ID: 1136414863

View in Genome Browser
Species Human (GRCh38)
Location 16:30096629-30096651
Sequence AGGGAGCCGCGAGACCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414863_1136414870 22 Left 1136414863 16:30096629-30096651 CCAGGGAGGTCTCGCGGCTCCCT 0: 1
1: 0
2: 0
3: 15
4: 130
Right 1136414870 16:30096674-30096696 CGAAGCTGGAATTCTCACTGTGG 0: 1
1: 0
2: 4
3: 15
4: 140
1136414863_1136414869 8 Left 1136414863 16:30096629-30096651 CCAGGGAGGTCTCGCGGCTCCCT 0: 1
1: 0
2: 0
3: 15
4: 130
Right 1136414869 16:30096660-30096682 CAGCTAGTAAGAGGCGAAGCTGG 0: 1
1: 0
2: 40
3: 246
4: 1176
1136414863_1136414867 -1 Left 1136414863 16:30096629-30096651 CCAGGGAGGTCTCGCGGCTCCCT 0: 1
1: 0
2: 0
3: 15
4: 130
Right 1136414867 16:30096651-30096673 TAGGTTATCCAGCTAGTAAGAGG 0: 1
1: 1
2: 29
3: 168
4: 867
1136414863_1136414871 23 Left 1136414863 16:30096629-30096651 CCAGGGAGGTCTCGCGGCTCCCT 0: 1
1: 0
2: 0
3: 15
4: 130
Right 1136414871 16:30096675-30096697 GAAGCTGGAATTCTCACTGTGGG 0: 1
1: 0
2: 14
3: 24
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414863 Original CRISPR AGGGAGCCGCGAGACCTCCC TGG (reversed) Intronic