ID: 1136414860

View in Genome Browser
Species Human (GRCh38)
Location 16:30096615-30096637
Sequence CCGGGGGCTGAGGCCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 925
Summary {0: 1, 1: 0, 2: 10, 3: 80, 4: 834}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414852_1136414860 -6 Left 1136414852 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414843_1136414860 23 Left 1136414843 16:30096569-30096591 CCCGCATCAATCCCGTGAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414848_1136414860 3 Left 1136414848 16:30096589-30096611 CCGTTTCTCCCGTTGGCTCCACT 0: 1
1: 0
2: 1
3: 13
4: 879
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414842_1136414860 24 Left 1136414842 16:30096568-30096590 CCCCGCATCAATCCCGTGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414845_1136414860 12 Left 1136414845 16:30096580-30096602 CCCGTGAGGCCGTTTCTCCCGTT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414844_1136414860 22 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414846_1136414860 11 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834
1136414850_1136414860 -5 Left 1136414850 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1136414860 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 0
2: 10
3: 80
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414860 Original CRISPR CCGGGGGCTGAGGCCCAGGG AGG Intronic