ID: 1136414847

View in Genome Browser
Species Human (GRCh38)
Location 16:30096582-30096604
Sequence CGTGAGGCCGTTTCTCCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 28}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414838_1136414847 2 Left 1136414838 16:30096557-30096579 CCCCGCTCAATCCCCGCATCAAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414842_1136414847 -9 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414836_1136414847 8 Left 1136414836 16:30096551-30096573 CCCGTGCCCCGCTCAATCCCCGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414835_1136414847 11 Left 1136414835 16:30096548-30096570 CCGCCCGTGCCCCGCTCAATCCC 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414832_1136414847 25 Left 1136414832 16:30096534-30096556 CCCGCGTTTGTCCGCCGCCCGTG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414833_1136414847 24 Left 1136414833 16:30096535-30096557 CCGCGTTTGTCCGCCGCCCGTGC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414834_1136414847 14 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414837_1136414847 7 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414839_1136414847 1 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414840_1136414847 0 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28
1136414843_1136414847 -10 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414847 16:30096582-30096604 CGTGAGGCCGTTTCTCCCGTTGG 0: 1
1: 0
2: 1
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414847 Original CRISPR CGTGAGGCCGTTTCTCCCGT TGG Intronic