ID: 1136414849

View in Genome Browser
Species Human (GRCh38)
Location 16:30096596-30096618
Sequence TCCCGTTGGCTCCACTGTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414837_1136414849 21 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414834_1136414849 28 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414836_1136414849 22 Left 1136414836 16:30096551-30096573 CCCGTGCCCCGCTCAATCCCCGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414844_1136414849 3 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414845_1136414849 -7 Left 1136414845 16:30096580-30096602 CCCGTGAGGCCGTTTCTCCCGTT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414843_1136414849 4 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414846_1136414849 -8 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414838_1136414849 16 Left 1136414838 16:30096557-30096579 CCCCGCTCAATCCCCGCATCAAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414842_1136414849 5 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414835_1136414849 25 Left 1136414835 16:30096548-30096570 CCGCCCGTGCCCCGCTCAATCCC 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414840_1136414849 14 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414839_1136414849 15 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414849 Original CRISPR TCCCGTTGGCTCCACTGTAC CGG Intronic