ID: 1136414848

View in Genome Browser
Species Human (GRCh38)
Location 16:30096589-30096611
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 894
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 879}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414848_1136414857 -1 Left 1136414848 16:30096589-30096611 CCGTTTCTCCCGTTGGCTCCACT 0: 1
1: 0
2: 1
3: 13
4: 879
Right 1136414857 16:30096611-30096633 TGTACCGGGGGCTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1136414848_1136414860 3 Left 1136414848 16:30096589-30096611 CCGTTTCTCCCGTTGGCTCCACT 0: 1
1: 0
2: 1
3: 13
4: 879
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414848_1136414864 20 Left 1136414848 16:30096589-30096611 CCGTTTCTCCCGTTGGCTCCACT 0: 1
1: 0
2: 1
3: 13
4: 879
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414848_1136414861 11 Left 1136414848 16:30096589-30096611 CCGTTTCTCCCGTTGGCTCCACT 0: 1
1: 0
2: 1
3: 13
4: 879
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414848_1136414858 0 Left 1136414848 16:30096589-30096611 CCGTTTCTCCCGTTGGCTCCACT 0: 1
1: 0
2: 1
3: 13
4: 879
Right 1136414858 16:30096612-30096634 GTACCGGGGGCTGAGGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136414848_1136414855 -7 Left 1136414848 16:30096589-30096611 CCGTTTCTCCCGTTGGCTCCACT 0: 1
1: 0
2: 1
3: 13
4: 879
Right 1136414855 16:30096605-30096627 CTCCACTGTACCGGGGGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414848 Original CRISPR AGTGGAGCCAACGGGAGAAA CGG (reversed) Intronic