ID: 1136414864

View in Genome Browser
Species Human (GRCh38)
Location 16:30096632-30096654
Sequence GGGAGGTCTCGCGGCTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414856_1136414864 2 Left 1136414856 16:30096607-30096629 CCACTGTACCGGGGGCTGAGGCC 0: 1
1: 0
2: 0
3: 20
4: 706
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414850_1136414864 12 Left 1136414850 16:30096597-30096619 CCCGTTGGCTCCACTGTACCGGG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414848_1136414864 20 Left 1136414848 16:30096589-30096611 CCGTTTCTCCCGTTGGCTCCACT 0: 1
1: 0
2: 1
3: 13
4: 879
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414845_1136414864 29 Left 1136414845 16:30096580-30096602 CCCGTGAGGCCGTTTCTCCCGTT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414859_1136414864 -6 Left 1136414859 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 2
2: 26
3: 157
4: 970
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414846_1136414864 28 Left 1136414846 16:30096581-30096603 CCGTGAGGCCGTTTCTCCCGTTG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1136414852_1136414864 11 Left 1136414852 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1136414864 16:30096632-30096654 GGGAGGTCTCGCGGCTCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414864 Original CRISPR GGGAGGTCTCGCGGCTCCCT AGG Intronic