ID: 1136415881

View in Genome Browser
Species Human (GRCh38)
Location 16:30103372-30103394
Sequence GCCCTTGACATGATATTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136415873_1136415881 11 Left 1136415873 16:30103338-30103360 CCCCACCAGCCAGATGACCTGGG No data
Right 1136415881 16:30103372-30103394 GCCCTTGACATGATATTGGCAGG No data
1136415879_1136415881 -6 Left 1136415879 16:30103355-30103377 CCTGGGAAAATAGACTAGCCCTT No data
Right 1136415881 16:30103372-30103394 GCCCTTGACATGATATTGGCAGG No data
1136415876_1136415881 9 Left 1136415876 16:30103340-30103362 CCACCAGCCAGATGACCTGGGAA No data
Right 1136415881 16:30103372-30103394 GCCCTTGACATGATATTGGCAGG No data
1136415878_1136415881 2 Left 1136415878 16:30103347-30103369 CCAGATGACCTGGGAAAATAGAC No data
Right 1136415881 16:30103372-30103394 GCCCTTGACATGATATTGGCAGG No data
1136415875_1136415881 10 Left 1136415875 16:30103339-30103361 CCCACCAGCCAGATGACCTGGGA No data
Right 1136415881 16:30103372-30103394 GCCCTTGACATGATATTGGCAGG No data
1136415877_1136415881 6 Left 1136415877 16:30103343-30103365 CCAGCCAGATGACCTGGGAAAAT No data
Right 1136415881 16:30103372-30103394 GCCCTTGACATGATATTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136415881 Original CRISPR GCCCTTGACATGATATTGGC AGG Intergenic
No off target data available for this crispr