ID: 1136414867

View in Genome Browser
Species Human (GRCh38)
Location 16:30096651-30096673
Sequence TAGGTTATCCAGCTAGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1066
Summary {0: 1, 1: 1, 2: 29, 3: 168, 4: 867}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414856_1136414867 21 Left 1136414856 16:30096607-30096629 CCACTGTACCGGGGGCTGAGGCC 0: 1
1: 0
2: 0
3: 20
4: 706
Right 1136414867 16:30096651-30096673 TAGGTTATCCAGCTAGTAAGAGG 0: 1
1: 1
2: 29
3: 168
4: 867
1136414859_1136414867 13 Left 1136414859 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 2
2: 26
3: 157
4: 970
Right 1136414867 16:30096651-30096673 TAGGTTATCCAGCTAGTAAGAGG 0: 1
1: 1
2: 29
3: 168
4: 867
1136414852_1136414867 30 Left 1136414852 16:30096598-30096620 CCGTTGGCTCCACTGTACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1136414867 16:30096651-30096673 TAGGTTATCCAGCTAGTAAGAGG 0: 1
1: 1
2: 29
3: 168
4: 867
1136414863_1136414867 -1 Left 1136414863 16:30096629-30096651 CCAGGGAGGTCTCGCGGCTCCCT 0: 1
1: 0
2: 0
3: 15
4: 130
Right 1136414867 16:30096651-30096673 TAGGTTATCCAGCTAGTAAGAGG 0: 1
1: 1
2: 29
3: 168
4: 867
1136414862_1136414867 0 Left 1136414862 16:30096628-30096650 CCCAGGGAGGTCTCGCGGCTCCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1136414867 16:30096651-30096673 TAGGTTATCCAGCTAGTAAGAGG 0: 1
1: 1
2: 29
3: 168
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414867 Original CRISPR TAGGTTATCCAGCTAGTAAG AGG Intronic