACGCCTCATGG + Intergenic
1177756690 21:25357143-25357165 CAAAGGGAGAAAAGGTTTCACGG - Intergenic
1179525292 21:41972093-41972115 CATCTGGGGAAACTGCCTCATGG - Intergenic
954389780 3:50262642-50262664 CAAGGGGAGAAAAGGACCCATGG - Intergenic
961332949 3:126153725-126153747 CCCCAGGAGAAAGGGCCTCAGGG - Intronic
969681508 4:8645778-8645800 CAGCGGGAGCCACGGTCTCAGGG - Intergenic
984894884 4:184529564-184529586 CAAAGGCAGGAAGGGCCTCAGGG - Intergenic
991206837 5:64059610-64059632 CAACGGGAAAAAAGGCCCCATGG + Intergenic
995160861 5:108979727-108979749 CAACAGGAGACAATGCCTCATGG - Intronic
999196813 5:149787102-149787124 CAATGGGAGAAACGGCCTCAGGG + Intronic
999377124 5:151094511-151094533 CAACGGGATACCAGGCCTCAGGG + Intergenic
1001542704 5:172550571-172550593 CAAGGGCAGAGCCGGCCTCAGGG - Intergenic
1002701890 5:181130423-181130445 CAGAGGGAGAAACAGGCTCAGGG + Intergenic
1002703907 5:181147723-181147745 CAGAGGGAGAAACAGGCTCAGGG - Intergenic
1003511602 6:6785869-6785891 CAAAGGGAGAAAAGGGCACATGG - Intergenic
1003893477 6:10584545-10584567 CAACCTGAGATACGGCCTCGTGG - Intronic
1004129708 6:12907883-12907905 CATCGTAAGAAAAGGCCTCAAGG - Intronic
1007031435 6:38631310-38631332 CAACTGAAGAAATGGCTTCACGG + Intronic
1015713535 6:136167028-136167050 CAGCTGGAGCAAAGGCCTCAAGG - Intronic
1018961704 6:168454185-168454207 CAACAGGAGAGACGGCCACAGGG - Intronic
1021457876 7:20848855-20848877 CAAGGTAAGAAATGGCCTCAGGG - Intergenic
1032463142 7:132126495-132126517 CAACGGGAGACACGGTACCAGGG + Exonic
1033517917 7:142128442-142128464 CAACGGGAAAAATGGCTCCAGGG + Intronic
1033904107 7:146180100-146180122 TAACAGGAGAAACACCCTCAGGG + Intronic
1034494930 7:151414523-151414545 CAAGGGAAGAAACAGCCCCACGG + Intergenic
1046786670 8:118273782-118273804 AAACTGGAGAACCTGCCTCAAGG + Intronic
1049619933 8:143593515-143593537 CAACGGGAGCTCCGGCCCCAGGG + Intronic
1050917972 9:11161724-11161746 CAATGAGAAAAAAGGCCTCAAGG + Intergenic
1054856336 9:69903443-69903465 AAATGGGAGAAGCGGACTCATGG + Intronic
1057448237 9:95134187-95134209 CAAGGGGAGAAACGGGATCGCGG + Intronic
1061317544 9:129805812-129805834 CAAAAGGAGAAACAGTCTCAAGG - Intronic
1062264088 9:135678874-135678896 CTGCGGGAGACACAGCCTCAGGG - Intergenic
1187126562 X:16459826-16459848 CAGCTGGAGAAACTGCATCACGG + Intergenic
1189549467 X:42077939-42077961 CAACGGGAAAAAGGCCCTAAAGG - Intergenic
1201537982 Y:15071849-15071871 TAATGTGAGAAACAGCCTCAAGG + Intergenic
1202109253 Y:21404662-21404684 CAGCAGGACAAACAGCCTCAGGG + Intergenic