ID: 1136414856

View in Genome Browser
Species Human (GRCh38)
Location 16:30096607-30096629
Sequence GGCCTCAGCCCCCGGTACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 727
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 706}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414856_1136414861 -7 Left 1136414856 16:30096607-30096629 CCACTGTACCGGGGGCTGAGGCC 0: 1
1: 0
2: 0
3: 20
4: 706
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414856_1136414869 30 Left 1136414856 16:30096607-30096629 CCACTGTACCGGGGGCTGAGGCC 0: 1
1: 0
2: 0
3: 20
4: 706
Right 1136414869 16:30096660-30096682 CAGCTAGTAAGAGGCGAAGCTGG 0: 1
1: 0
2: 40
3: 246
4: 1176
1136414856_1136414864 2 Left 1136414856 16:30096607-30096629 CCACTGTACCGGGGGCTGAGGCC 0: 1
1: 0
2: 0
3: 20
4: 706
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414856_1136414867 21 Left 1136414856 16:30096607-30096629 CCACTGTACCGGGGGCTGAGGCC 0: 1
1: 0
2: 0
3: 20
4: 706
Right 1136414867 16:30096651-30096673 TAGGTTATCCAGCTAGTAAGAGG 0: 1
1: 1
2: 29
3: 168
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414856 Original CRISPR GGCCTCAGCCCCCGGTACAG TGG (reversed) Intronic