ID: 1136414861

View in Genome Browser
Species Human (GRCh38)
Location 16:30096623-30096645
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 453}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414845_1136414861 20 Left 1136414845 16:30096580-30096602 CCCGTGAGGCCGTTTCTCCCGTT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414848_1136414861 11 Left 1136414848 16:30096589-30096611 CCGTTTCTCCCGTTGGCTCCACT 0: 1
1: 0
2: 1
3: 13
4: 879
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414850_1136414861 3 Left 1136414850 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414846_1136414861 19 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414856_1136414861 -7 Left 1136414856 16:30096607-30096629 CCACTGTACCGGGGGCTGAGGCC 0: 1
1: 0
2: 0
3: 20
4: 706
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414844_1136414861 30 Left 1136414844 16:30096570-30096592 CCGCATCAATCCCGTGAGGCCGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453
1136414852_1136414861 2 Left 1136414852 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1136414861 16:30096623-30096645 TGAGGCCCAGGGAGGTCTCGCGG 0: 1
1: 1
2: 2
3: 38
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type