ID: 1136414869

View in Genome Browser
Species Human (GRCh38)
Location 16:30096660-30096682
Sequence CAGCTAGTAAGAGGCGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1463
Summary {0: 1, 1: 0, 2: 40, 3: 246, 4: 1176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136414863_1136414869 8 Left 1136414863 16:30096629-30096651 CCAGGGAGGTCTCGCGGCTCCCT 0: 1
1: 0
2: 0
3: 15
4: 130
Right 1136414869 16:30096660-30096682 CAGCTAGTAAGAGGCGAAGCTGG 0: 1
1: 0
2: 40
3: 246
4: 1176
1136414859_1136414869 22 Left 1136414859 16:30096615-30096637 CCGGGGGCTGAGGCCCAGGGAGG 0: 1
1: 2
2: 26
3: 157
4: 970
Right 1136414869 16:30096660-30096682 CAGCTAGTAAGAGGCGAAGCTGG 0: 1
1: 0
2: 40
3: 246
4: 1176
1136414856_1136414869 30 Left 1136414856 16:30096607-30096629 CCACTGTACCGGGGGCTGAGGCC 0: 1
1: 0
2: 0
3: 20
4: 706
Right 1136414869 16:30096660-30096682 CAGCTAGTAAGAGGCGAAGCTGG 0: 1
1: 0
2: 40
3: 246
4: 1176
1136414862_1136414869 9 Left 1136414862 16:30096628-30096650 CCCAGGGAGGTCTCGCGGCTCCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1136414869 16:30096660-30096682 CAGCTAGTAAGAGGCGAAGCTGG 0: 1
1: 0
2: 40
3: 246
4: 1176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136414869 Original CRISPR CAGCTAGTAAGAGGCGAAGC TGG Intronic