ID: 1136414862

View in Genome Browser
Species Human (GRCh38)
Location 16:30096628-30096650
Sequence GGGAGCCGCGAGACCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414862_1136414870 23 Left 1136414862 16:30096628-30096650 CCCAGGGAGGTCTCGCGGCTCCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1136414870 16:30096674-30096696 CGAAGCTGGAATTCTCACTGTGG 0: 1
1: 0
2: 4
3: 15
4: 140
1136414862_1136414867 0 Left 1136414862 16:30096628-30096650 CCCAGGGAGGTCTCGCGGCTCCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1136414867 16:30096651-30096673 TAGGTTATCCAGCTAGTAAGAGG 0: 1
1: 1
2: 29
3: 168
4: 867
1136414862_1136414869 9 Left 1136414862 16:30096628-30096650 CCCAGGGAGGTCTCGCGGCTCCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1136414869 16:30096660-30096682 CAGCTAGTAAGAGGCGAAGCTGG 0: 1
1: 0
2: 40
3: 246
4: 1176
1136414862_1136414871 24 Left 1136414862 16:30096628-30096650 CCCAGGGAGGTCTCGCGGCTCCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1136414871 16:30096675-30096697 GAAGCTGGAATTCTCACTGTGGG 0: 1
1: 0
2: 14
3: 24
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414862 Original CRISPR GGGAGCCGCGAGACCTCCCT GGG (reversed) Intronic