ID: 1136414846

View in Genome Browser
Species Human (GRCh38)
Location 16:30096581-30096603
Sequence CAACGGGAGAAACGGCCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 80}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414846_1136414849 -8 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414846_1136414855 1 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
1136414846_1136414861 19 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414846_1136414864 28 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414846_1136414851 -7 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414851 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 1
2: 1
3: 11
4: 60
1136414846_1136414854 -5 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414854 16:30096599-30096621 CGTTGGCTCCACTGTACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1136414846_1136414857 7 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414857 16:30096611-30096633 TGTACCGGGGGCTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1136414846_1136414858 8 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414858 16:30096612-30096634 GTACCGGGGGCTGAGGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136414846_1136414853 -6 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414853 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 29
1136414846_1136414860 11 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414846 Original CRISPR CAACGGGAGAAACGGCCTCA CGG (reversed) Intronic