ID: 1136414859

View in Genome Browser
Species Human (GRCh38)
Location 16:30096615-30096637
Sequence CCTCCCTGGGCCTCAGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1156
Summary {0: 1, 1: 2, 2: 26, 3: 157, 4: 970}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414859_1136414867 13 Left 1136414859 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 2
2: 26
3: 157
4: 970
Right 1136414867 16:30096651-30096673 TAGGTTATCCAGCTAGTAAGAGG 0: 1
1: 1
2: 29
3: 168
4: 867
1136414859_1136414869 22 Left 1136414859 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 2
2: 26
3: 157
4: 970
Right 1136414869 16:30096660-30096682 CAGCTAGTAAGAGGCGAAGCTGG 0: 1
1: 0
2: 40
3: 246
4: 1176
1136414859_1136414864 -6 Left 1136414859 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 2
2: 26
3: 157
4: 970
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414859 Original CRISPR CCTCCCTGGGCCTCAGCCCC CGG (reversed) Intronic