ID: 1136414849

View in Genome Browser
Species Human (GRCh38)
Location 16:30096596-30096618
Sequence TCCCGTTGGCTCCACTGTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414840_1136414849 14 Left 1136414840 16:30096559-30096581 CCGCTCAATCCCCGCATCAATCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414846_1136414849 -8 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414838_1136414849 16 Left 1136414838 16:30096557-30096579 CCCCGCTCAATCCCCGCATCAAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414843_1136414849 4 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414836_1136414849 22 Left 1136414836 16:30096551-30096573 CCCGTGCCCCGCTCAATCCCCGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414837_1136414849 21 Left 1136414837 16:30096552-30096574 CCGTGCCCCGCTCAATCCCCGCA 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414842_1136414849 5 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414844_1136414849 3 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414835_1136414849 25 Left 1136414835 16:30096548-30096570 CCGCCCGTGCCCCGCTCAATCCC 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414845_1136414849 -7 Left 1136414845 16:30096580-30096602 CCCGTGAGGCCGTTTCTCCCGTT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414839_1136414849 15 Left 1136414839 16:30096558-30096580 CCCGCTCAATCCCCGCATCAATC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1136414834_1136414849 28 Left 1136414834 16:30096545-30096567 CCGCCGCCCGTGCCCCGCTCAAT 0: 1
1: 0
2: 1
3: 18
4: 108
Right 1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414849 Original CRISPR TCCCGTTGGCTCCACTGTAC CGG Intronic
902322681 1:15679656-15679678 TCCCCTTGGCTTCATTGCACTGG + Intergenic
902663311 1:17920431-17920453 ACCCTATGGCTCCACTGTGCTGG - Intergenic
905349784 1:37337522-37337544 TCCCCATGGCTCCACTGAAGGGG + Intergenic
910507669 1:87968613-87968635 TACAGCTGGCTCCACTGGACTGG + Intergenic
912721075 1:112020696-112020718 TCTCCTGGGCTCCACTGGACCGG + Intergenic
1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG + Intergenic
1075993515 10:126858015-126858037 TCTTGTTTGCTCCACTGTAGGGG - Intergenic
1083286437 11:61662145-61662167 TCCCCTAGGCGCCACTCTACAGG - Intergenic
1084092607 11:66888490-66888512 TCCCTTTGCCTCCTCTGTGCTGG - Intronic
1093439222 12:19173658-19173680 TCCCTTTGGCTCCAGGGAACAGG + Intronic
1097091780 12:56511156-56511178 TCCCTTTGGCCCCATTGTAAGGG - Intergenic
1102454352 12:113062729-113062751 TTCCGCTGGCTGCACTGCACGGG - Intronic
1113251691 13:108460311-108460333 TGCCTTTGGCTGCAATGTACTGG - Intergenic
1113549915 13:111184811-111184833 CCCCGTGGGCTTCACTGTGCGGG + Intronic
1117178080 14:53165584-53165606 TCCCTCTGGCTCCACTATCCAGG + Intergenic
1119322369 14:73739567-73739589 TCCCCTTGGTTGCACTGTAGAGG + Exonic
1132738577 16:1399360-1399382 TCCCGCAGGCTCACCTGTACTGG + Exonic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1146467323 17:33096554-33096576 TGCTGTTGGCTTCACTGTGCTGG - Intronic
1153721645 18:7909698-7909720 TCTCATTTGCTCCACTGTAAAGG + Intronic
1156096617 18:33540554-33540576 TCCTGTGGGCTCCACTCTGCAGG - Intergenic
1163263401 19:16204590-16204612 GCCCGTTGGCCACACTGTACTGG - Intronic
927218216 2:20682046-20682068 TCCTGTGGACTCCTCTGTACAGG - Intergenic
927521909 2:23704021-23704043 TGCCGTGGGCTCCACCCTACTGG - Intronic
935753918 2:106262375-106262397 TCCTGATGGCTCCCCAGTACGGG - Intergenic
946348780 2:219133868-219133890 TCCCCTTGGCTCAACTCCACAGG + Intronic
1172192614 20:33071072-33071094 TCCCTTTGGGTCCATTTTACAGG + Intronic
1175660799 20:60810344-60810366 GCCCCTGGGCCCCACTGTACAGG + Intergenic
1176143289 20:63554306-63554328 TCCCCTTGGCTCCCCTGGCCCGG - Exonic
1178064503 21:28889094-28889116 TCCCTTTGGCCCCATTGTAATGG + Intergenic
1178631048 21:34261748-34261770 TCCTGTTGGTGCCACTATACTGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1183191641 22:36325404-36325426 TCCCGGTGGCTCCACCTTACTGG - Intronic
952744984 3:36768653-36768675 TCCCTTTGGCCCCATTGTAATGG + Intergenic
953282917 3:41575952-41575974 TCCCTTTGGCTCCACTGCCAGGG - Intronic
955042771 3:55333187-55333209 TCCCCTTTGCCCCACTGTCCAGG + Intergenic
956506074 3:69941620-69941642 TTCCCTTGGCTGCAGTGTACTGG - Intronic
960571365 3:119188175-119188197 CCCCTTTGGCTTCTCTGTACTGG - Intronic
961355999 3:126340382-126340404 GCCCCTTGGCTCCACAGGACTGG - Intergenic
961727508 3:128942395-128942417 TCCAGGGGGCTCCACTGCACAGG + Intronic
967820034 3:193831804-193831826 TACAATTGGCTCCACGGTACTGG - Intergenic
968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG + Intergenic
968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG + Intronic
969868031 4:10087820-10087842 TCCCATGGGCTCCACGGTTCTGG - Exonic
981446541 4:144845777-144845799 TCCCTTTGGCCCCATTGTAACGG - Intergenic
982108038 4:152028453-152028475 ACCCTTTGGCTCCACTGGATTGG - Intergenic
987739111 5:21882745-21882767 TCCCTTTGGCTCCATTGTAACGG - Intronic
1000295283 5:159908287-159908309 TACCGTTAGCTCCAATTTACAGG - Intergenic
1000327290 5:160182023-160182045 TCCTGTTGGCTCCAATCTGCTGG - Intergenic
1001678974 5:173542479-173542501 TCCTGTGTGCTGCACTGTACTGG - Intergenic
1001726861 5:173910777-173910799 TCACGATGGCTCCACTATAGAGG - Intronic
1006475096 6:34248223-34248245 TCCATTTTGCTCCACTGGACAGG - Intronic
1018016904 6:159720810-159720832 ACCAGATGGCTCCACTATACAGG + Intronic
1018799856 6:167213606-167213628 TCCCGTTGGCTCCGTGGTGCCGG - Intergenic
1018813151 6:167312281-167312303 TCCCGTTGGCTCCGTGGTGCCGG + Intronic
1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG + Intronic
1034478408 7:151302082-151302104 TGCCCTTGGTGCCACTGTACTGG + Intergenic
1036283240 8:7418998-7419020 TCCCTTTGGCCCCATTGTAATGG - Intergenic
1036338231 8:7892523-7892545 TCCCTTTGGCCCCATTGTAATGG + Intergenic
1039490364 8:37942980-37943002 TCCCCTTGGCTCTACTGTCCTGG + Intergenic
1051435908 9:17031386-17031408 TTCCCTTCCCTCCACTGTACGGG - Intergenic
1060000201 9:119951759-119951781 TCCCATTGCCTCCCCTGTTCAGG + Intergenic
1201719156 Y:17078159-17078181 TCCCTGTGTCTCCACTGTGCAGG - Intergenic