ID: 1136418342

View in Genome Browser
Species Human (GRCh38)
Location 16:30116935-30116957
Sequence GATCACAGTGGAGGAAGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136418342_1136418350 7 Left 1136418342 16:30116935-30116957 CCAGCGCTTCCTCCACTGTGATC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1136418350 16:30116965-30116987 TGGGGTTAAAGGTTAACATCCGG 0: 1
1: 0
2: 0
3: 12
4: 148
1136418342_1136418355 29 Left 1136418342 16:30116935-30116957 CCAGCGCTTCCTCCACTGTGATC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1136418355 16:30116987-30117009 GTCCAGCAGGTCAAGGGCTATGG 0: 1
1: 0
2: 0
3: 16
4: 173
1136418342_1136418353 23 Left 1136418342 16:30116935-30116957 CCAGCGCTTCCTCCACTGTGATC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1136418353 16:30116981-30117003 CATCCGGTCCAGCAGGTCAAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1136418342_1136418352 22 Left 1136418342 16:30116935-30116957 CCAGCGCTTCCTCCACTGTGATC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1136418352 16:30116980-30117002 ACATCCGGTCCAGCAGGTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 71
1136418342_1136418348 -4 Left 1136418342 16:30116935-30116957 CCAGCGCTTCCTCCACTGTGATC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1136418348 16:30116954-30116976 GATCCGTTTATTGGGGTTAAAGG 0: 1
1: 0
2: 0
3: 2
4: 44
1136418342_1136418351 16 Left 1136418342 16:30116935-30116957 CCAGCGCTTCCTCCACTGTGATC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1136418351 16:30116974-30116996 AGGTTAACATCCGGTCCAGCAGG 0: 1
1: 0
2: 1
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136418342 Original CRISPR GATCACAGTGGAGGAAGCGC TGG (reversed) Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900721548 1:4179181-4179203 GAGCACTGTGGAGGAGGGGCAGG - Intergenic
900891993 1:5456272-5456294 GATGCCCGTGGAGGAAGCGGTGG + Intergenic
900945913 1:5831353-5831375 GGTCACAGAGGAGGAAGCCAAGG + Intergenic
901470485 1:9452634-9452656 CAGCACAGTGGAAGGAGCGCTGG + Intergenic
904081668 1:27876327-27876349 GAACTCAGTGGAGGAGGCACGGG + Intronic
906299674 1:44672918-44672940 TTTCACAGTGGAGGAATCTCAGG + Intronic
907589242 1:55650270-55650292 GATCACTTTGGAGGAAGGGAGGG - Intergenic
908131430 1:61079679-61079701 GAGAGCAGTGGAGGAAACGCAGG - Intronic
908959822 1:69683113-69683135 GAAAACACTGGAGGAAGCTCAGG - Intronic
908991166 1:70091642-70091664 CATCACAGTGGAAGAATTGCAGG - Intronic
910825847 1:91406190-91406212 GATCACAGTGCAGGCAGATCCGG - Intergenic
913369179 1:118077884-118077906 AGACACAGTGGAGGAAGCACTGG + Intronic
915553548 1:156648599-156648621 GCTGACATTGGAGGAAGCACGGG + Exonic
918180142 1:182080341-182080363 GATGATAGTGGAGGAAGTGTGGG + Intergenic
919022631 1:192126988-192127010 GAGCACAGAGGAGGAAGAGTGGG - Intergenic
920274777 1:204796016-204796038 GATCTCAGTGGAGGAGGAGCAGG - Intergenic
1063540892 10:6932754-6932776 GCTCCCAATGGAGGAAGCACTGG - Intergenic
1064119453 10:12606191-12606213 GACCACAGGGGAGGGAGCGCGGG + Intronic
1066661085 10:37738718-37738740 GATCACGGTGTGGGAAGGGCTGG - Intergenic
1071985119 10:91042615-91042637 GAACACAGAAGAGGAAGAGCAGG + Intergenic
1072577844 10:96716877-96716899 GATCACAGCAGAGGAAGGGGAGG + Intronic
1073062233 10:100739731-100739753 GATGACTGTGGAGGTAACGCCGG + Intronic
1075486010 10:122822478-122822500 GATCAGAGTGGAAGAAGGGCAGG + Intergenic
1076070303 10:127483356-127483378 GAGCACAGGGGAGAAAGTGCCGG - Intergenic
1078071026 11:8110596-8110618 GAACACAGTGAAGAAAGTGCAGG + Exonic
1081809025 11:45905056-45905078 GATGGCAGTGGAGGAGGCACGGG + Intronic
1082790850 11:57345932-57345954 GAGAACAGAGGAGGAAGCGGGGG - Intronic
1083096890 11:60260148-60260170 GAGCACAGTGGAGGCAGGGACGG - Intergenic
1084090324 11:66875412-66875434 GCTCACAGAGGGGGAAGAGCAGG + Intronic
1084111085 11:67014638-67014660 GATCACAGTGGAGGTAGGACTGG + Intronic
1090641658 11:128734558-128734580 CACCACAGTGCAGGCAGCGCGGG - Intronic
1090969859 11:131631723-131631745 AATCACAGTGGAGGAAAAGGAGG - Intronic
1091048588 11:132347920-132347942 GAGGACAGTGGAGGACGTGCAGG - Intergenic
1091727300 12:2855047-2855069 GATAACAGTGGATGAAGGTCAGG + Intronic
1092168228 12:6356106-6356128 TATCACAGAGGAGGAAGCTAAGG + Intronic
1092456144 12:8644706-8644728 GAGCACAGTGGAGGAGAGGCAGG - Intronic
1097911051 12:64969415-64969437 AGTTACAGTGGAGGAAGGGCTGG + Intergenic
1098171752 12:67753869-67753891 GCTCACAGTTTAGGAAGAGCTGG - Intergenic
1099337384 12:81380649-81380671 GTTCATAGTGGAAGAAGCACAGG + Intronic
1101660440 12:106760296-106760318 GATCAGAGGGGAGGAAGGGGAGG - Intronic
1101939228 12:109087362-109087384 GCTCACAGTGCAGGAAGCCCAGG + Exonic
1110483358 13:76009692-76009714 GGTGGCAGTGGAGGAAGGGCAGG - Intergenic
1110909141 13:80933496-80933518 AATCATAGTGGAGGGAGAGCGGG + Intergenic
1112365997 13:98755978-98756000 GATCACAGTTTAAGAACCGCTGG - Intergenic
1113801661 13:113089808-113089830 CTTCACACTGCAGGAAGCGCAGG - Intronic
1114141995 14:19922773-19922795 GATCACAGGGGAGACAGCACAGG - Intergenic
1121227000 14:92328429-92328451 GTGCACAGAGGAGGATGCGCTGG + Intronic
1123101886 14:105809041-105809063 GGACACAGGGGAGGAAGGGCAGG + Intergenic
1125467622 15:39969993-39970015 TTTCACAGAGGAGGAAACGCAGG - Intronic
1127426773 15:58865558-58865580 TATCACAGAGAAGGACGCGCTGG + Intronic
1128659370 15:69486896-69486918 GGTCACAGTGAAGGAAGTGTGGG + Intergenic
1132434515 15:101786931-101786953 GATCACACTGGAGGAAGTTATGG - Intergenic
1133116789 16:3582159-3582181 GAGCCCAGAGGAGGAAGCCCTGG + Exonic
1133320665 16:4911455-4911477 GATCAAAGTGGAGGCTGGGCGGG - Intronic
1134439838 16:14292722-14292744 AATCAAAGTGGAGGAGGCACTGG - Intergenic
1136418342 16:30116935-30116957 GATCACAGTGGAGGAAGCGCTGG - Exonic
1136479873 16:30534575-30534597 GATCCGAGTGGAGAAAGCCCGGG - Exonic
1138238626 16:55407671-55407693 GAGCACAGAGCAGGAAGAGCGGG + Intronic
1141775845 16:86122028-86122050 GATCAAAGTGGAGAAGGGGCAGG - Intergenic
1142703084 17:1676337-1676359 CATCACAGCGGAGGAAGCAGTGG - Exonic
1144675968 17:17161886-17161908 GATCTCAGTGGAGGTATCCCGGG - Intronic
1144678893 17:17179752-17179774 AGTCACAGTGCAGGAAGCCCTGG + Intronic
1144938564 17:18919829-18919851 GAACACAGTGGAAAAAGCACAGG - Intronic
1146793765 17:35767142-35767164 GATGGCAGTGGAGAAAGCTCTGG - Intronic
1147570452 17:41567478-41567500 GGTCATAGTGGAGGAAGTGGGGG - Exonic
1148159413 17:45441584-45441606 GACCACAGTCGTGGAAGCCCTGG + Intronic
1148204999 17:45774626-45774648 GATCCCCGTGGAGGAAATGCAGG - Intergenic
1149613103 17:57972276-57972298 GACCACTGTGGAGGAAGCCTGGG + Intronic
1149847532 17:60016475-60016497 GATCCCAGGGGAGGTAGGGCGGG - Intergenic
1149993837 17:61396911-61396933 GCACACAGAGGAGGAAGCGGCGG + Intergenic
1150035761 17:61795372-61795394 GATCACAGGGGAGGAGGGGTTGG - Intronic
1150390748 17:64788669-64788691 GACCACAGTCGTGGAAGCCCTGG + Intergenic
1150870416 17:68903157-68903179 CATCACAGTGGAAGAAGCACAGG - Intronic
1151315301 17:73318207-73318229 GGTCACAGTGGGTGAAGCTCTGG - Intergenic
1151456874 17:74231784-74231806 GCTCACAGTGAAGGATGCTCTGG + Intronic
1152205847 17:78974014-78974036 ACTCACAGTGGGGGAAGCCCAGG - Intronic
1152233975 17:79128937-79128959 GATCACAGTGAAGAAACCTCTGG + Intronic
1152355336 17:79804123-79804145 GACCACAGTGGAGGACGCCGAGG - Intergenic
1153212852 18:2787129-2787151 TATCACAGTAGATGAAGAGCTGG + Intronic
1154080929 18:11255904-11255926 GCTCAGAGTGGAGGAAAAGCTGG - Intergenic
1159845652 18:73456567-73456589 GATTACAGTGTAGAAAGAGCAGG + Intergenic
1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG + Intronic
1162986251 19:14272050-14272072 GATCAGAGTGTAGGCAGAGCAGG - Intergenic
1165509519 19:36257895-36257917 GATCGCCGGGGAGGCAGCGCGGG + Intergenic
1165511047 19:36266857-36266879 GATCGCCGGGGAGGCAGCGCGGG + Intergenic
1165631238 19:37304144-37304166 GATCGCCGGGGAGGCAGCGCGGG - Intergenic
1167089035 19:47330553-47330575 AAACAGAGTGGAGGAAGCCCTGG + Intergenic
927907926 2:26875339-26875361 GAGCACAGTGGTGGGAGTGCAGG + Intronic
928443610 2:31313808-31313830 GTTGACAGTGGAGGAAGCTGGGG - Intergenic
929957498 2:46469891-46469913 GAGCTCAGTGGAGGAGGCGGAGG - Intronic
942379780 2:175376787-175376809 GATCAGAGTGGAGCAAGGGAAGG - Intergenic
944441977 2:199752114-199752136 AATCACAGGGGAGGAAGCTGGGG - Intergenic
946487020 2:220110551-220110573 GTTCACAGAGGAGGAAACTCAGG + Intergenic
947752149 2:232538780-232538802 GCTCAGAGAGGAGGAAGCTCAGG + Intergenic
1170015649 20:11778875-11778897 GATAACAGTGAAGGAAGGGCAGG + Intergenic
1172428101 20:34869776-34869798 AATGGCAGTGGAGGAAGAGCAGG + Intronic
1172512625 20:35511284-35511306 GAACACAGAGCAGGAAGAGCTGG + Intronic
1173155637 20:40606311-40606333 GGGCACAGTGGAATAAGCGCAGG - Intergenic
1173882339 20:46425065-46425087 GATGTCAGAGGAGGAAGCGTGGG + Intronic
1174387770 20:50197498-50197520 GCTCACAGGTGAGGAAGCCCAGG - Intergenic
1174464556 20:50707243-50707265 GATCACTGTGGAGGATGAACTGG + Intergenic
1176705745 21:10119275-10119297 GATCGCCGGGGAGGCAGCGCGGG - Intergenic
1179093900 21:38294023-38294045 GACCACAGTCGAGGGAGCCCAGG + Intronic
1180623216 22:17176078-17176100 TGTCACAGTGGAGGCAGAGCTGG - Intergenic
1181452494 22:23033334-23033356 GAACTCAAGGGAGGAAGCGCTGG - Intergenic
1182094676 22:27618036-27618058 GATCATAGTGGAGAAAGGGAAGG + Intergenic
1182856673 22:33523395-33523417 GTTCACAGAGGAGGAAATGCAGG - Intronic
1183441186 22:37823967-37823989 GTTCACAGTGGAGGAGGGGAAGG - Intronic
1183951075 22:41353501-41353523 GATGACAGTGGAGGACCCTCGGG + Intronic
1184111760 22:42399640-42399662 GGTCACAGTGGAGGCTGGGCCGG + Intronic
1184303994 22:43582645-43582667 GATAATAGTGGAGGCAGCACAGG + Intronic
1185204737 22:49531336-49531358 GGGCACCGCGGAGGAAGCGCAGG + Intronic
949357474 3:3197319-3197341 GACCACTGTAGAGGAAGCCCTGG + Intergenic
950670086 3:14520728-14520750 GATAGCAGTGGAGGAGGGGCAGG + Intronic
953410851 3:42689756-42689778 CATCACAGTGTAAGAAGCCCTGG - Intronic
954853754 3:53625432-53625454 GAACACAGTGAGGGAAGTGCTGG - Intronic
963634105 3:147772068-147772090 GGTCACAGTTGAGGAAGCAAAGG + Intergenic
964721878 3:159775480-159775502 GATCTCAGAGGAGGAAGCAAGGG - Intronic
965688860 3:171334003-171334025 GATAACAGTGGTGGGAGAGCTGG - Intronic
966554981 3:181248906-181248928 AATCACAGTGGTGAAAGGGCAGG - Intergenic
968691541 4:1992731-1992753 GAGGACAGTGAGGGAAGCGCTGG - Intronic
970531348 4:16988639-16988661 GGAGACAGTGGAGGAAGAGCAGG + Intergenic
971750977 4:30647408-30647430 GATCATAGCGGAGGAAGTACAGG - Intergenic
979380959 4:120006117-120006139 GAGCACAGTGAAGGAGGAGCAGG + Intergenic
980355162 4:131727777-131727799 GATCGCCGGGGAGGCAGCGCGGG + Intergenic
986327148 5:6684873-6684895 GAACACAGTGGAGCAGGCACCGG - Intergenic
987100604 5:14588311-14588333 GCTCACAGGGGAGGAAGCTGAGG + Intronic
990212246 5:53493031-53493053 GATGACAGTGGAGGAAGCTGAGG - Intergenic
990626920 5:57623977-57623999 GTTCACAGTGGAGGCAGTGGGGG + Intergenic
990649919 5:57886893-57886915 AATTACAGTAGAGGAAGCACGGG - Intergenic
992444352 5:76820253-76820275 GATCACAGTGGCGCGATCGCAGG - Intronic
997428572 5:133821663-133821685 GGGCACTGTGGAGGAGGCGCAGG + Intergenic
998092998 5:139381841-139381863 GATCACAGTGGAGGGGTGGCGGG + Intronic
999098772 5:149005060-149005082 GACCACAGTGGAGGGAGAGAGGG - Intronic
999695498 5:154185387-154185409 GCTAACAGTGGAGGAAGATCTGG + Intronic
999697716 5:154201256-154201278 TATCACGGTGGAGGCAGGGCAGG + Intronic
1001453737 5:171845463-171845485 GATGACAGGGAAGGAAGCACAGG - Intergenic
1005066473 6:21822894-21822916 GACCACAGTGGAGGAGGTGGTGG + Intergenic
1007777892 6:44233965-44233987 GAACACAGAGGAGGAGGCGCAGG - Exonic
1012422439 6:99079508-99079530 AATCACAGTGGTGGAAGAGTTGG + Intergenic
1017470445 6:154733441-154733463 GAAGACAGAGGAGGAAGCGCTGG - Exonic
1018042027 6:159933326-159933348 GATCATAGTGGAGGAGGAGCTGG - Intergenic
1018196829 6:161362489-161362511 GTTCTCAGTGGAGGAAGCCAGGG + Intronic
1019574782 7:1732128-1732150 GGTCACAGCGGAGCAAGCACAGG + Intronic
1022536671 7:31102687-31102709 GATCACAGAGGAAGAAACTCGGG - Intronic
1022776444 7:33532284-33532306 GAATACAGTGGAGCAAGAGCTGG + Intronic
1026736313 7:72950915-72950937 GAGCCCAGTGGAGGAGGCACGGG + Exonic
1026786668 7:73305969-73305991 GAGCCCAGTGGAGGAGGCACGGG + Intronic
1026903867 7:74051653-74051675 GATCACACTGGTGAAAACGCCGG + Intronic
1027107420 7:75414147-75414169 GAGCCCAGTGGAGGAGGCACGGG - Intergenic
1029677557 7:102080800-102080822 GATCACTCTGAAGGAAGTGCTGG - Intronic
1029987056 7:104931781-104931803 GAAAGCAGTGGAGGGAGCGCAGG + Intergenic
1031688792 7:124764514-124764536 GATCTCAGAGGAGGAAGAGAAGG - Exonic
1035655464 8:1301839-1301861 GACCACAGCAGAGGCAGCGCGGG + Intergenic
1035978121 8:4335888-4335910 GATCATATTGCAGGAAGCCCTGG - Intronic
1036781374 8:11650198-11650220 GGTTACAGTGGAGGAAAAGCTGG + Intergenic
1038554097 8:28494476-28494498 GATCCCTGAGGAGGAGGCGCCGG - Intronic
1039823921 8:41157120-41157142 GATCAGGGAGGAGGAAGCCCAGG + Intergenic
1041200983 8:55451886-55451908 GATCTCAGTGTCGGAAGAGCTGG - Intronic
1044341522 8:91051342-91051364 TATCTCACTGGAGGAAGTGCTGG - Intergenic
1053643029 9:40106392-40106414 GATCGCCGGGGAGGCAGCGCGGG - Intergenic
1053763119 9:41359096-41359118 GATCGCCGGGGAGGCAGCGCGGG + Intergenic
1054323879 9:63703619-63703641 GATCGCCGGGGAGGCAGCGCGGG - Intergenic
1054541729 9:66270211-66270233 GATCGCCGGGGAGGCAGCGCGGG + Intergenic
1054726291 9:68654335-68654357 GATCACAGTGGAGGATGCCAGGG + Intergenic
1056957637 9:91095472-91095494 GCTCACTGTGGAGGAAGTTCTGG + Intergenic
1057997032 9:99828291-99828313 GATCAAAGTGGAGGAGGGGCGGG + Exonic
1059326111 9:113504947-113504969 GAGCACAGGGGAGGAAACACTGG - Intronic
1061520926 9:131117408-131117430 GATCTCTGTGCAGGAAGCACCGG - Intronic
1061579847 9:131530209-131530231 GATCACAGTTGTGGCAGGGCAGG + Intronic
1062064979 9:134521866-134521888 TATCAGAGTGGAGGATGGGCCGG + Intergenic
1062377233 9:136267687-136267709 GCTCACAGTCGGGGAAGCGAGGG - Intergenic
1202790779 9_KI270719v1_random:89364-89386 GATCGCCGGGGAGGCAGCGCGGG - Intergenic
1185659886 X:1719386-1719408 GATGAGAGTGGAGGAAGAGGAGG + Intergenic
1186451844 X:9680460-9680482 TATCACAGAGGAGGAAATGCAGG + Intronic
1190301104 X:49058094-49058116 GATCACAGTGGCAGAAGAGCAGG - Intronic
1197303949 X:124817694-124817716 GAGCATAGTGGAGAAAGCGAAGG - Intronic
1199708259 X:150449794-150449816 GTTCCCAGTGGAGGAAGCCTGGG - Intronic
1199848625 X:151709462-151709484 GGTCACAGTTGAGGAAGAGCAGG + Intergenic
1200832804 Y:7704126-7704148 GCTTACAGTTGAGGAAGGGCAGG + Intergenic