ID: 1136418011

View in Genome Browser
Species Human (GRCh38)
Location 16:30115133-30115155
Sequence CCTTGCACCCAGGAGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136418003_1136418011 14 Left 1136418003 16:30115096-30115118 CCGGTTGCAATGGCTCGTCCAGC 0: 1
1: 0
2: 2
3: 3
4: 55
Right 1136418011 16:30115133-30115155 CCTTGCACCCAGGAGTTTTGAGG 0: 1
1: 0
2: 6
3: 50
4: 314
1136418007_1136418011 -4 Left 1136418007 16:30115114-30115136 CCAGCTAGCTGGGAGGATCCCTT 0: 1
1: 0
2: 24
3: 133
4: 413
Right 1136418011 16:30115133-30115155 CCTTGCACCCAGGAGTTTTGAGG 0: 1
1: 0
2: 6
3: 50
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136418011 Original CRISPR CCTTGCACCCAGGAGTTTTG AGG Intronic
900313375 1:2045324-2045346 GCTTGAGCCCAGGAGTTTTAAGG + Intergenic
900656459 1:3761154-3761176 CCTGGGACCCTGGGGTTTTGGGG + Intronic
901139129 1:7016750-7016772 ACTTGAACCCAGGAGGTTGGAGG + Intronic
901266035 1:7911541-7911563 CTTTGGACCCAGTAATTTTGAGG - Intergenic
901343727 1:8519347-8519369 ACTTGAGCCCAGGAGTTTTGAGG + Intronic
901344159 1:8524171-8524193 CATTGCACTGGGGAGTTTTGGGG - Intronic
901946837 1:12711115-12711137 CCTTCCACTCATGACTTTTGAGG - Intergenic
902364136 1:15959687-15959709 ACTTAAGCCCAGGAGTTTTGAGG + Intronic
903782849 1:25833195-25833217 ACTTGAGCCCAGGAGTTTGGAGG - Intronic
904397865 1:30234744-30234766 CCTTCCTCCTGGGAGTTTTGGGG + Intergenic
904591787 1:31619068-31619090 GCTTGCACCCAGGTCTTTTCGGG - Exonic
904638698 1:31904866-31904888 ACTTGAGCCCAGGAGTTTTGAGG - Intergenic
904771350 1:32882953-32882975 GCTTGAGCCCAGGAATTTTGAGG - Intergenic
904946105 1:34199877-34199899 CCTTACATCCAGGGGTATTGGGG - Intronic
905148062 1:35903636-35903658 ACTTGAGCCCAGGAGTTTTCTGG + Intronic
905216421 1:36411426-36411448 ACTTGAGCCCAGGAGTTTGGAGG + Intergenic
905339578 1:37269128-37269150 ACTTGCACACCGGAGTTTGGTGG + Intergenic
905762824 1:40574576-40574598 GCTTGAACCCAGGAGTTTGAAGG - Intergenic
908183818 1:61632536-61632558 GCTTGAGCCCAGGAGTTTTGAGG - Intergenic
908278273 1:62499794-62499816 CCTTTAGCCCAGGAGTTTTGAGG + Intronic
909625693 1:77713465-77713487 CCTTGAGCCCAGGAATTTTGAGG - Intronic
911127452 1:94353687-94353709 CTTTGAGCCTAGGAGTTTTGAGG - Intergenic
911188136 1:94924173-94924195 CCTTTCACCCGGGAGTCCTGAGG + Intronic
911402186 1:97389223-97389245 GCTTGAGCCCAGGAGTTTTGAGG + Intronic
911728783 1:101269964-101269986 CCTTGAGCCCAGGAGTTTGAGGG - Intergenic
912400600 1:109388319-109388341 ACTTGAGCCCAGGAGTTTTGAGG - Intronic
912449488 1:109760445-109760467 CCTTCCACCCAGGCTTCTTGTGG + Intronic
913224402 1:116686336-116686358 GCTTGAGCCCGGGAGTTTTGAGG - Intergenic
914772763 1:150704958-150704980 CCTTGAACCCAGGAGGCTAGAGG + Intronic
915105017 1:153528401-153528423 ACTTGAACCCAGGAGGTTGGAGG + Intergenic
915142778 1:153777417-153777439 CCCTGCAGCCTGGAGTTATGTGG - Intronic
915334440 1:155132745-155132767 GCTTGAACCCAGGAGGTGTGAGG + Intronic
915466199 1:156099530-156099552 GCTTGAGCCCAGGAGTTTTAAGG + Intronic
916275865 1:162992531-162992553 TCTTTCACCCAGGAGTTGTGGGG + Intergenic
917118259 1:171623859-171623881 CCTTGCACTCAGGGGATTTGAGG - Intergenic
917177593 1:172254141-172254163 TCTTGCACCCAGGTAGTTTGAGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919105264 1:193141958-193141980 CCTTAAACAGAGGAGTTTTGTGG + Exonic
919575285 1:199301062-199301084 CCTTCCAAGCAGGATTTTTGAGG + Intergenic
920028619 1:203021113-203021135 GCTTAAGCCCAGGAGTTTTGAGG - Intronic
920751863 1:208685919-208685941 TTGTGCACCCAGGGGTTTTGAGG - Intergenic
920814294 1:209316456-209316478 CTTTCTACCCAAGAGTTTTGTGG + Intergenic
920878543 1:209859209-209859231 CCTCTCACCCAGGACTTTGGAGG + Intergenic
924741499 1:246796724-246796746 ACTTGAGCCCAGGAGATTTGAGG + Intergenic
1064989864 10:21246748-21246770 GCTTGAGCCCAGGAGTTTTGAGG + Intergenic
1065287381 10:24199137-24199159 ACTTGAGCCCAGGAGTTTGGAGG + Intronic
1065309131 10:24397193-24397215 GCTTGAACCCAGGAGGTATGAGG - Intronic
1066039332 10:31530514-31530536 ACTTGAGCCCAGGAGGTTTGAGG - Intergenic
1066447619 10:35498188-35498210 CCCAGCACCCAGGATTTTTATGG + Intronic
1067201063 10:44172523-44172545 CCATGCACCCAGGAGACCTGGGG - Intergenic
1068214189 10:53962291-53962313 ACTTGAAACCAGAAGTTTTGAGG - Intronic
1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG + Intronic
1070997725 10:80800622-80800644 ACTTGAGCCCAGGAGTTTTGAGG + Intergenic
1071713509 10:88072830-88072852 CCTTGGAACCAGGAGATTTTTGG - Intergenic
1071807656 10:89142419-89142441 ACTTGAGCCCAGGGGTTTTGGGG + Intergenic
1073003631 10:100304575-100304597 ACTTGACCCCAGGAGGTTTGAGG - Intronic
1073255931 10:102151341-102151363 CCTTGAGCCCAGGAGTTAAGAGG - Intergenic
1073404616 10:103286250-103286272 GCTTGAGCCCAGGAATTTTGAGG + Intronic
1075906931 10:126089726-126089748 CCTTGCTGCCAGGAGCCTTGGGG - Intronic
1076438931 10:130466119-130466141 ACTTGAACCCAGGAGGTGTGAGG - Intergenic
1077539419 11:3139566-3139588 CCCTGCCCGCAGGAGTTTGGGGG + Intronic
1078173214 11:8946272-8946294 ACTTGAAGCCAGGAGTTTTGAGG - Intergenic
1078240413 11:9526059-9526081 ACTTGTACCCAGGAGATTTGAGG + Intronic
1079097759 11:17521866-17521888 CTTTGCACCCAGGAGTTCAGTGG + Intronic
1079434054 11:20427640-20427662 GCTTGAACCCAGGAGGTTGGAGG + Intronic
1080231041 11:30017537-30017559 CTTTGCACACAGGAGTTGGGAGG + Intergenic
1080657283 11:34267782-34267804 CCTTGCACACGGGGGTTTTTTGG + Intronic
1080838755 11:35964904-35964926 ACTTGAACCCAGGAAGTTTGAGG + Intronic
1080843815 11:36008465-36008487 CCTTTCTCCCAGGAGTTTGTTGG + Intronic
1080871164 11:36238382-36238404 ACCTGCACCCAGGAGTTGAGTGG + Intergenic
1081883289 11:46472371-46472393 CCTAGCACCCAGGTTATTTGCGG - Intronic
1083375582 11:62217606-62217628 CCTTCCACTCATGACTTTTGAGG + Intergenic
1084465764 11:69322099-69322121 GCTTGCACCCAGCTCTTTTGTGG - Intronic
1084619124 11:70256599-70256621 ACTTGAACCCAGGAGTGTGGGGG + Intergenic
1084831604 11:71774073-71774095 GCTTGAGCCCAGGAGTGTTGAGG + Intergenic
1084917090 11:72436903-72436925 CCTTGAGCCCAGGAGGTTTCAGG - Intergenic
1085129529 11:74026222-74026244 ACTTGAACCCAGGAGTTTGCGGG + Intronic
1086666200 11:89486374-89486396 GCTTGAGCCCAGGAGTTTGGAGG - Intronic
1089146262 11:116331565-116331587 ACTTGCCCACAGGAGTGTTGGGG - Intergenic
1089286332 11:117410171-117410193 CCCTGCAGCCAGGAGTTCTATGG + Intronic
1089481897 11:118812465-118812487 CCTTGAGCCCAGGAGGTTAGAGG + Intergenic
1089695244 11:120212365-120212387 CCTTGCACCCAGGGGGCTGGGGG + Intronic
1091174051 11:133544089-133544111 GCTTGAACCCAGGAGTTTTGAGG - Intergenic
1091595654 12:1877353-1877375 CCTTGTACCAAGGGGTTCTGCGG - Intronic
1092189555 12:6508711-6508733 CTTTGCAACCAGTATTTTTGTGG - Intronic
1092586780 12:9908637-9908659 CCTTCCACTCATGACTTTTGAGG - Intronic
1092838421 12:12514750-12514772 ACTTGATCCCAGGAGTTTTGAGG - Intronic
1093774296 12:23054187-23054209 GCTTTCATCCAGGAGTTCTGTGG + Intergenic
1094746220 12:33347077-33347099 GCTTGAACCCAGGAGTTTAAGGG + Intergenic
1095727518 12:45469552-45469574 GCTTGAACCCAGGGTTTTTGTGG - Intergenic
1096222547 12:49840796-49840818 CACTGCACCCAGCAGTTTTTTGG + Intronic
1097103905 12:56609255-56609277 ACTTGAGCCCAGGAGTTTGGAGG - Intronic
1099194584 12:79600562-79600584 ACTTGAGCCTAGGAGTTTTGAGG - Intronic
1099872867 12:88370299-88370321 CCTTGCCCCCATAACTTTTGTGG + Intergenic
1100375131 12:94008057-94008079 CCTGGGACACAGGAGTTTGGCGG - Intergenic
1100459708 12:94787296-94787318 CCTAGCACTCAGGAGGCTTGTGG - Intergenic
1100549509 12:95634134-95634156 CCTCCTAGCCAGGAGTTTTGAGG - Intergenic
1101736144 12:107464803-107464825 CCTTGCACCCAGGGGATGTTGGG + Intronic
1102072617 12:110034517-110034539 TCTTGAACCCAGGAGTTTGAGGG - Intronic
1102409616 12:112706352-112706374 CATTGCACTGAGGAGTTCTGGGG - Intronic
1102760975 12:115384658-115384680 ACTTGAGGCCAGGAGTTTTGAGG + Intergenic
1102812046 12:115832840-115832862 CCTGGCCCCCAGGAGACTTGGGG - Intergenic
1105013165 12:132769386-132769408 CCCTGCACCAAGGAGAGTTGAGG + Exonic
1105793690 13:23829722-23829744 GCTTGAACCCAGGAGTTTGAGGG + Intronic
1106150340 13:27094416-27094438 ACTTGAGCCCAGGAGTCTTGGGG + Intronic
1106813454 13:33382283-33382305 CCTGGCATCCAGGGCTTTTGCGG + Intergenic
1108380369 13:49848695-49848717 GCTTGAGCCCAGGAGATTTGAGG + Intergenic
1109118449 13:58421873-58421895 TCTTGCACCTAGGGGTCTTGGGG - Intergenic
1110752952 13:79137038-79137060 CCTTGAATCCAGGAGTTTGAGGG - Intergenic
1111018714 13:82417444-82417466 ACTTGAGGCCAGGAGTTTTGGGG - Intergenic
1111456675 13:88493437-88493459 CTTAGGACACAGGAGTTTTGAGG - Intergenic
1112558099 13:100487806-100487828 GCTTGAGCCCAGGAGTTTTGAGG - Intronic
1114930584 14:27462613-27462635 CCTTTAACACAGGAATTTTGAGG - Intergenic
1115216573 14:31019223-31019245 ATTTGAACCCAAGAGTTTTGAGG + Intronic
1118537039 14:66778816-66778838 ACTTGAACCCAGGAGGTTGGAGG - Intronic
1119660121 14:76445087-76445109 GCTTGAGCCCAGGAGTTTGGAGG + Intronic
1120194954 14:81470901-81470923 TCTTGAGCCCAGGAGTTTTGAGG + Intergenic
1120847620 14:89139726-89139748 ACTTGAACCCAGGTGTTTGGAGG - Intronic
1120990151 14:90368374-90368396 GCTTGAGCCCAGGAGTTTTGAGG - Intergenic
1121015654 14:90547397-90547419 CCTTGCACACAGGAGCCTTCCGG - Intronic
1121087209 14:91155711-91155733 GCTTGAGCCCAGGAGGTTTGAGG + Intronic
1124423224 15:29540021-29540043 CCGTGCACCCAGGATGTATGGGG + Intronic
1124446846 15:29742168-29742190 GCTGGAGCCCAGGAGTTTTGAGG + Intronic
1126133228 15:45364449-45364471 ACTTGAGCCCAGGAGTCTTGAGG + Intronic
1128867397 15:71124988-71125010 GCTTGAGCCCAGGAGTTTTGAGG + Intronic
1129161332 15:73749607-73749629 CCTTGGACCCAAGAGTTTGGAGG + Intronic
1129249658 15:74301937-74301959 CCTTGCTCAGAGGAGATTTGTGG + Intronic
1131223225 15:90602535-90602557 ACTTGAGACCAGGAGTTTTGAGG + Intronic
1131234762 15:90685910-90685932 GCTTGAGCCCAGGAGTTTTAAGG + Intergenic
1132879599 16:2156120-2156142 CCTGGCACCCGGGAGTCTCGGGG - Intronic
1134199792 16:12188521-12188543 CATTGCACCCAGGATATTTTGGG + Intronic
1135411951 16:22242058-22242080 GCTTGAGCCCAGGAGTTTTGAGG + Intronic
1135836684 16:25832021-25832043 ACTTGGACCCAGGATTGTTGAGG + Intronic
1136108594 16:28050261-28050283 CCTTGAGCCCAGGAGTTTCTTGG - Intronic
1136418011 16:30115133-30115155 CCTTGCACCCAGGAGTTTTGAGG + Intronic
1136531057 16:30869592-30869614 CCTTGAGCCCAGGAGTTTCAAGG - Intronic
1137251503 16:46744422-46744444 GCTTGAACCCAGGAGGTTGGAGG - Intronic
1137541231 16:49363357-49363379 GCTTGAGGCCAGGAGTTTTGAGG - Intergenic
1138336736 16:56259301-56259323 CCTTGCACTCAGGAGGTGTTGGG + Intronic
1138674218 16:58639280-58639302 CCTTGAGCCCACGAGTTTTGAGG + Intergenic
1138677488 16:58662344-58662366 ACTTGAACCTAGGAGTTTTAAGG - Intergenic
1139462726 16:67135559-67135581 ACTTGAGCCCAGGAGTTTTGAGG - Intronic
1140723304 16:77789607-77789629 CCTTGCACCCAGGCTTGGTGAGG + Intronic
1141469570 16:84229213-84229235 ACTTGAACCCAGGAGGTTGGAGG + Intronic
1141807683 16:86352500-86352522 CCCTGCACCCAGGAGCTGGGGGG + Intergenic
1142214019 16:88822097-88822119 CCTTACCCTCAGGAGTCTTGAGG - Intronic
1142577799 17:920978-921000 CCTGTCATCCAGGACTTTTGGGG - Intronic
1142668665 17:1477260-1477282 ACTTGAGCCCTGGAGTTTTGAGG - Intronic
1142761859 17:2046989-2047011 ACTTGAGCCCAGGAGTTTTGAGG + Intergenic
1143759587 17:9091335-9091357 CCTTGAACCTAGGAGTTTTGAGG - Intronic
1145765078 17:27453399-27453421 GCTTGAGCCCAGGACTTTTGAGG + Intergenic
1146394323 17:32450838-32450860 GCTTGAAGCCAGGAGTTATGTGG + Intronic
1148010584 17:44477451-44477473 CCTTGAGCCCAGGAGTTTGAAGG - Intronic
1148626555 17:49073749-49073771 CCTTGAGCCCAGGAGTTGGGGGG + Intergenic
1148663041 17:49351763-49351785 GCTTGAGCTCAGGAGTTTTGAGG + Intronic
1149367225 17:55957833-55957855 CCAGGCACCCAGAACTTTTGGGG + Intergenic
1149480401 17:56998869-56998891 GCTTGAACCCAGGAGTTTGAGGG + Intronic
1149806327 17:59620604-59620626 GTCTGCACCCAGGAGTTGTGGGG + Intronic
1150602793 17:66665002-66665024 CCATGAACCCAGGATTTTTATGG + Intronic
1151632019 17:75317461-75317483 ACTTGAGCCCAGGAGTTTTGAGG - Intergenic
1151852092 17:76697006-76697028 CCTTGGTCCCAGGAGTGTTCAGG + Intronic
1151853930 17:76708724-76708746 GTTTGCAGGCAGGAGTTTTGGGG + Intronic
1151892157 17:76957163-76957185 CCTGGGACACAGGTGTTTTGAGG + Intergenic
1152086419 17:78221977-78221999 CATTGAGCCCAGGAGTTTTGAGG + Intronic
1152505530 17:80747291-80747313 CCATGCACCCAGTAGTGTGGTGG + Intronic
1152625050 17:81384211-81384233 CTGTGCACCCTGGCGTTTTGGGG + Intergenic
1153889387 18:9498585-9498607 GCTTGAGGCCAGGAGTTTTGAGG - Intronic
1156857751 18:41802284-41802306 CCATCCACCAAGGAGATTTGTGG + Intergenic
1157488890 18:48108514-48108536 ACTTGAGCCCAGGAGTTTAGAGG - Intronic
1158719400 18:59910640-59910662 CCTTGAACCCAAGAGTCTAGAGG - Intergenic
1159931552 18:74316945-74316967 ACTTGCACCCAGGAATTTTTTGG + Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1161886969 19:7004618-7004640 CCTTAAACACAGGAGTTTTCTGG + Intergenic
1161995990 19:7711808-7711830 CCTTGAGCCCAGGAGTTGGGAGG - Intergenic
1162384908 19:10354971-10354993 GTTTGAGCCCAGGAGTTTTGAGG + Intronic
1162967363 19:14162232-14162254 ACTTCCACCCAGGATTTTGGTGG + Intronic
1163480472 19:17552848-17552870 GCTTGAGCCAAGGAGTTTTGAGG + Intronic
1164836739 19:31359874-31359896 CCTTGAACCCATGGGTTTTTGGG + Intergenic
1166221080 19:41364956-41364978 CCTTGAACCCAGGAGTTAAGAGG - Intronic
1166600688 19:44092164-44092186 GCTTGAGCCCAGGAGTTTTGAGG + Intergenic
1166855593 19:45781398-45781420 CCTTGCAAGAAGGGGTTTTGTGG + Intronic
1168052657 19:53841119-53841141 GCTGGAGCCCAGGAGTTTTGAGG - Intergenic
1168386927 19:55971355-55971377 CCTTGAACCCAGGAGGCTAGAGG + Intronic
1168705742 19:58469405-58469427 CCTTGCAGCCAGGAGCCATGTGG + Intronic
1168708074 19:58480876-58480898 CCTTGCACCCAGGTCTTTTGGGG - Exonic
926179256 2:10626095-10626117 ACTTGAGCCCAGGAGTTTGGAGG + Intronic
926602805 2:14864232-14864254 ACTTGCACCCAGGAGGTAGGAGG + Intergenic
927642508 2:24854331-24854353 CATATCACCCAGGGGTTTTGGGG + Intronic
927735689 2:25519279-25519301 TCTTGAGCCCAGGAGTTTTGAGG + Intronic
927883249 2:26703630-26703652 CCTGGCACACAGGAGATTTCGGG - Intronic
927948480 2:27151716-27151738 CCTTGAGCCCAGGAGTTTGAGGG - Intronic
928021697 2:27710359-27710381 ATTTGGGCCCAGGAGTTTTGAGG - Intronic
930669588 2:54134208-54134230 CCTTGAGCCCAGGAGTTTGAGGG + Intronic
931337643 2:61364277-61364299 ACTTGAGCCCAGGAGTTTTGAGG + Intronic
931517496 2:63058664-63058686 CCTTACACCCAGGAGGTTTCAGG - Intergenic
931590903 2:63882258-63882280 CCTTGCACACAGTAGTTCAGTGG - Intronic
932250477 2:70238984-70239006 ACTTGAACCCAGGAGTTAAGAGG + Intronic
932399135 2:71467444-71467466 CCTTGACACAAGGAGTTTTGAGG + Intronic
932973878 2:76576937-76576959 CCTTGCCCCCAGAACTGTTGTGG - Intergenic
934729944 2:96650124-96650146 CCTGGGGCCCAGGAGGTTTGAGG - Intergenic
935031597 2:99328176-99328198 TCTTGAGCCCAGGAGGTTTGAGG - Intronic
935048080 2:99499494-99499516 CCTTCCACTCATGACTTTTGAGG + Intergenic
935334417 2:102002006-102002028 CCTTGTTCCCAGAAGTTTTTAGG - Intronic
936442523 2:112567357-112567379 CCTTTCACCCAGGAGTTTGTTGG + Intronic
936574216 2:113640061-113640083 CCTTGAGCCCAGGAGTTTTGAGG + Intronic
937873355 2:126802326-126802348 GCTTTCGCCCAGGAGTTTGGGGG + Intergenic
937988723 2:127650446-127650468 CCTGCCACCCAGGAGATCTGAGG - Intronic
938955864 2:136297603-136297625 CCTTGCACCCAGGGGAATTTAGG - Intergenic
939259203 2:139784894-139784916 ACTTCCACACAGGAATTTTGAGG + Intergenic
939855445 2:147353408-147353430 ACTTTCACCCAGAAGTATTGAGG - Intergenic
939940678 2:148347289-148347311 GCTTGAGCCAAGGAGTTTTGAGG + Intronic
940529399 2:154861031-154861053 CCTTGAGCCCAGGAGTTTGGGGG + Intergenic
944560679 2:200934395-200934417 CCTTGTGCCCAGGAGGTTGGGGG - Intronic
944781330 2:203021002-203021024 GCTTGCACCCAGAAGGTTGGAGG - Intronic
945428478 2:209736828-209736850 CCTGGAAGCCAGGACTTTTGAGG - Intergenic
946405095 2:219488289-219488311 CCTTTCATCCAGGAGATGTGCGG - Exonic
948304514 2:236936531-236936553 CCCCTCCCCCAGGAGTTTTGTGG + Intergenic
948787298 2:240359236-240359258 CCTGGCACCCAAGAGTTCTTTGG + Intergenic
1170098807 20:12675877-12675899 GCTTGAGCCCAGGAGTTTGGGGG + Intergenic
1170799212 20:19576643-19576665 CCAAGCACTCAGGACTTTTGAGG - Intronic
1172246813 20:33451171-33451193 GCTTGAACCCAGGAATTTTGAGG - Intergenic
1172255214 20:33511799-33511821 ACTTGAGCCCAGGAGTTCTGAGG + Intronic
1172383618 20:34516740-34516762 CCCTGCAGCCTAGAGTTTTGGGG + Intronic
1172410294 20:34716531-34716553 ACTTGAGCCCAGAAGTTTTGAGG + Intronic
1172712267 20:36934739-36934761 ACTTGAACCCAGGAGGTTGGTGG - Intronic
1173976559 20:47191114-47191136 CCATGCACACAGGAGGTTTTGGG + Intergenic
1174206155 20:48840904-48840926 ATTTGAGCCCAGGAGTTTTGAGG - Intergenic
1175721126 20:61287942-61287964 CCTTGCACCCCAGAGTGTGGTGG + Intronic
1175923903 20:62462740-62462762 CCAGGCACCCAGCAGGTTTGAGG + Intergenic
1178971220 21:37178875-37178897 ACTTGAGCCCAGGGGTTTTGAGG + Intronic
1179835740 21:44031560-44031582 CTTTCCTCCCAGGAGTTATGGGG + Intronic
1181965927 22:26656822-26656844 GCTTGAACCCAGGAGTTCGGGGG + Intergenic
1182081741 22:27534088-27534110 TCATGCACCCAGGAGGTTGGGGG + Intergenic
1183913810 22:41100149-41100171 TCTTGAGCCCAGGAGTTTTGAGG + Intronic
1184270962 22:43383165-43383187 ACTTGAACCCAGGAGTTGGGAGG + Intergenic
1184721169 22:46314369-46314391 ACAGGCACCCAGGAGTTATGGGG - Intronic
1185425957 22:50770831-50770853 CCTTGAGCCCAGGAGTTTTGAGG - Intronic
949971992 3:9415779-9415801 ACTTGAGGCCAGGAGTTTTGAGG - Intronic
950068409 3:10132284-10132306 GCTTGAGCCCAGGAGTTTTGAGG + Intergenic
950413189 3:12852459-12852481 TCTTGCAGTCAGGAGTTTCGAGG - Intronic
950438916 3:12995959-12995981 ACTTGAAGCCAAGAGTTTTGAGG + Intronic
951202220 3:19888307-19888329 CCTTGAACCCAGGAGTTCAAGGG + Intronic
951528332 3:23675053-23675075 GTTTGAGCCCAGGAGTTTTGAGG - Intergenic
952911400 3:38191126-38191148 ACTTGAACCCAGGAGTTTTGAGG - Intronic
953938926 3:47073065-47073087 TCTTGAGCCCAGGAGGTTTGAGG + Intronic
954157940 3:48697759-48697781 CCTTGAGCCCAGGAGTTTGAGGG - Intronic
954182732 3:48894341-48894363 ACTTGAACCCAGGAGGCTTGTGG - Intronic
956689968 3:71867126-71867148 CATAGTACCCAAGAGTTTTGGGG - Intergenic
958791309 3:98654327-98654349 ACTTGAGCCCAGGAGTTTGGAGG + Intergenic
960160660 3:114347133-114347155 ACTTGAGCCCAGGAGTTTCGAGG - Intronic
961298828 3:125908497-125908519 GCTTGAGCCCAGGAATTTTGAGG + Intergenic
963164959 3:142191912-142191934 ACTTGAGCCCATGAGTTTTGAGG + Intronic
964419184 3:156483309-156483331 CCTTGCACAGAGGATTTCTGTGG + Intronic
965223169 3:165953747-165953769 CCTTTCATTCAGGAGTTTTGAGG - Intergenic
965783010 3:172307608-172307630 ACTTGAACCCAGGAGTTTCAAGG + Intronic
966620506 3:181958414-181958436 CCTTGTGCCCAAGAGTTTTAGGG - Intergenic
968244121 3:197124657-197124679 GTTTGAACCCAGGAGTTTGGGGG - Intronic
968681119 4:1920650-1920672 GCTTGAGCCCAGGAGTGTTGAGG + Intronic
968738298 4:2311857-2311879 GCTTGAACCCAGGAGTTTGAGGG - Intronic
969675128 4:8610335-8610357 CCCTGCACCCCAGGGTTTTGGGG + Intronic
973228258 4:47811294-47811316 CCATGCACCCAGAGGTTCTGGGG + Intronic
973627456 4:52787345-52787367 GCTTGAGCCCAGGAGTTTGGAGG - Intergenic
973894717 4:55400060-55400082 CCTTGAGCCCAGGAGTTTGAGGG - Intronic
973938362 4:55875845-55875867 ACTTGAGCCCAGGAGTTTGGGGG + Intronic
973964965 4:56152614-56152636 TCTTGCACCCAGGAGTTCAAGGG + Intergenic
975170415 4:71226225-71226247 GCTTGAGCCCAGGAGCTTTGAGG - Intronic
976545665 4:86333026-86333048 CCTTGTGCCCAGGAGTTTGAGGG - Intronic
978409810 4:108415173-108415195 CCCTACTCCCAGGAGATTTGGGG + Intergenic
980423077 4:132589980-132590002 CCTTGAGCCCAGGAGTTTGAGGG - Intergenic
980705355 4:136485843-136485865 CCTTAGACCCAGGACTTATGTGG + Intergenic
982180409 4:152744420-152744442 CCTTGCCCCCATAACTTTTGTGG - Intronic
982249096 4:153386412-153386434 ACTTGAGCCCAGGAGTTTTGAGG + Intronic
982449483 4:155535222-155535244 CCTTGCACACATGAGTTGTATGG - Intergenic
984573187 4:181417812-181417834 CTTTGCACCCAGGATTATTTTGG - Intergenic
985047818 4:185958007-185958029 CCTGGCTCCCAGGAGTTGAGTGG - Intergenic
985085485 4:186308650-186308672 ACTTGCATGCAGGAGATTTGGGG + Intergenic
985678197 5:1243072-1243094 CGCTGCACCCAGCAGTCTTGGGG + Intronic
985886566 5:2684772-2684794 CCCGGCACCCATGAGTTGTGGGG - Intergenic
986650475 5:9958809-9958831 CCTTGATCCCAGGACTTTTTGGG + Intergenic
989160971 5:38391479-38391501 ACTTGAACCCAGGAGGTTTGAGG - Intronic
990553309 5:56905554-56905576 GCTTGAACCCAAGAGTTTGGAGG + Intergenic
992899235 5:81276977-81276999 ACTTGAGCCTAGGAGTTTTGAGG - Intergenic
993646155 5:90465661-90465683 CCTTGAGCCCAGGAGTTCAGGGG - Intronic
997164773 5:131648236-131648258 ACTTGAGCCCAGGGGTTTTGAGG + Intronic
997989177 5:138529834-138529856 ACTTGAACCCAGGAGTTTCCAGG - Intronic
998929553 5:147165759-147165781 CTTTGCACCAATGAGATTTGGGG + Intergenic
998985784 5:147754932-147754954 GCTTGCATCAAGGAGCTTTGGGG + Intronic
999878199 5:155831896-155831918 ACTTGCACTCAGAAGTCTTGTGG + Intergenic
1001951177 5:175817712-175817734 CTTTGCCCTCAGGAGTTGTGCGG + Intronic
1002906854 6:1456184-1456206 CCTTGCAGCCAGGTGTACTGTGG + Intergenic
1003075614 6:2981416-2981438 CCCTGCTCCCTGGAATTTTGAGG + Intergenic
1005361069 6:25031212-25031234 GCTTGAGCCCAGGAGTTCTGGGG - Intronic
1006085888 6:31594701-31594723 CCTTGAGCCCAGGAGTTTCAAGG + Intergenic
1006152184 6:31995532-31995554 CCTTGCACCCAGAACCTTTCTGG - Exonic
1006158486 6:32028270-32028292 CCTTGCACCCAGAACCTTTCTGG - Exonic
1007318559 6:41009639-41009661 CATAGCAACTAGGAGTTTTGAGG - Intergenic
1007344235 6:41216351-41216373 CCTTGTAGTCATGAGTTTTGAGG - Intergenic
1007612314 6:43158382-43158404 GCTTGAGCCCAGGAGTTTAGAGG + Intronic
1010468607 6:76198694-76198716 GCTTGAACCCAGGAGTTTAAGGG + Intergenic
1011445565 6:87435740-87435762 CCTTGAACCCAGGAGTTGGAAGG - Intronic
1012226969 6:96715929-96715951 CATTACACCCAGGTGTTGTGAGG + Intergenic
1012461940 6:99473462-99473484 ACTTGAACCCAGGAGGTTGGAGG + Intronic
1012690947 6:102309785-102309807 CCTTGATCCCAGGAGTTTGAGGG + Intergenic
1012750489 6:103156226-103156248 GCTTGAACCCAGGAGGGTTGTGG + Intergenic
1015128050 6:129776455-129776477 ACTTGGGCCCAGGAGGTTTGAGG - Intergenic
1016112488 6:140242286-140242308 CCTTGAGCCCAGGAGTTTCAGGG - Intergenic
1016237466 6:141886343-141886365 CCTCTTTCCCAGGAGTTTTGGGG - Intergenic
1017941328 6:159055698-159055720 GCTTCCACACAGGAATTTTGGGG + Intergenic
1019749954 7:2722893-2722915 GCTTGAGCCCAGGAGTTTTGAGG + Intronic
1020512335 7:9073382-9073404 ACCTGCACCCAGGATTGTTGAGG - Intergenic
1022563899 7:31377486-31377508 TCTTGAGCCCAGGAGTTTTGAGG - Intergenic
1023907949 7:44535444-44535466 ACTTGTGCCCAGGAGTTTTGAGG + Intronic
1023950492 7:44840109-44840131 CTTTGAACCCAGGAGGTTTGAGG + Intronic
1026083138 7:67240222-67240244 GCTTGGGCCCAGGAGATTTGAGG - Intergenic
1026761619 7:73131114-73131136 ACTTGAACCCAGGAGTTAAGAGG + Intergenic
1026772817 7:73213004-73213026 GCTTGAACCCAGGAGGTTGGAGG + Intergenic
1026950898 7:74346059-74346081 GCTTGAACCCAGGAGTTTGAGGG - Intronic
1027013681 7:74766404-74766426 GCTTGAACCCAGGAGGTTGGAGG + Intergenic
1027037959 7:74939930-74939952 ACTTGAACCCAGGAGTTAAGAGG + Intergenic
1027074357 7:75179629-75179651 GCTTGAACCCAGGAGGTTGGAGG - Intergenic
1027085602 7:75261545-75261567 ACTTGAACCCAGGAGTTAAGAGG - Intergenic
1028018506 7:85743497-85743519 CCTTCCACTCATGACTTTTGGGG - Intergenic
1028393087 7:90337454-90337476 GCTTGAGCCCAGGAGTTTTGAGG - Intronic
1028593813 7:92527572-92527594 CCATGCATCCAGGATTTATGAGG + Intronic
1029561466 7:101305777-101305799 GCTTGAACCCAGGAGGCTTGAGG - Intergenic
1029582111 7:101443952-101443974 ACTGGAGCCCAGGAGTTTTGAGG - Intronic
1029637501 7:101794718-101794740 CCTTGAGCCCAGGAGTTTGAGGG + Intergenic
1030399144 7:109026732-109026754 CCTTGCATCCATGAATTCTGAGG + Intergenic
1030664932 7:112266227-112266249 CCTTGAACCCAGGAGATGGGAGG - Intronic
1031340337 7:120592453-120592475 GCTTGAACCCAGGAGGTTTCAGG + Intronic
1031910734 7:127514168-127514190 CCTTGGGCCCAGTGGTTTTGTGG - Intergenic
1032105181 7:129022299-129022321 ATTTGAGCCCAGGAGTTTTGAGG + Intronic
1033432508 7:141301882-141301904 CCTCGAACCCAGGAGTTGTTTGG - Intronic
1034626337 7:152495803-152495825 ACTTGAGCCCAGGAGTTTTGAGG + Intergenic
1036048406 8:5168908-5168930 CCTGGAACACAGCAGTTTTGAGG - Intergenic
1036096324 8:5728430-5728452 CCTTGAACACAGGAGTGATGAGG + Intergenic
1039242641 8:35573358-35573380 ACTTGAGCCTAGGAGTTTTGGGG + Intronic
1040391064 8:46950852-46950874 CCTTGAGCCCAGGAGTTTGAGGG + Intergenic
1043464883 8:80494840-80494862 CCTTGAACCCAGGAGGTTGAGGG + Intronic
1046002845 8:108442879-108442901 CCATCCACCCAGGAGTAATGAGG + Intergenic
1047157921 8:122342389-122342411 ACTTGGGCCCAGGAGGTTTGAGG - Intergenic
1047540297 8:125758734-125758756 CCTAGCACACAGGGTTTTTGCGG - Intergenic
1047860092 8:128956428-128956450 GCTTGAACCCAGGAGTTCAGGGG + Intergenic
1049711948 8:144068781-144068803 CCTTGCAGCCAGGAGCTGGGAGG - Intergenic
1051084476 9:13332154-13332176 ACTTGAGGCCAGGAGTTTTGAGG + Intergenic
1051610358 9:18956021-18956043 GCTTGAGCCCAGGAATTTTGAGG - Intronic
1053249755 9:36564610-36564632 GCTTGAACCCAGGAGGTTGGAGG - Intergenic
1055109751 9:72548100-72548122 CCTTCAACACAGGAATTTTGGGG + Intronic
1055590184 9:77804447-77804469 GCTTGAACCCAGGAGTTTCAGGG + Intronic
1055725574 9:79224621-79224643 CCTTGCAACCATCAGTTCTGGGG + Intergenic
1056282812 9:85058442-85058464 CCTTGCTCTCTGGAGGTTTGAGG + Intergenic
1056703540 9:88932052-88932074 CCTGGCACCCAGGAGGGTTGAGG + Intergenic
1057167005 9:92936460-92936482 CCTTGAGCCCAGGAGTTTGAGGG - Intergenic
1058017236 9:100048156-100048178 CCTTGAGCCCAGGAGTTGGGTGG + Intronic
1058969438 9:110066613-110066635 CCTTGAGCCCAGGAGTTCTAAGG + Intronic
1059616362 9:115955730-115955752 GCTTGAACCCAGGAGGTTGGAGG + Intergenic
1060005844 9:119998649-119998671 CCATGTTCCCAGGAGATTTGGGG - Intergenic
1060276928 9:122189511-122189533 TCTTGAACCCAGGAGTTCAGAGG + Intronic
1061047143 9:128172062-128172084 CCTTGAGCTCAGGAGTTCTGAGG + Intronic
1061500163 9:130997417-130997439 CCCTGCAGCCTGGAGCTTTGGGG - Intergenic
1186183595 X:6996748-6996770 ACTTGAACCCAGGAGGTTTGAGG - Intergenic
1186417597 X:9397411-9397433 CCTTGAGCCCAGGAGTTTGGAGG - Intergenic
1189820847 X:44868870-44868892 ACTTCCACCCAGCAGTTGTGAGG - Intergenic
1190641191 X:52483483-52483505 CCTGGGCCCCTGGAGTTTTGGGG - Intergenic
1190646481 X:52529382-52529404 CCTGGGCCCCTGGAGTTTTGGGG + Intergenic
1195924812 X:110014864-110014886 CCTTTCACCCAGGAGCTCTGGGG - Intronic
1198499768 X:137231985-137232007 CCTTGCAAGCAGGAGTTTGTTGG + Intergenic
1198789673 X:140330629-140330651 GCTTGAACCCAGGAGTTTGAGGG - Intergenic
1199815222 X:151391764-151391786 CCTTGCACCCAGCAGGTGTCGGG - Intergenic
1201344295 Y:12966315-12966337 CCTTGATCCCAGGACTTTAGAGG + Intergenic
1201980040 Y:19897021-19897043 CTTATCACCTAGGAGTTTTGAGG - Intergenic