ID: 1136414850

View in Genome Browser
Species Human (GRCh38)
Location 16:30096597-30096619
Sequence CCCGGTACAGTGGAGCCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414850_1136414860 -5 Left 1136414850 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414850_1136414858 -8 Left 1136414850 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1136414858 16:30096612-30096634 GTACCGGGGGCTGAGGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136414850_1136414857 -9 Left 1136414850 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1136414857 16:30096611-30096633 TGTACCGGGGGCTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1136414850_1136414864 12 Left 1136414850 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414850_1136414861 3 Left 1136414850 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414850 Original CRISPR CCCGGTACAGTGGAGCCAAC GGG (reversed) Intronic