ID: 1136415158

View in Genome Browser
Species Human (GRCh38)
Location 16:30098386-30098408
Sequence CAGTGGTACTTAAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136415158_1136415170 -6 Left 1136415158 16:30098386-30098408 CCCTTTTCCCTTAAGTACCACTG No data
Right 1136415170 16:30098403-30098425 CCACTGGGAGGAGGGGGTATTGG No data
1136415158_1136415171 26 Left 1136415158 16:30098386-30098408 CCCTTTTCCCTTAAGTACCACTG No data
Right 1136415171 16:30098435-30098457 TGCCCCCTTAACTAGTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136415158 Original CRISPR CAGTGGTACTTAAGGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr